Tuesday, April 3, 2012

3122.txt

date: Mon, 19 Jul 2004 12:17:08 +0100
from: Sarah Raper <sraperatXYZxyz-bremerhaven.de>
subject: my ppt for climate sensitivity workshop
to: Tom Wigley <wigleyatXYZxyz.ucar.edu>


--Apple-Mail-4-259479166
Content-Transfer-Encoding: 7bit
Content-Type: text/plain;
charset=US-ASCII;
format=flowed

Dear Tom,

Please find my ppt for the climate sensitivity workshop. You will see
I'm going ahead with the subtitle (don't quite know why I want to do
it) but I'm just going to leave it as silent subtext.
More important I have added at the end a new figure. It shows effective
climate sensitivity for the CMIP2 runs I analysed for all 4 decades of
available data. It shows where the 1.7 to 4.2 range comes from and ask
the question whether this is a good definition for the AR4.

The first 2 slides are just definitions - I imagine that Jonathan will
already have covered this but maybe with different notation.
Then I show the 2 figures you already saw but building them up one
graph at a time. Finally the CMIP2 figure.
The workshop has grown to 112 participants! I will attach the draft
program in following email.


--Apple-Mail-4-259479166
Content-Transfer-Encoding: base64
Content-Type: application/vnd.ms-powerpoint;
x-mac-type=534C4438;
x-unix-mode=0644;
x-mac-creator=50505433;
name="Presentation1.ppt"
Content-Disposition: attachment;
filename=Presentation1.ppt

0M8R4KGxGuEAAAAAAAAAAAAAAAAAAAAAPgADAP7/CQAGAAAAAAAAAAAAAAAFAAAAGgIAAAAAAAAA
EAAAHgIAAAEAAAD+////AAAAAOABAADfAQAAIAIAABwCAAAbAgAA////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
//////////////////////////////////////////////////////////////////////////+a
T8/+ffPpruNsN9tFkd4jqX9+6soTf8x2GY/jRbyDT7HWTDbDzpiHI3AizsbFuBq34l48hhfwNj7B
GjPVFDthXxyOE3AWFuMq3IJ78Ciex1v4GNNmVhPsiH1wGI7HmbgIS3EzluMRPIc38RFWm40aYwfs
jUNxHM7AIizBTViGh/Es3kDB12Z2DrbHXjgEx+J0XIgrcSPuxkN4Bq/jQ3xl5mRjO8zFwTgGp+EC
XIEbcBcexNN4DR/gS7NxI2yLPXEQjsapOB+X43rciR4r8Crexxdmkyxsgz1wII7CKTgPl+E63IEH
8BRewXv43GyawtbYHQdgAU7GQlyKa3E77seTeBkr8ZnZLImtsBv2x5E4CefiElyD23AfnsBLeBer
zOYJ/LHakWpaH3/qdjXvNij+6a5E0aC42//qsuNkJ+L5P1zj6L6zv7Pb/cH1dU1cKrtgTtGc33zl
XEr/tHC/dH/tspyLnMt1pxN/mRig9/x3/fq373c28QvrrHocL+IdfIq1pnVW7Yx5OAIn4mxcjKtx
K+7FY3gBb+MTrDGts2on7IvDcQLOwmJchVtwDx7F83gLH2PatM6qHbEPDsPxOBMXYSluxnI8gufw
Jj7CatM6q3bA3jgUx+EMLMIS3IRleBjP4g0UfG1aZ9X22AuH4FicjgtxJW7E3XgIz+B1fIivTOus
2g5zcTCOwWm4AFfgBtyFB/E0XsMH+NK0zqptsScOwtE4FefjclyPO9FjBV7F+/jCtM6qbbAHDsRR
OAXn4TJchzvwAJ7CK3gPn5vWWbU1dscBWICTsRCX4lrcjvvxJF7GSnxmWmfVVtgN++NInIRzcQmu
wW24D0/gJbyLVaZ1Vv1IZxM/t84mfv4Zne1dnujvPtlRoaNCR4WOCh0VOip0VOio0FGho0JHhY4K
HRU6KnRU6KjQUaGjQkeFjgodFToqdFToqNBRoaNCR4WOCh0VOip0VOio0FGho0JHhY4KHRU6KnRU
6KjQUaGjQkeFjgodFToqdFToqNBRoaNCR4WOCh0VOip0VOio0FGho0JHhY4KHRU6KnRU6KjQUaGj
QkeFjgodFToqdFToqNBRoaNCR4WOCh0VOip0VOio0FGho0JHhY4KHRU6KnRU6KjQUaGjQkeFjgod
FToqdFToqNBRoaNCR4WOCh0VOip0VOio0FGho0JHhY4KHRU6KnRU6KjQUaGjQkeFjgodFToqdFTo
qNBRoaNCR4WOCh0VOip0VOio0FGho0JHhY4KHRU6KnRU6KjQUaGjQkeFjgodFToqdFToqNBRoaNC
R4WOCh0VOip0VOio0FGho0JHhY4KHRU6Kh/t6H06ev9zOlqW+NtPdjT5O+uoehwv4h18irWmdVTt
jHk4AifibFyMq3Er7sVjeAFv4xOsMa2jaifsi8NxAs7CYlyFW3APHsXzeAsfY9q0jqodsQ8Ow/E4
ExdhKW7GcjyC5/AmPsJq0zqqdsDeOBTH4QwswhLchGV4GM/iDRR8bVpH1fbYC4fgWJyOC3ElbsTd
eAjP4HV8iK9M66jaDnNxMI7BabgAV+AG3IUH8TRewwf40rSOqm2xJw7C0TgV5+NyXI870WMFXsX7
+MK0jqptsAcOxFE4BefhMlyHO/AAnsIreA+fm9ZRtTV2xwFYgJOxEJfiWtyO+/EkXsZKfGZaR9VW
2A3740ichHNxCa7BbbgPT+AlvItVpnVU/UhHk7+1jiZ/+3m/j/7skx1N5VpH1eN4Ee/gU6w1raNq
Z8zDETgRZ+NiXI1bcS8ewwt4G59gjWkdVTthXxyOE3AWFuMq3IJ78Ciex1v4GNOmdVTtiH1wGI7H
mbgIS3EzluMRPIc38RFWm9ZRtQP2xqE4DmdgEZbgJizDw3gWb6Dga9M6qrbHXjgEx+J0XIgrcSPu
xkN4Bq/jQ3xlWkfVdpiLg3EMTsMFuAI34C48iKfxGj7Al6Z1VG2LPXEQjsapOB+X43rciR4r8Cre
xxemdVRtgz1wII7CKTgPl+E63IEH8BRewXv43LSOqq2xOw7AApyMhbgU1+J23I8n8TJW4jMJfYY5
taorDsBROBnn4BJci5vwKzyMZ/Ay3sGn2KJG67E/jsQkzsbFuAY34i48hKfxEt7GJ9isVnfBfjgC
J+EsXISrcQPuxIN4Ci/iLXyMTWpNZ+yLw3EizsSFuArX4w48gCfxa7yJjzCr1nbCPjgMJ+AMXIAr
MY3bcT+ewAt4Ax9ioxqrw944FMfjdJyPKzCF23AfHsfzeB0f4Cu1Loa9cAh+hNNwHi7HdbgV9+Ix
PIfX8D6+VDvVYk8cjONwKn6Cy/Bz3IJ78Ciexat4D1+onWuwBw7CsTgF5+JS/Aw34248ghm8gnfx
udqlGrvjQByDfxs1pg/ppTn1E7Ohy/Sx/qsbIgfG+vz8F1ProzPi2783dcFdKf46TLvfmeGmk4nW
fvzpik//ebExUfmvq5ltRppqYwJjBpuDkZroz0b+lbz23+TjX9smXuQDTTzxGeZUTTxxAI7CyTgH
l+Ba3IRf4WE8g5fxDj7FFlUTT+yPIzGJs3ExrsGNuAsP4Wm8hLfxCTarmnhiPxyBk3AWLsLVuAF3
4kE8hRfxFj7GJlUTT+yLw3EizsSFuArX4w48gCfxa7yJjzCrauKJfXAYTsAZuABXYhq34348gRfw
Bj7ERlUTT+yNQ3E8Tsf5uAJTuA334XE8j9fxAb5SNfHEXjgEP8JpOA+X4zrcinvxGJ7Da3gfX6qa
eGJPHIzjcCp+gsvwc9yCe/AonsWreA9fqJp4Yg8chGNxCs7FpfgZbsbdeAQzeAXv4nNVE0/sjgNx
DLaTeJGRmniRkR1IvKH/IYE22rwx0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSzJJol0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSzJJol0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSzJJol0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSzJJol0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSzJJol0SyJZkk0S6JZEs2SaJZEsySaJdEsiWZJNEuiWRLNkmiWRLMk
miXRLIlmSTRLolkSzZJolkSz7SbaNyTaNx1LtJ/KEu1NiVb1pSaa+AxzqiaaOABH4WScg0twLW7C
r/AwnsHLeAefYouqiSb2x5GYxNm4GNfgRtyFh/A0XsLb+ASbVU00sR+OwEk4CxfhatyAMFQc8NQB
AAD298gq0BgX2NnUS6b9J3qIOWtjRC5cr75Je4Wmj4xP67wCAAAAAAAAAAAAAEICAABMAAAAOAJw
AFC6DgCSAQAAAP54nI1QsU4bQRScPVvGRFiK01GAHlVscAy2RBMFCXDAsmKjmAYKFHE6r+2Vjj3L
XlvQUSNoCaTCRXo+gPxDqhTIVRS6NJFS5/LuDE6KyOSt5rSzb/Zm9lk3CKpsrSNp+VPwfwHW6hBB
WfvPnoabPmqol4rbSxDM9phFim271cwt4z/KYsQZ4tPMx7tH1Vc4DTHLXk9GKSbC3hJcvBbfkivI
c4ZX4ntygztxXsPOILkMEgOUw90cDH/7OEcsiC2Cd3xA3P/CcfZDpwtkMIlIrCi17NlAhFcCLWQR
BXxgYe9ndVM1um1JuZdUct1ux7RtozxNXp1MU5Ks16VjHphr69qi50hbU1PahuSh07R1Q5LjsVA5
SmpD7HvJeP+PZLdMpu+TzV+LFMZoPzN5fq9N4BjpvNgdpw/+fTLSt5DeimZo52DMja9MUqMbW0iJ
d+KH9SL/iMtE7i+XhepmYfFNmnhif8alejwRVx3YRlJH6o7iE2WOqNtRukGVtWKpUCDT1bJGxqO3
hUp25HiFsxD+b3VDkXwwVBzw6jIAAB8fOFUa0H5bhhWi3/KNoQQbHIPlwKnM6n7xBR8EU5DjvvAA
AAAAAAAAAAAACQEAANoAAAB8WjMA2D4qAKgyAAAA/nic7Jp7vJTT/sfXs555vs/uOonjGrORIz8k
cgg5o6MjjtB2j8RWEadSqRTVTOkmldJFhXQTUoqihBpR6HJKuXTD4LhzDD/V7L1nz3M+37XWzDyz
L8rrOJ1/9q691/uz1vOsZz1rfdflM69JrBT8s8OqJQ6SXl3hpYWQF+hf/qHNBRcrmCU6i9suaXNl
M2FBdYCy2/Qu7tn19DPEfvxI/Bbg13rt6Llz93n1TDFG/R6DZ9XOtsJFDQWiULS15jjjrTlMbh9n
vNtHHCcecFu2EJxac1pwW6cI4mZazNNFgfcZRCtV81RxiqglbGrTpUeXfsVC2PhXT7QTTUVACE+I
JuJZy7HPaNoM107D7yPiOGuNrt1asx+1N7G+wv2nN/1T7n5b6vttuT/3243V/b7nB8L6/kB4f+4P
FOP+Zv7nOwP1/c7A/bnfmaHuzz3fXG/Vz17/AQb0SHO9GSH1U0/05PanlzZsW9yjcyH/XtGpS3GP
wiaXniTyxnKqaMgcOFOMN+kYERejnEOsQ4QlfxS//r+gRMiglywVtUuFcNOeSJSJAmCk3CsTtcuQ
l0JeSmEYmE6JgjJR6olouaidQjEwoTEETJWLAmCkxENeORqa9EQsLRoA7bQn4/xXxFWGHfS8ZDqT
1C8XMux5KSEjXlrLiIfnStfztPS8aJkIeF5MiPppIW0vVSoCIS+upeslIPEXXZfmV4qWCNtLClE3
LaxwOinscFqLSDLJD9XCS0C4XlTUQ8haXgwKf0VdKNuL7sVT46KOzT2zB+1LaE6BQ4aT4KDhONg2
HANbCVGbObpbAGth4rq/CKunIgI1UxQANfi1IcKlwipXia0TVydBnYTQ1Xi3QrxsWGOzJA+gwhZA
jEUdYMsSYVmG/wy2DYfBQbDqqWipsEIZEYcIZwT614qkjUDAWB4Gux6LVBne1UsalS7jwUkYhSjC
2MTL1SCFvGiKxyamJSClMtW1PIQpPAIxUE+NbxLKQ7zxpeph/BeF5Zxdrh6iVQRN5IekVJygvkzd
LAGZJ9dTlyVMs+qpKpIcEWmtUD2HBF6nbkoQL994Ky0iiBfcqgUqE0EvrgXqFyEvVibqpITD8Rf2
ShVz9EXSmlGp4HitzRGcttR8A0Y8m8OWMeyN9OIag94mL1aqJx9mC0YEM44nTomoVcbx6aVLeI5i
RiQ1YKZoCHtxDWiVBpcnglvKo51UqYW5QCVCpHTSXyeImAIOhb3oyt8d9rkIVfifmxX5M0XPHt+U
8s+0SjPQPzP9M9bM5LwpXmH2+xeGSktGdjHJX2cqLEIVl6gKC1jl5c23+FVaHCstn76lNbfc5pZg
38KcW6xzC7hvWc8t9b7lP7Ml/NZx+5/8R2tFJMXhxm9QZiCcgYgCvLBVasDOgFsJghkIGcC6gThw
y3hN3KvScNqkyfw0kjBpvJo09tvScCaN56ehTGqeF8ykph1uSqe2aaeNdheo9Tmq5z9HOafhhE5D
WAj0isFLBwdJphN+V9j/AfXtcxE9hlZmMEN5o0qlonTfg6vGlCM+WIbg14h6BLakumVYy9MiEg3y
nlMmXCwRkail9iOocFxEYvifVWGs9HGjYqyCCaOirFyjIlCYqck8lTIKD48LK09xqzIqUVFFsiqY
r5IVFfb++pi8GYVN0Eg3Va1EwytIO129jGGlw1Nz0vJJfi0sl15GJjjUlOQ2cpO8OJ8+lEKtXsI2
Cjs3ZnDQrzzP9IINFc4qS6tUToWUqluKHToueLHUAj2OhTWhBVpme3wEYeFyM3mE65RiW0bn83nD
3cMTKLW/6w0mE+/PJbxrxywcO1RdWNitpGaXGQutejozP1C1S4mYenras8E6noSllY4gXuUrq2Sm
f5LhmJXpA+zzHIpZpaLS9FYopaIyo5KsbKOwAarx8yvh+SM9q2IZpeJHq8ygV5TRAyu9/GZkgi3X
5Jyy8l4uX2UCMZTIU0l/9wVT/q5FAPNikMoMifANgquGJDNcOOCFY3ZGYdzCsSAPrAkAFZe892IL
EzGNvEtHzYKXQnRyXrBc79ylvDZ6IqnRKtfejLdA7N048fJuGEpjP6+FYwmiHsdXN8m717528zp8
RMRxgutjDjKnNIeZPRXO2J/4cKTD2fKU0AukNEoHNM4+SukQxilHqWRVKqhVSq3HVgg9rP4ogUss
NyNQl2UbEcZjlJnJE3XUxpnSjsfHddXGynYCEaJElJ3GgRZ5LciIiu2s+s2UUB3gVdU1eQI9aQWN
4FXVMpHJh1U+zGbjNC6yo4A4RROCZrygeO1mxdulpbdLBGRZNkgjuSAN+4M0pdHND9K4jsxwJjLd
bGSG9xmZ+nCSKlFN4fNvQhuicDlu5ZOuhabAjKlDLzCpUZ11NeK0IDAQ6tBcqhrDaJfqyVOuzgjc
cBzDC7BcJ3nvSKfMqTyt3CPeMKjO7Dh823oDMUd6lWsMrfKnfJLKSD7h2xlps0OVlrHG7Mw4DpLa
UbseTzQjgulSPY4sQimejhnBxts1LjzEltxO+/y57XfulhERWEEdd5UEzIsOz18VnhKYpfxpgZfU
C8KB5LxG/IaGV//meR2U13V5nZrf3Wog0lUMUXbw8se1wqBXERL+gMkPp6qizReMFULVF8QVQjsT
8L5pkD85fFPGTKTc5PJNuMwk/J/7varXCInW7+ET/+8NfJwL8qFN74VOiF22OdrhyMkfIZi9MGr2
Ql52LbXsaoth8dlf7V4sXF6qg0mzOvOK7qZ8ws5sg2rhz6zoMSOq298URytwpPy/tYf9+oamRNwn
Km9i+7Gj+Tcx/jxSnQlym1hmS3N5ivjOxhzQuS3tP9zEzEkLO9d/uIXVfFhR82FFzYcVNR9WHPAP
K2p24pqduGYnrtmJa3bimp24Zic+0Duxu1svsDXpfzc98N9cENlvdM0UY9X36wqdqdYcZ6rbRxSK
1tYc0Vp9l661GxAtxHHOLSr99W+L8TfnmlADess+velZuW+cidZ0o2jE3zjTqWjtLNF1qnQf30Cj
Bk4/1HeGvz6ntq5Pp6J1oFjXp9J91hdobDdr2sJfn/2yrk+n0A10fSrdZ31yK+o701+f7Krr0yl6
c5WuT6X7rM8aWtU37nzX8zfuemb7vKc4eWO3Q9t0u+vW4m6Ffbp079mld3Gfvr276O/ZVRzlI4W9
YQOqKnJ6Wkuc8dZWUWT9bM+WDe3VoBcCJ1hbAn8FjQn0tRYEJoN6BRZZEwKbQB0Cu6yBgRTob46w
7nQKQS2dkNXBCYNOc86xrnDagxo77azWTk/QUU4n6zznftDBTl+rucP11XGGWyc7T4IcZ6J1AmKg
SKSdmdYxTgxU4iywjnA2gH5xllmHOB+CfnRWW0HnM9C3znqrtvMd6Etnq0XO/4M+d3ZZtoNWiU+c
z4VHNmin860oo9qgbc5PIkkHgd539orddBhoi1MufqajQZtxdYKOB22kAvEDNQGtp/riO2oKepsa
iq/pDNBa3PclnQ16kxqJf1JL0Go6VnxGrUAxaizi1Bq0EjV8TBeDXqVTxS66DLSCmokd1A70MjUX
2+kq0DLU9SFdB3qJzhUf0A2gpXS+eI9uAr2AWrdQMeh5ulC8S51Ai+kitPY20CK6RGyiO0ALqS3a
3Q20gC4XG6gH6FniN+gFmo8nraO7QU/TtXiXfoquB/UHzcMz19K9oCfxzDU0CDSXOuL9BoPm4Olv
0BBFnUAYQTGLOovXaZii20EjQU9QV7GKRim6EzQaNAMtWkljQI9Td/EajQU9RnehRx5S1As0AfQo
2vYKTQRNpz7opUmgaWjlyzQFNBWtXE5TFQ0ATQM9gvYuo+mKBoIeA01By1+ix0GT0fIXaYaiKGgm
aBLeYSnNAk3EOyyhOQLxKR6m4ehjRKCYQCPQx/MUjQI9DRoPWmxoNGi+ogdBz4IewpstogWgcXiz
52ihonGg50Bj8Y4LaZGi8aDFoDH0MMbnBUUTQRzvD4KeNTQJtFTRZNCLoNHogfn0kqKpoOWgB0DP
GJoGelnRdNAK0Ch6FGP7CmgkeuUpelXR46DXFM0ArQSNAM0z9ARoFWg4eupJiimaBXpd0WwQVgQx
DH02l95Av7VXai7Um6D70X9zaI2ieaC1oKH0lJhNbyl6GvS2uWsIPYOYeUfRfNA6UBS9OZPWq/Io
+nMmbVC0ELQRFEF/PkH/UOWDwTPATItAmxQtBm1W5YPoecTau4peAG0xuUvAWxUPBD8GZloKeg90
H/r6UXpfld+H3n6UPlC0DPShyV0O3ga6FzQdxLkD0PfTaLvhFeAdhl8B71TcHyMwlXYpeg30kcq9
Bz3/CH2sekXrVdCfKO6HEZhCccOvgz81vBr8meK+GIfJ9Lm5uw/UJCimN0H/NLlrwF8YXgv+UvHd
4IlgprdAX5nct8Ffg3qDHjb0Dugb08r2Kmcdcr5V3AtjNoG+MyW9MGoT6Pus2gj1g+KeGK/x9K9s
HXdBP6Q08ybwj4Y3gxPZq96F+klxD/A4MNMW0M/mmh4Yx3HEK3930FhQrqXdMbJjYaAy6n2o3aBu
oDGg9oo/AO/J3vN3jPaDtDertkEls2o7VInvCXciZ7TKYd4BLvWV7YQu8+ld0Lwz3QF6AKTz70A8
PEDlRnVFRIyidPYZuWd1RWyMIi+rb0d8jHSFT38KbRl1G9QIKKbPQNJX022IkxGuXcUzuiBuhuNs
58/5AjmO4s7gYYq1+hKKfNd2RhwNc928nK+RU5DVnaDvh2b6BlSrUhsy132L0tq+nFsRZUPdOnlX
3YpYG+rWNaoYaohP/QBVL+/6YkTcELd+Nc+8BaVRlDL9CApWKk8gt4Him8ERxZnSmxGbEfegvDtu
RpRG3IYV6rkZMRpxD87qjtCDszr/2o6I3sHuIVXk70b+H3w5NyFnkMph3gM+tNJdNyGuB7mHKe4A
Hqg4V94BkT7QPbzSfR0Q4QPdI6rsNy6/EeX3ZctZl0IfWcWVN2A+3OseVWVJCiWNqsgvR/7RVd6R
RskxRrWHGmBUdf+KxPW4qj+uYvJAoaqvwqzq7xZWWWKh5Nhq7pIoOw50HegeUOVrrsOsu8c9vprW
XYeZd4/buNrWX4vyflWUc4mDkhOqKLkGJX1VCTOB/1hN7ddg5vZ1T6y2tAClTaopvRozuY97UqWS
nM+wRllwGj6fEfjenu3UZZ8RGBA4ITCNfUageaBv4Cr2GQERWBQoZJ9hbw/sskvYZ9jLHWFvY59h
z3BC9kr2GfZI5xz7KfYZ9t1OO3si+wy72OlkD2GfYV/p9LV7s8+wWzvD7c7sM+wWzkT7evYZ9inO
TLst+wz7WGeB3Yp9hn24swxXwGfYQWe1fRr7DNt11tsnss+QnrPVDrHPkElnF65Fq+RPzuf2Qewz
5HfOt3Yd9hnyC+cn22GfIT9x9kqPfYbc4ZTLUvYZ8n2y5W72GXIzFcgE+wwJnyGVz5BvUUP5FfsM
+QYdJj9nnyFXUSP5CfsM+QodK3eyz5DLqbHcxj5DLqUm8j32GfJ5OlW+yz5DLqRmciP7DDmfmst1
7DPkU3Q2aofPkE/SuXIN+ww5i86Xr7PPkE9QKzwHPkM+RhfKV9lnyOl0kVzBPkM+QpfIZewz5GRq
K19knyEn0uVyCfsMOZ6K5GL2GXIcXSWfY58hx9C1cgH7DDmarkcr4DPkKLpBPs0+Q46gm+Q89hly
GHWUc9lnyKFULGezz5BDqBNahhGUEeqMlsFnyEF0u3ycfYYcSF3RRvgMeS/diTbCZ8gB1E1OY58h
76HuaC18huxHd8kp7DNkH+olJxF8huxNd8uH2WfIXtRHTmCfIXtSP7wBfIa8i/rLh9hnyO40QI4l
+AzZje7Fu8BnyL/TQPkg+wx5Jw3CW8FnyK40GG8FnyFvp6gcyT5D3kZD8H7wGbIL3S+H48xcJDuD
hinqRMMln5eLZDGNwJvCb8hbaJSMssuQN4MiijrSaDmY/QboQRD8huxAY/D2CxSNBcFvyBtoHPrh
OUUPgeA35PU0XvZnvwF6GAS/Ia+jiegbxL28FtRP0TU0SfZlvyGvpsnoJfgNeRVNkXez3wBNBcFl
yCtBvRUV0TT0HPyGbEfT0XMrFD0Kgt+Ql9Njsgf7DdDjIPgNeRnNQG/CZci2oG6GngDBb8hLaSb6
NaZoFgh+Q15Cs+Ud7DdAc0BvgC4GdVXUBnS7obkg+A95ET2JXof/kH+leej1tYqeAsF/yNb0NPqf
/UeRvBDcCVwk/0LPyFvZh4Dmg9Ypeha0HtQKVKzoAlqA8dmgaCEIfkSG6TmMlPIj8s/gjuxH5Pm0
SN7EfgS0GKT8iGxJz2O04EfkefSCvFH7EfASMNZBeS7oBkXngNobWgqCL5Et6EWMofIl4JfA8CXy
bFqG8VS+RJ5FyzGiyo3IP4GvYY8Cehm0HXQm6GpDK0DKn8jm9ArGdyfoDNCVhl4F7VL0Gugj0Omg
IkMrQR+ru5uB2xk+jVbJK7RvAcfAcVBT0OWGXgd9CjoVdJmh1SDlY8BvgOFc5CmgtopOBl2qvA3z
m2DlZ+T/0Rr5N+1nwGvBys/Ik8CXsJ8BvQX6CtQEdLGht0Ffqyub0Dvgb0AngtooZ1Mk/wi+KMvr
wMrfyBNoPeLI+BuoDVDfgxqDWiunUySPp42Iqh8M/wP8L3P9cVB/0S5HHgtuBWbaBPrR5G4GJxQX
gi8AM70LgteRIVBYOyDwFrDxPfIY2orIy7kdzjua3kPk/aK4EbglmOl90G5zTSP6AGqP4qPA5xk+
kj5EJBrfA7UNyvgeeQRtR0SWGHU4VIusC2K9A7pU8WHgs7O8E5z1P9C7oHnHPBR0Vsb/yD/QR4jW
8qz6GCqdvesQ6DONLpIHQzVXivkTcNYPQcf/zdt5h0tRZH24u2b6DEgOEkuQAQGzYg7rx5qVlRVZ
VjHnnFAWRcRAzjlIkJyzggTJiCA5R8k5h0uO96uuqmcW+lfz1fSd6/eHz+n3nXOqZ27o2zXz45Hd
Ju7cqrGC4qiS3hn5tFWQm+grSNsEM3FUQBzdqndG1Vh+QbdIn5+2i6PL90fVWD5hb5bWP94hjqPy
OK84vknvmXzaKci7ZC4P7WI3XrpPYrlpN7vh0n2SMHuESeyTWC7B1/v7JHG0VxwF90nV2BXCX6e9
T/sE+XceOcXRtYmdk8/7BV+2b2I56ACrqHdKysSEqSCMf3RQHF22bxLukHB5NZGg8pftoqoxT7hr
Eh0eHRYU2D8Je0TY/OIoKo7KXbJ7qindUeEKXGIiwpSNFZBHGeKo4CWPMWHi0vjHx8Sxcf/EXPFY
mf/utQQfF1xYHjvi+OrL9la+OyHclZev4mbSSVb6sv1UNfeicKWk849PieOiwbMLf1r4Ygm+IPiq
y/iM4OKmZ+6eF4/xyx7z3VnhSoijc+KoJOywfH9O+JIBe1bYEtL6x+fFMb/k0TPCFNfGpwuCDPst
8chF8UipBJ8WXMy24xJdmaKrtDg6JY6Kwo6rmntS+CKy42TMEUeGfZd4xBWPlLnMnRDuyoTzmQmO
X9JxXJjCARMRJsn+SzwaFY+Wk8fHxHEh2GtVczOEL5hkj+Y/6olHg/uwau5R4Qto7xMJSrIPE4/G
xKMVLjFHhMl/2c7MdzmEq6jpsKB8sDvzfU7h/4992XfFMjMd14k5YsPlxMXubGbevE7ZDP+/DKds
3gwnHp3EOoIrG7k/6CLzIr3BNY3sAlc9ehW4a6NPgPOinwQd2x1tC25hdDi4cdHZ4HpH14NrFT0E
rp7ngPvAKwDuRe9qcFW9m8A96N0H7k7vMXDXe8+AK+O9BK6o9w64vN6n4Dzvq6BzL3oNwJ30WoA7
7LUHt8frBm6rB99zd703CNxKbwS4xd7P4OZ5E8HN9qaBm+b9Bm6S9we4cd4icGO85eCGe6vBDfb+
BNff2wKut7cDXA9vN7iu3n5wHb0j4Np5x8C18k6Ca+6dBdfYuwCuAcHPs/stRcF9TTFwdekKcHUo
D7jalB9cLSoE7mO6EtwHVAzce1QS3NsE1w33TYLfQfd1ioN7ha4B9xJVAPcCXQuuJl0P7lmC33O3
Bt0CrjpVAvc03Q6uKt0J7h90N7gqdC+4Jwiuxe5j9AC4R6gyuIfp7+AepIfAVaZHwD1Aj4L7Gz0O
7j56Etw9VAXc3fQUuDvpn+DuoKfB3U5w7XQrUXVwt1INcDfTv8HdRM+Bu5FqgrueXgB3Hb0IriLB
ddytQK+AK0+vgitHr4ErS6+Di9Ob4MrQW+CuprfBlSb4m+KWovfAcXofXEn6AFwJ+hBccfoIXDH6
GFxRgr9lbhGqBe5KgytMn4MrRLXBFaD/GFwdcPkNLh99CS4v1QWXh/Dvb26qBy6XwV1BX4PLSfXB
5aBvwcXoO4P7HpxndHh/EKWG4CLUCByjxgbXBJxjdE2DzsmkZuAuUnNwFwjuX4RrCe68wZ2jVuDO
UmtwZ6hNwJWFntME96bCtQN3iuDeyjlpcCeoA7jjBPfiwnUCd8zgMqizwXUBd9TouoI7Qj+AO2x0
cN/oHKLu4A5SD+vX+AD0xJ391NPgfgS3j3pZ199LcD/r7KE+BtcX3G6D22V0/cDtNLgd1N/gBoDb
TgOtr2s7wT25s83gthrdYHBbaAi4zUY31OCGgdtkdLCvczYS7COcDeDw9W+gkeD+NLj1NMq61joa
bXBjwK01up/ArQGH51xDsFdyVhvcKhprXWsVjQO3kn4Bt8LoxlvXXw49cWeZ0U2wrrWUYD8o3CTr
3BL61dqzmCZbexbRFGvPwpR6poJbYHTBvS6uNZ+mW3vm0YwUeuC9HucPg5sLDteaS7PAzTE62Lc7
vxtd8P0bPOds+j2FnjnWnt+gJ+7MMrq51rVmEbwH4cw0uBlGN8+6/gyaD2660S0AN83oFlrPOdXa
Y5qB912cKUa3GNxkcLj+ZFoC7lejWwpuktEtC/0aJ1pn4s4ECr7XZF93Aq0AN97oVoZe+xdaZe0Z
R8H3wuzrjqM14MaCw7mfU+pZa+35CXp8ty6FOXhP2BkDDudGU/C9QfvXaDRtADcKHM6NTKlnY+jn
M4I2WXuGQ4/vNoc+1zAKvm+aysxWa8/QFHqGpNSzLfTzG0zbrT2DoMd3wfeL7ecaRDvBDQSHcwMo
+PmL/VwDKPjeNfb0t/bYz9Of9oDrBw7n+tFecH3B2c/fl/ZZe/pAj+/gfXynNzhcqzcdSPtr1iv0
Gv7MQWvPj9Dju+BnYzjXM6Wew6Gfcw8Kfi5in+kOM747mvbXvFvoNeLOD5SRhZng5z72ma4w47vj
ab/mLnQi9ExnmPFd8HOrVNY5Ze3pZO3BmY5ZmjkdeqYDzPjujHWufUo9wc/8wn9v29G5bFjjfOiZ
tlmYaWOd8XuCn3mGfz2t6WLaa7SizPTXiAU/q8WeltYe04yb9nNrEXoN//+9EpzxHUvzuZjOEwHX
DJx9nWYx+FzcaQou/PNrGvNCzzSBGd+Rda6xtcc0E/zsP/3vSaO01/TXyBF6pqF1xu/Jae1pYO0x
zQTzEuFf8/ewhu9yhV7nO+uM35M7m7/veI5v0z5H3PkmFsycpP+8vhE/nmFn6ltn/J582f5c68cg
X+N8DS78uvUM69aLBbNu6T//erGCoWe+Cj2Da9TNljWCOab0vx5fxgqnvcYX1jX8nmDeKvt/v7+I
FQFXB1z656kTK5r2Gv9Jew1cs7Z1Tb8nmHHL/u9D7VhxcJ+DS/88n8VK/MWvxXTOYB7QPlMrSzP8
L38tn6Z9jv/+q1pn2LDMzCS57U2G3PZ7mNuOljfktk8ZctvLDbntcYbcdk/MbUeaYG47Uhtz25E3
MLcdqYG57cjjUchtR+7H3HbkVsxtRypibjtSCnPbkSKY247kxdx2hDC3HXEMue0zhtz2MUNu+yDm
ttkezG2z7ZjbZpswt83WYm6brcTcNluKuW22EHPb7A/MbbPZmNtmMzC3zaZibpsZcttsPOa22VjM
bbMxmNtmIzG3zYZhbpsNwdw2G4i5bdYfc9usD+a2WS/MbbOemNtm3TC3zbpibpt1xtw264i5bdYe
c9usDea2WSvMbbOWmNtmzTG3zZpibps1xtw2a4S5bdYAc9vsO8xts28xt83qY26bfY25bfYV5rZZ
Xcxtsy8xt83qYG6b1cbcNvscc9vsM8xts1qY22afYG6bfYy5bfYR5rbZB5jbFg5y2+x9zG2zdzG3
zd7B3DZ7G3Pb7C3MbbM3MbfN3sDcNnsdc9vsNcxts1cJ/83LK5jbZi9jbpu9hLlt9iLmttkLmNtm
z2Num9XE3DZ7DnPbwkFumz2LuW32b8xtsxqY22b/wtw2q465beEgt82ewdw2q4a5bfY05raFg9w2
+yfmtllVzG2zpzC3zf6BuW3hIKPNqhgd5LbZk5jbZk9gbls4yGizxw3uMcxtCwe5bfYo5rbZI5DR
hvs69jBmtoWDzDZ7CDPb7EHMbAsH+Wz2d4OrjJlt4RqC+x/MbAsHmW32AOSz8bX+DfPawkFem92P
eW12H+a1hQtms/Gc92JWm92DWW3hglntOLvb6PDfEt6NeW12F2az2Z1GB3lt4eAenN2B2Wx2u9FB
Xls4yGaz2wyuEua1hQtms/FrfCtmtYWDrLZwkMNmt9jz2+xmzGoLB1lt4YJZ7Ti7yeBuxLy2cJDX
Fg5y2OwGcPh8r4dctqmnP7jrMKctnDWnLXrwHvxag6todJDTFi6YycZzVsCMNisPeWycK4/5bOFw
v3CNPZ8teoJZbOwpR8FsdpyVNTrIZwsXzGLj+nF7DpuVwfy2cMH9kGkumMuOs6uNDrLZrDTksHH9
0vZcNiuVUo81k82uwky2cMFMdpxxo7PmskWPNZfNStoz16xESj3BDDb2FLdnslkxeyZb9Fgz2aIH
3sdhRa35a1ynKGSvsacI5K6x50p7Dlv0WHPYogfy1KywPZvNChnmCtlz2KIn+J4C9hTEDLZw1gy2
6AnmrU09kLVmBYwumK2Os/yh89Z4/vyYtWb5jM6atWZ5MaMtXDBrbZoL5qxNPcEMdZzlseeqWe6U
ekJnr8UM5KxZLqMLnb0WM9bsNbsifPaa5bRmqMP//OTEPDXLYc9hi55g5jrOYkZny1jj2jFr5jrO
CHp8Z81PM8/aY5oJnbkWM5CnZlF7Dlv0hM5cixl8zzNizWH7Pda8NGPWHvvzY+Ez18yl7aFnnPB5
azFjy1abZuAzEzfTmr/2e6x5a/di+nlrsYYtW40zF0Lnqk1r2HLWOHPemqc2zQSz0XH3XNqZa/t5
z9nz1e5ZzFcLZ8tO4zpnYMZ3ofPVYiZsvhrXOJ12tjor5wzmquPuKWvW2u+xZavj7smUetLOVos1
Qmer3ROYrRYudLbaPR46A53938PjmI92j4XPWYuZYF467mZYM9S4Tkb6mWqxhi1THXePptQTNiOd
/d+fI+nnqd3D6eepxRpp56ndw/Y8tXsofJ5azNiy0HH3YNqZa/vzOJh2ljruHoA1fBdJe939aeem
TWuGzVGb1rBmqN194TPUYia7M9T2c+61ntPvCZuhxjX2wBq+C5uPTuU86eancc3dobPT9jV3/eW5
6ex4jrbMdNzdGTpX7c+EzU2nsma6mem4uwPW8F26GWk8z3bMTAuX7ZlpsWa62WX7ObZl+zn8NW15
6bi7NXSm2p9JNzOdyjnSzUvH3S3WNfyedPPRcXezdQ2/J7vzzn/9dWszZKXj7qZsz0/7a2Z3Ntp0
jrBZ6bi7Me18tb9G6OyzuyFLM391XjpdvuT/QJSZ+f1SmZUey7msS3aIGv2CDeGqzvY5siLyOlf1
G8mfRRZxVfdKviFagqt6p8/sVLQGV7WW5IXRRlzVPpKHRIdxVedIbhFdwFXdLfnT6G7Jn3oRyTU9
h6vKJT/iFeGqVpJcybuOq/qo5Lh3H1f1WcmFvCpc1Xcke97zXNU6PrtnvHe4qg0lH/Rqc1XbSd7u
fctV7SF5ndeCqzpI8lKvI1d1tOS5Xk+u6kTJ071BXNVZkid6o7iq8yWP8cZzVZdLHupN4aquldzf
m81V3SL5R28+V3WX5K7eMq7qQcntvTVc1WOSW3kbuKqnJTf1tnFVL0pu4Mmvt9uA5Nfbre8dkFyf
ckiu6x2VXJfySK7tnZBcmwpIruWdlVyLikj+0Lso+UMqIfldYlzVUpLfIuKqxiW/RldwVctLfpny
cFWvlfw8FeCq3ij5WSrMVb1F8r+oKFf1NsnVqCRX9S7JVakUV/VeyVUozlV9QPITVI6rWlnyI1SB
q/qQ5IdI/nyJKn++3Mp0I1f1CckP0M1c1SqS76dKXNWqku+h27mqT0u+i+7iqlaXfAfdw1WtIbkS
3c9VfU7yrfQ3rmpNyTdTZa7qi5JvoAe5qi9Lvo4e5qq+KrkiPcpVfV1yeXqcq/qm5HL0JFf1bcll
6Smu6nuSy1BVrur7kkvT01zVDyWXome4qh9L5lSdq/qJ5BIkrweiyuuBW5ye5ap+LrkoPcdVrS25
CMnfT1HV72dhepGr+qXkQvQSV7Wu5AL0Cle1nuT89BpXtb7kvCSvX6LK65ebh97gqn4rOTe9xVX9
XnIuUteDXKSuBznpXa5qI8k56D2uamPJMXqfq9pEskcfclWbSY7SR1zV5pIj9DFXtYVkRp9yVVtJ
dqgWV7W1z04mfcZVbSP5In3OVW0r+QLJ65Wo8nrlnKc6XNUOks/RF1zVjpLP0pdc1U6Sz1Bdrmpn
yafpK65qF8mnqB5Xtavkk1Sfq9pN8gnNJzQfp2+4qt0lHyN5/RRVXj+dDPqOq9pT8lFqwFXtJfkI
NeSq9pZ8WPPhBDfSLP+eOAepMVe1r+YmmvtJ3k9Nuar9NTfTPEDyPmrOVR0oeS/J67uo8vru7KGW
XNXBmltpHiJ5N7Xmqg6VvEvzLs07qQ1XdZjkHdSWqzpcczvNIyRvp/Zc1ZGSt1EHruooyVtJ/r0R
dbSRt2jeonkzdeKqjpG8iTpzVX/S3EXzz5I3Uleu6ljJG+gHruo4I/9J3biqv0her3l9grtrHi95
HfXgqk6QvJbk30tRJ2r+UfMkyWuoF1f1VyOv1rxa8yrqzVWdrLmP5imSV2peqXkF9eWqTtXcT/M0
ycupP1d1uuRlmpcl4aU0gKs6Q/NAzTONvITk/YGo8v7AWUyDuaq/aR6iWd6POYs0L9K8UPPCBA/V
/LuRF5C8/xJ1jubhmudKnq95vuZ5NIKr+ofmkZrnGfkPkvc3osr7G2eu5rlJebTmBZLnaJ6j+Xca
w1VdqPknzYskz9Y8O8E/a15s5N9I3u+KusTIszTPSvA4zUslz9Q8M8G/aF4meQbJ+zlRlyfhCZpX
SJ6uebrmaTSRq7oyJZ6qeWqCJ2leZeQp9CtXdbXkyTSZq7omCU/RLO9HnV81/5rgqZrXSZ6keVKC
p2leb+SJmicm4Qk0nav6ZxKeoXmD5PGaxyd4puaNRv6FZnFVNxl5HP3GVd2cEo/VPDYJ/0zyfl7U
LUn4d81bjfwTzeGqbkvCczVvlzxG85gE/6F5h+TRmkcn5Xmadxp5lOZRSXgkyf2KqLuS8ALNcv/n
jNA8IgkPp4Vc1T1JeJHmvUYepnlYghdr3pcSD9U8NAkPoSVc1f1JeKnmA0YerHlwgpdplvs7Z5Dm
QQlervlQSjyQVnBVD6fEAzQPSMorNR8xcn/N/RO8SvPRJLxac4bkfpr7JeG+JPe7oh5LkddqPm7k
Ppr7JHid5hOSe2vunU3ci9ZzVU8m4T81n0qJfyS53xf1tJF7au6Z4I2az6TImzSfldxDc48k3F1z
95R5s+ZzRu6muVtS3qL5vOQfNP+QlLdqvpASdyX5/omoF1Pk7ZozjdxFc5cUubPmzkl5h+KYkxJ3
op2SO8XclLgj7ZLcMcayyLs1R4zcQXOHBO/RHJXcXnP7lHmvZi8lbqe5XZZ5n2YyclvNbZPyfs0x
yW00t0nKBzTnyBK3poOSW8dypsStNLdK8CHNV2QLt9TcMikf1pwrS9yCjkhuEcudJW5O8v1Qp3ks
TxY5Q3NeIzfT3CwpH9OcT3JTzU3/n7gJHZfcJJY/JW6suXGCT2gukE18UnNByY00N0qZT2kulCVu
SKclN/zf5u4EOMr6DuP4u7/dzYYkhCsJCQFZ7hvC2dpWS++ppUWktow9GQ4RJUUkIGDkGO1gHUY7
DAItMxZrndJaR2yxFVqsVVurtFYxIYAcAcINISCEcKU/fs/DOxTed/r2nd2lMOHhM8CfHSbZbPJ+
2SQKQnkRvch1E12YFi+kFwb0giz7/L6zIFEU0ufp9qE8n57v+gJdHMgP0w+7vkiXpMiXaLve4VTS
lTfID9EPuW6mSwN5Hj3vihMO3TFFjtCdPD2XnhvYQtv1JWcOPSdljtKdA/lB+kFfx+ikp2fTs2+Y
43QX8yx6VsqcRXcN5Qq6wnWC7hbIM+mZvs6mu6fJLege5gfoB1LkGfSMlDmH7hnK99P3+zqX7pUm
59G9PT2dnh7SP0jY9WrdPmlyPt03lMvp8hR5Gj0tsFvR/TLk1nR/8330fSnyvQnrEXQHZMht6YGB
PJWeGtjt6EEZcgFt/YZzD31PmjyFnpIxF9KDQ/lu+u7ALqKHBPJkenJot6eHZsjF9DDzJHpSmjyR
nui6hB7+f2i35xsZGRnjc5/+Z89XxZ6vCj1f7E70fLrWw8Ty0PPpouerYc9Xg54v+iJ6Pl3rd6JP
oufTtf4iOgs9n65dT45+Hz2frl2viY5CzxcdhZ7v8vOSdsTaxwPRAej5dO31K5pEz6drvVW0ED2f
rvV80Rz0fLrW80Ud9Hy61gtJI3o+Xet3pB49n671MXIAPZ+u9SiyGz2frvUesg09n671E7IZPZ+u
9QnyT/R8una9Xt5Cz6dr17PldfR8una9Vzai59O166XyCno+XbveJ+vQ8+na9TBZi55P167vyG/Q
8+na9QtZg55P1z5/L79Az6drn2+WZ9DzyTPo+eRp9HzyNHo+WYWeT1ah55MV6PlkBXo+WYaeT5ah
55Ol6PlkKXo+eRI9n659fCRL0PPp2uNxeRw9n649vpPF6Pl07fGMPIqeT9fev8kj6Pl07f5TFqLn
07W3f5mPnk/Xej6pRM+naz2fzEPPp2s9n8xBz6drPZ/MRs+naz2fVKDn00UvOhM9n671fDIDPZ+u
9XwyHT2frvV8Uo6eT9d6PpmGnk/Xej65Fz2frvV8MhU9n671fDIFPZ+u9XwyGT2frvV8Mgk9n671
fDIRPZ+u9XwyAT2frvV8Mh49n671fPI99Hy61vPJd9Hz6VrPJ99Bz6drPZ98Gz2frvV8chd6Pt1y
eixtPZ+MQ8+ni773m+j5dK3nk2+g59O1nk/uRM+ni7fPr6Pn07WeT8ai59O1nk/uQM+naz2fjEHP
p2s9n9yOnk/X7r9kNHo+Xev55Gvo+XSt55OvoufTxf3BKPR8utbzyVfQ8+lazye3oefTtZ5Pvoye
T3cxPY22nk++hJ5P90f0dNp6Pvkiej5d6/nkC+j5dK3nk8+j59N9gp5J4/7qc+j5dK3nk8+i59O1
nk8+g55P13o+GYmeT3cZPZe2nk8+jZ5PdzldSVu/J7fSt9K3oOfTtZ5PPoWeTxf3n59Ez6e7il5E
W88nn0C/p2v9ntxM3+z6ERp9+MfR8+mupn9IW88nH0PPp2s9n4xAz6f7LP0YbT2fDEfPp/sc/Tht
PZ8MQ8+n+0t6CW39ngylh9JD0PPp/op+graeTwaj59N9nv4xbT2flKHn032BXkrj/c0gepCPB6Ln
07WeTwag59NdSz9Fv0Qvp63nk/7o93St35N+dD/XK+l1nu6Lnk/3Zfqn9O/pVTTeX/ZBz6drPZ/0
Rq+nuz6Qe6Hn07WeT3qi39P9o49X09bzSQ/0fLob6Z/Tr3q6O93d9bO09XzSDf2e7ms+fo7G44Ou
6Pl0reeTLuj1dN8I6DW09XuSpJN0Z/R8un+lf03/zcfP09bzyU3o93T/7uMXaDy+6UR38nFH9Hu6
7/j4RXoTvZa2fk9K6VLXL9HW70kHuoPr39LverqELnH9O9r6PSmmi12vo9+jX6bf93R79Hu6m338
B/oDTxfRRT4uRL+nW+Xj9XQ1vYHe4ukC9Hu6NZ5uh35Pd6uPN9LbPN2WbuvrV+ntPv4zbf2etKHb
uH6Ntn5PWtOtXf+F3unj1+ldnm5Ft/JxPp3v+g16t4/fpGs93RL9nu4eT+eh39Pd6+O36H2BnIs+
T7cupN+m8fFKDp3j+h36gKdb0C1cb6IP+vgf9KFAzkaPp3vY0wk6Edjv0kd8/C/aej3JorN8/R6N
j+/idNz1+/TxgN5M13s6RscC+wP6RCBH0e/pNvi4mrZeT4QWX2+hTwV0DW29nkToiK+30tbfiUM7
KfM22vq9SDOse8Xb6cZAvoReT/dsQO+gmwL5Ivo73XNp8i7a+rzIBfpCYO+mrdeLnKfP+7qWvhjQ
e+hLnj5Hn3O9l24O5Ca6KbT3wej1/qvPoteLnEWvF8D7aQnpAzT+/2gj3ejrg3TM02foM74+RMfT
4tP0adeH6axA/oj+yPUROhHQR+nsUD6FPi9yCn3e/+yT6O0iJ9HbZcD1dK6nG+gGX5+g80K6gW7p
6RP0CV+fpPMDuZ6ud32KbnVDfBx9XuQ4+rwQPk3j/4Mfo4+F9hm6bUg30tbnRY7SRwP7LF3g6SP0
kcBuogsz4sP0YV+fo4tC+jzdPpQP0YdcX6CLQ/kgerzIQfR4KfAlukNafIA+ENrNtPV5kf30/qBG
j6fbMUWO0J1CuY6ucy30TWlylO4cyvvofa5jdDIl3kvvTZnjdJc0OYvG83nsofeEdoLu5ulaujaw
s+nuaXILukcg76Z3Z8i76F2uc+ieaXIu3Sst3on+Trd3mtyS7pMm59PWx0V20Dsy5A/pD0O7Fd0v
Q25N9w/k7fT2wG5DD0iJt9HbfN2WHpgmt6MHpcVb6a2uC+iyjLiGrsmYC+nBGXIRPcTTW+gtKXN7
emiGXEwPC+Vqujq0S+jhoVxFV6XFV30tc/uWsB/LZG38W/HK7DucIbImPjb+aPZd+ivZ+h2/UpF9
m5OMV8Qn2M+6yCv6YwcnummTE3HGSG18Q7Q0ftpZ7TzlZEX0OH1Z7fzEyW7eo9ipLz9zVrh/Y0vn
dqd3tCTrltzkqPHlE5PjkmUDh+vvWKkvyy8/b+DiiJ47JjpaT33M99Sma07tW56XHD1h0vjya89b
UNzcrH804cT0e9fon+LVpaVOt7rLL3VOt9I6n/OPXXc+b25y3OCyMueq28uvCR/rF/Dkcx4n85Zf
czKfQTG2Mr5hxAjbhrdH+Jz65nWntuA/7+ARV53pVpwJnKnrf+b6687Mxi3VI6+ciNenJU7zvwHU
yfulMFQc8CInAACnISaiucdHsLQ2SjadC3SQoAKDb6SD/0PfVKG7XHMrrv7uAAAAAAAAAAAAAIsB
AADQAAAAtItMAMBOKADgJgAAAP54nOzaWYxUV37H8VNd3V0NNJQTiX0pax7YN884AsxS5CUOO0Qj
ZYTZM85MxA5SnmyqWCxZmmHHyWQe2OElkdjhKVKxGHgcdrB0pCP2RUpaYunq7uq6+Z/7/9bWNKbH
Q+xJZEz35/xvF923zjn3d8+57v/KG//nD5HfmL+oCupNIHXVZP3wf2rT9b8IG/vML80/Tvn470ab
iFTzpIp+vGbxql+PNh35UyUfdfIR+c/+e//w1lfvNb8NPwbIz+pcPIuYfIc68775eeRAzeTIAd/q
sqlmcpdNps8is8gEgbyiSv77ifki8k2tO/EgnsKLeAsfY5OqiSb2xeE4EWfiQlyF63EHHsCT+DXe
xEeYVTXRxD44DCfgDFyAKzGN23E/nsALeAMfYqOqiSb2xqE4HqfjfFyBKdyG+/A4nsfr+ABfqZpo
Yi8cgh/hNJyHy3EdbsW9eAzP4TW8jy9VTTSxJw7GcTgVP8Fl+DluwT14FM/iVbyHL1RNNLEHDsKx
OAXn4lL8DDfjbjyCGbyCd/G5qokmdseBOAbbSbSqLzTRqr7oSKL9uyTam9do0Q810cRnmFM10cQB
OAon4xxcgmtxE36Fh/EMXsY7+BRbVE00sT+OxCTOxsW4BjfiLjyEp/ES3sYn2Kxqoon9cAROwlm4
CFfjBtyJB/EUXsRb+BibVE00sS8Ox4k4ExfiKlyPO/AAnsSv8SY+wqyqiSb2wWE4AWfgAlyJadyO
+/EEXsAb+BAbVU00sTcOxfE4HefjCkzhNtyHx/E8XscH+ErVRBN74RD8CKfhPFyO63Ar7sVjeA6v
4X18qWqiiT1xMI7DqfgJLsPPcQvuwaN4Fq/iPXyhaqKJPXAQjsUpOBeX4me4GXfjEczgFbyLz1VN
NLE7DsQx2E6iRT/QRIt+0LE12gffskaLOhLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EcieZINEeiORLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EcieZINEeiORLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EcieZINEeiORLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EcieZINEeiORLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EcieZINEeiORLNkWiORHMkmiPRHInmSDRHojkSzZFojkRzJJoj0RyJ
5kg0R6I5Es2RaI5EcySaI9EciebaTTRLotmOJtqb12jVv9FEE59hTtVEEwfgKJyMc3AJrsVN+BUe
xjN4Ge/gU2xRNdHE/jgSkzgbF+Ma3Ii78BCexkt4G59gs6qJJvbDETgJZ+EiXI0bcCcexFN4EW/h
Y2xSNdHEvjgcJ+JMXIircD3uwAN4Er/Gm/gIs6ommtgHh+EEnIELcCWmcTvuxxN4AW/gQ2xUNdHE
3jgUx+N0nI8rMIXbcB8ex/N4HR/gK1UTTeyFQ/AjnIbzcDmuw624F4/hObyG9/Glqokm9sTBOA6n
4ie4DD/HLbgHj+JZvIr38IWqiSb2wEE4FqfgXFyKn+Fm3I1HMINX8C4+VzXRxO44EMdgO4lW/aUm
WvWXHdt1jv6WNVrNGE008RnmVE00cQCOwsk4B5fgWtyEX+FhPIOX8Q4+xRZVE03sjyMxibNxMa7B
jbgLD+FpvIS38Qk2q5poYj8cgZNwFi7C1bgBd+JBPIUX8RY+xiZVE03si8NxIs7EhbgK1+MOPIAn
8Wu8iY8wq2qiiX1wGE7AGbgAV2Iat+N+PIEX8AY+xEZVE03sjUNxPE7H+bgCU7gN9+FxPI/X8QG+
UjXRxF44BD/CaTgPl+M63Ip78Riew2t4H1+qmmhiTxyM43AqfoLL8HPcgnvwKJ7Fq3gPX6iaaGIP
HIRjcQrOxaX4GW7G3XgEM3gF7+JzVRNN7I4DcQy2k2g1H2qi1XzYsTXa6PI1Gq+OdCu++qYx0Z/x
an7nLfzT1awyg6O/bl3a9+efLl/1/uBpQ95fvOKX7//NyjX/8E8rfvX+4L9fPuKnQyp+S+535i/D
9q/MNvytfPUXtavNfROp+m/zLX/rmkxVPMg2m87N8j7zgWloMXXSTLUGLaZzixzLybFc2ExKM58z
dS2mOTDpVtM5J1+WZoM2E9LMtZo6aaaaAjnWKl2TDUwmb96TZjQfVDn/2bjwQDQeBNl8gW6tpioZ
BDlTlQryWqYC+blVsSDQMgjSLaY6CDLGdMubqmiQazbVicBpGQsapJTP0n95/5bSTSYaZI2pz5tI
Mp810WRei1Q263+oFkGDFLEgbbpWy8kGGanks6mXKhqkG+WnOtMl6nvmlZxfg7Zz0k7Qzko7TttJ
O0o7I+1Ig+ns2+mXRpqdqqT5wkRWha1aaY0OW9XSeu/bhuhNf+VbGOlm6JLz598StutbfYdkS0Ui
CLToKv0u3ZzOFb7kh0ML6UUTyYeDXSj9YGVLpZ8euVIZz4fTIfxGvmwNtIjnTU0iyKQCmSLFOm/k
UKlO5kwscGV11o9FWS3jWF6nZJhT2bI646djZZ3Il9Vpf36VdSzQ+r28qZUR9wOcrzgg/Vc84H8p
tqp4IK5EAldZpxoq62SbOpGtrOO5NnW+so4FlXW0sq6J+NOsqDOFOuK7u9pfDtQpX6caKmvp52Kd
8XW+sk4ExTopw1Mt11GxluGQC8wVaxmO6qhccNQJGY7qiJyw1jLn5AdG5XrV6eIvSen/VL6iTBbK
WFgmCmU0LGOFMnxzfjrKPPfDIPM3r7NZ3lYuTA6tEr6KF6qYryK+isklmBQ7fnXF/IzMNP8odrDb
5H5iUjnpaX8TibfQSPpGbbPcN1r97cNECo1ooRErNOKvNRI0ZEa5rIm1+DxvVHOYVVMN6NqY6ZjJ
tvLvEwX5/vGC/NwY5xEtGDSGJywTVU64WW8s3mSDmshlfb/IrHdN7fRUeANu+VP6qtRpyTd1Wuod
ddprnefadF5Dm87j58Y5j1i+o52WL+80vx4pvNl32ujQrVdic/TzkORziSk/BV+YurzvbrnbayP7
0nTKh7dbWQzQkqVD53wYe0a6q9DM02yVm3E2bMakKW/XL6HCo/KGfQDmgqZwqeWPyXrHL7XkWHO4
OkvIsayu2SKyUJPo80u68GjOX5ZyTBK+c1N4p/YLtdqsCS/UbHhEGo3Es2+E0Vv3imj18RlwIGzU
vjKFV8Z9o7bR+G/ROcsqQZupfPFnxnSx4JspXXP4s/MLjHxL2PT94Fp0orfylvwx3maklbee8Me0
O+SYdpE/Jqs6OSbvLK096Fcn2VIXy1quNASlYdGRanipYxgUxtAVhy5dfHX2Vfk3KzRlUtfp4keP
RRhDzooxjOoYhkPnu0ebfpAz+k59n2S16Y+mw0V4a3E1Hg9X48367Ru0GxOlHg2/vXZ5UnvfD2rs
tUGN58vH0DdiAV+KFF4T3oL9P4+20kiGjaZwqulgJnUChVsGppVuGfxUK2wa0uFOIRdOSj+CcT9R
pZHTMW0NjzRpp+W0e/I6X/PZtpdD+UWil86bBzP7snQhFq5MLlQu245c4aWVeeVqXVfwZcv68tX+
a7uA8t1B+a6B3UTFNqPNDqR8c/LatqW4oanc67TZCLXdJrXZRL2+xSrbgL22QXttC1e2vStt+Urb
wLLNYWnDWNpElm0tS9vNsi1oYVv6HfZF3//fznrvMLKfKDTzNJt8jxWb2VJTBq+Tb2aDSKmVLrYy
xZYrthpMN4mIeJDxq27pnbBM+kzxG69cWPqNUsxfR1rqtibtF+Td5B4b8ZsGGfyollHZIdUknbwi
LGMybDUJv2MIy7gs8GvipVJGsibmUz3dLVwTSRnNvVYmwzKZ8buTNqW/CDMVZSLTtUWX8NWVVfDu
qm4tureRzdLbSj27VPhWimUyLPPFtxJ2Q6nMUtINvgvjpV7xHZzIFbow4bs/6TfqsuALL1zZmso4
RsO6S9xfpX5s5fv5OuY31HGpE1r7zZQkt4vI8Xp/m28JqjO+kAtHmumIfKv65nD9Xe3Tw3RtDlO0
xmeJCyu5kdSEC/qwkjtETUM4P7rqvaUm48/NdG0ynZI+FIwfQl9JRMhEiPjJlfU3yu+2H4h9p1Xu
68vdsh1Bgy5uE0Fj5SI328Gdwbte7HZ0p9DhRS87hfgPv+gt/9tF7guJrP7b77Pd0dOTnov6Zzdy
e/HtuG/ntJ0Mn+nk/JUiw8mDk/pmffoT8Q+purbw6CfiH1H5KqpVg1YxrbLtVXGtJAbquf7DT2GR
9Y8kCkVDq+ZvPRETZnNF0SWcZ/pMrbxdH85DnyISH/VknXz6nouKMygUbc+z/XdWT47K9G+vayqK
XPiYTIt4+IwtV+jptF8WaRXzD6aKoxCLkpyFSvIu8FVnTU2/WK7zmVlcuubC9UkYTTkNVN0laTPG
ypYFuAv3U34l2mI6Nfklmn/W+uZg/EEDKPvtARTxweknP/mTcuRPMXcyfwa5U+jbUm8XB0AafhvF
fpLtUeWYhXuKXOXolkZcZ4GfJ3pv5ZqP+UeZJlGo/G3Z35vbT4BwJmaZpOE1TwDEw+mbe2sAlF8M
b0+DN19//3cToLw7KjqqoguLnVvZ76+NSeV4tRnL0ji/NQSYOm0mFNOsOPX+qDRoO7XDR+0v3mq4
7XPhc/ymH4s/88I/Eko2+qB7140ffK/7luV+ldwiX/kTftcNWbrVxP3+R5dx4a4qkQ+XcbWpcN9U
WMalWcbVs+ENU8cXUZ8kPmh8EfMZEy9ktk+fWK6siBYyO0ysQi5lKN60NAvb6TbtVOv/Vvh+exKH
hSsrXk/fDizGytdffv8aLmdL669kMYtdWfqGO9dYKYv/xPVXtPgQ+zusvn7ck/6/35P6X4GI6m9C
pHQMI4XBTFSM6h/xvyD9VI3LDM1rM6GzVq6C2kTepNJxmaV+bicapAi3kL5KOpPKmFSmWCUzJsGq
Q5ryN86KJJn2VYwqJZUz0WxFxc4mJT/cmUhFZfKlqqFtlSpW8coq27ZKtvrHUnWFKp0vlLHcG0s5
8TalPhtrv8z4Z1smVSojZaV/W/73CwplQ/hgypf+HP0p+XWannH4Gw8N0aC020vl4uVVEOQLaSPd
Xqz+p73zAa7juOv43u2TnizFtWxnaCh/JD+ZiQeGVJZkks506g6yjVtMa6hlOfyZ4CSSHKYTtyax
ZWaoPSFTyTKhQDod2RaMIcBgWWYCbYBatlAIUKhki39DO4lliYGSNESylLi2/lnH/vne0719d7f3
7z3ZQeNcPre3/3d/v73d/e09GdK1sOSqEi68NvjetnSwFk+LMYo7WMmomCByR5oXk/cwf+3wLbBj
rO/Tt7gCLSz/GzfggLdyyOvuPuTFxy7jjnMkS0uskai6I6xf1VJr+W2tVGd++4g81VPBbj86i+Ui
u//YrHyp8/uts3L7RLTU8Tn5LpdzVj6y244pvgWwCMfMnNzJWi3e8+KNMAPXotgUm4LLkhMAeVan
ypJncAbtcz5sPiIPA62WXcgnLnz0FP07w+cnTN7kKR+WmSlmePz0Dldhnol0HbPEoTb29v+AONB2
3E6bO8Wum8x5tQg2hWKtFknMcIlYlC6WvNigmyf3LZBSscfN5w/ccczik5Yp6ajiVhNrXDpY+vz8
2jw/ZVfC5Y9PNfg9l75ji/Ke78RzeS3nErxoWNKemzpmUS62/Har1WGNy9s11ogF2y9XSNYj4l20
aM1ycw+TT2tRnAxhGjEjb5imyJutODSCvRlxIoIpAn8z8+JwGkwXStksZ0GiXYJJzN2zMFkxsK4Y
WHX/+Wz72Xuxg0ubM1M56wbf3T7HOiR3gSKnE/xEzNJSxrGx7Nh0zm7vb3VdKTnXULm7e65bfcJk
OS6GJ/2arjBbes71anZNeyx/fVvlvOdnhxddVso5a2ix1M46eDOlse7mG34ibO5a3TbG8Im0mKhN
EWmmEQt/cbhnARsC44S/LsSa4TbT3cRvIky1Vs4/rpx/dDbe+/D849KyQpwNLp/lc5tBY1xqpcHP
KczI+zS/xzZdlTi/cBzrLeEYFDq9aNFB29bKT6JxlxyM+bsw35Udmme2Dhr22o7NhvgSO+sSq22s
AqsWxGrbds1wF4WLTRPEutTpIrZrPMc1aLvEuli67MWs6jxeXKeVWwx7Eb1U5CWXkVO5XJe9wK6a
ynHNOJtvzYKzadnCnG9yZM2wxNEJadElDpPM1kFqu1i/bR0UJloIgFhv2y9r7AtuXdoXrHLuCy7m
7AsqByPFqVO5SVhlbxLS7CZhlf8moTC3DN5837NwC4HlrlmxmP2y7yx5QfxyfXXJTuOlkp0Vz5Nq
sst4iezK/5X6kjUVv0rmSCa1CE6A18Ah8CJ4DuwGO8DDYAu4B2wE68ANYKUktcBJcBQcBvvBXvAU
2AkeAVvBJnAbWA9mwLUgkTRvgNfBK+Al8Dx4GjwBtoNt4F5wO9gA1oDrQEPSmALHwKvgZbAPPAN2
gUfBA2AzuAPcAm4E14OmJJkGx8ERcAC8APaAJwXVXxXfVfE58giTnkpB9+9OfwVfkvLfEN9UMlhR
nqprqPX+jZCSNav+V0oiOAFeA4fAi+A5sBvsAA+DLeAesBGsAzeAlZLUAifBUXAY7Ad7wVNgJ3gE
bAWbwG1gPZgB14JE0rwBXgevgJfA8+Bp8ATYDraBe8HtYANYA64DDUljChwDr4KXwT7wDNgFHgUP
gM3gDnALuBFcD5qSZBocB0fAAfAC2AOeFMyTxFVvSUkU9JdEJoWrnkvV1ftKYdkTUgrBCfAaOARe
BM+B3WAHeBhsAfeAjWAduAGslKQWOAmOgsNgP9gLngI7wSNgK9gEbgPrwQy4FiSS5g3wOngFvASe
B0+DJ8B2sA3cC24HG8AacB1oSBpT4Bh4FbwM9oFnwC7wKHgAbAZ3gFvAjeB60JQk0+A4OAIOgBfA
HvCkYJ4Ulv2ylEJBrRSm51J1db5SWPqGlEJwArwGDoEXwXNgN9gBHgZbwD1gI1gHbgArJakFToKj
4DDYD/aCp8BO8AjYCjaB28B6MAOuBYmkeQO8Dl4BL4HnwdPgCbAdbAP3gtvBBrAGXAcaksYUOAZe
BS+DfeAZsAs8Ch4Am8Ed4BZwI7geNCXJNDgOjoAD4AWwBzwpmCeFpd+WUiiolcLSQ6m6zb5SWPIZ
KYXgBHgNHAIvgufAbrADPAy2gHvARrAO3ABWSlILnARHwWGwH+wFT4Gd4BGwFWwCt4H1YAZcCxJJ
8wZ4HbwCXgLPg6fBE2A72AbuBbeDDWANuA40JI0pcAy8Cl4G+8AzYBd4FDwANoM7wC3gRnA9aEqS
aXAcHAEHwAtgD3hSME8KS3ZLKRTUSmHq7RQbCv2kkA5JKQQnwGvgEHgRPAd2gx3gYbAF3AM2gnXg
BrBSklrgJDgKDoP9YC94CuwEj4CtYBO4DawHM+BakEiaN8Dr4BXwEngePA2eANvBNnAvuB1sAGvA
daAhaUyBY+BV8DLYB54Bu8Cj4AGwGdwBbgE3gutBU5JMg+PgCDgAXgB7wJOCeVJI/1FKoaBWCunj
qc0f8ZVCs1FKITgBXgOHwIvgObAb7AAPgy3gHrARrAM3gJWS1AInwVFwGOwHe8FTYCd4BGwFm8Bt
YD2YAdeCRNK8AV4Hr4CXwPPgafAE2A62gXvB7WADWAOuAw1JYwocA6+Cl8E+8AzYBR4FD4DN4A5w
C7gRXA+akmQaHAdHwAHwAtgDnhTMk0Lz41IKBbVSaLye2vxIbf5vNDli/AdzHMmurD9HNpU+WVqd
erRl/6H8/Z+z7N+HmAzLElWyf9UltcZXU63GX5Ga1BC7xtj1XXZNsOtdUkPfY7yFa4Zds+yawzXv
uBbkRe/gnnMRdN4v5l+U03I8sxxul3tqOZ4HuYgSh+jvqdtzH1Lb7RdWeUa9/Dzu88L7xXHm4ePv
GV7183lGA4az733L5PHct1y6PHTxcvvvLNMrridR4kYrW4B8ArVZ2PaKUg81jwLHCVtvz/YN2rZx
+s8nr0B5JNG2IcoVokx5OhFZHsPUJ+n6u7RHpH4pYB3uGlkJEl43Lhai3tFlOJnwfu+Je7UfnfXJ
mScOlnzckDNE8otihlisXn4f5nE3lmklj0jhtZr/fqz/Sh73dpkKnIf/DPHeq8+KrKzkETd8YWaI
y10fxwyR0OFhghki3SVmiKPseodd0+y6ya7bLEXnvqFjrzC7T+i87P1A++LPnPt/cfYEiRKeuPj5
PPPcr/PaE/QK73Hvumej2bMLuyfou8bweO65hvUK75eHh1/o/YSQe26+ku1Xj4DlUcJHnyFG3eNK
Yg8m5to6cL/EKFOUci3b3kXcPcfl6L+o4fX9XtwZojqm3qt5xOnHqPvsy1mPIu/vJZ5HuPHq3poh
6uU9f4ZodBpsjpgRVuavszCvsut1dn2HXW+z6wZLz54rfo+I+aK4Zom7rZnbmO05pNPWrMwhVVsz
dbE7580pnfNJLzu0z+VpY3Z7RnzCE5/wqp+G2jmrcp+XR4D7wPNcZ5l8/H1lzm1M0+URJB9n3XVx
44f31vuoc2q1H0OUS1ufIHkEnbeGmR+69WPUuvuUtWBz0DBlUuIsy9w77hoibDvlho8/PwxZf988
dGvCKHlEXdtp2rBg7/wo8hsmj0KvVxJYOxajrSLPDyP0/TLLrzo//APyR8QwSPZMovNvTNp/0fIR
oz91ntQQnkI/+C3wv8C3wUlJPqMU7nfB74G3wNvgjMI5cBacV54vIP35XLcn7yhUny96hMNzqvov
RqTl7qYa/zy37rkH8/IJShIw/ajxvfyJR/ph0wuYvu32yOcseYlpytdICSFmdbX045rSZPSJb7mF
jhhvkUzqtjFgvMP8F9j9Xxp/y57xsJnUs8Y3KPdvMP7VWJD6YcyTDH3PeJPOSfnnMm6yePSr5gdN
ewWlnOQ1LebfZe5zroqcp3eZJmfoM+Ypw3uFlKEt5uvZlQ9x+BPEf5T+gKGMOM5VCSE5bSFHlFdy
RhPnKKLvk4BuTxkI6g6aT8z4uud59UgoXc96RE0vaj1ippun+2Hjh8w3dPpB/UmwsYPupfU5b/dc
XcvQTzGNJvl+nCb330lfydFRh7/Q55+kt7L67ExD1j1DP5Z6mCrP7XAi/kdS7cZS+Lx0RBkfTvWF
HRe08hOunb3lNGp6AcNrx4u49bLzSUYew+tB1PSXKR9t+gnlF7nfScBxgemU64ra1sv61ISh+sFf
6HVtyUPUxZ+nKcaNHy85aBDvXQih1z9W8rLpeOa8RBqbSqbz8keaoowPlm4MOy4E1rek5SeqHC2P
/MTXs4Tq45lPQvUK/J6IWb9Ct1fA9PXjAtMpr50boXM/UtpiWu67AGL+nyn9Eze/bPzq0jfdxhW6
VMYMrUpvMt3GJoJx4YfST7mNKdn4P5juCT0uxJSrgstpgdNPfNxIWg9C1jt2PoVOv1jtFCwf/bjA
dErVtRyd+1B61FSe0yVm6PeX/TD1iC/GhQ+WPeY73/i+srPqfMVOX4wJ95f9p9t4kS3f+lX3Rx4T
Eu6DxPvWg4m/29xlp3hjUsD2LVj6MfMvdL8n3N/6MYHplK/OrVvVpI4J9iV0du2qr7jpc3ZMqFz1
Ld8xYU35A9TFLxv/A+WPqvGpOldYXf5C5HGh2PocUe7+3+lBtHLp5Z3JikP+cuRKyNt95VfVvW2H
bGdoRcWanHiWEr+8YreRGycnrJDXVRXPeMqri+WNEGF7c8qvtLn9Hur+Z+A/g9fA/wa/izadgPsG
aNve3gNvgqoNTrXFzSqE7Y3O5bqztjmVOpucaoNT3NTDFudlowtsm7PT19nmQtrwvNzUy19lRH9P
m1tCzOqoLnzMcInY3N4S9rZXBZ81/s6UtrZvGvNCL7id7d9NJvf0XXb/F8b/EEvqAZd9YXP7vFlK
F0jeL+oYfL38E2ajsKe5nGwU6+n7zedzfkHHyvoJe515x/x7A/VMuVxc381JWppdTyv+/D1sfofW
e44pQffRdP3h1T9R44d05+UT1u317gibftRyEA95jptv0Hok/DxwPXTPPfy19YhXH+34wXUq+363
9W0pfsZ8A3Y3Zxji0Ml/o69k5xlKGD5XMIdhd1Pjy7bNmP+Qetj1V6vs+IOK3U2Zr4gyXopgd4vZ
b4HlJ6n0dfJT7HwSbjfP9GOWO3J/hA1np1+gdAP3R7D09eMC0ylK8nUyq5d/7bC7Kf6U+39NsbtZ
Szosxo2X9XY38wLsbi75iDR6FbubIw9Rxj+NYHcrbLsH7vfQchoyn9DjRsh8EtPnuP0RM79C90Ps
8TVg/gHbST8uMJ1y07fsuPDHpS0mcX9Xi3HhDz3sbhbin1XsbkoeYlz4/fQmP3u8eUaxuzkuEf90
BLtbzH6IvecZVp8LJE+x9UFTnsD1iFk/bT5JtVPS7WWnn3B6mv7QjwtMp9z0Matz3elR1VZOl5gx
v+JvdzO/7GJ3sxzxf7fsrDqu2G4xJvy2v93N/FIB7G5x3zkFks2iyWiB0i2aLhQp/ZDv6LulHvox
4Usudjfn/P4Ff7ub+Zsudjfn3kKXh92NYEw44WJ3I474nXq7m9kRw+5GlH4ttJx6yFXB0i9QfoVu
L896xF0zd8DuRvLnv0Levgi7m8s7Tsjr84rdjSjxf0NvdzOfC2t36+21LBe725+j7q+Cb4Bvgu+A
U2jToN+4qXY19ds21X4GN9XYy7QMaCfz/NbN8oine674e9qrgn6b5hVOkeHYdjFVJxTm6WjAeJ66
pku/QO5E7G5M9o1b+NbtJru/Kexv3zT4r85NCxvct815krW1cR2j7xl3hD1tXsq28zs38X3ba+ZH
c34RxHEv4veZvy7m05bDD+OKOLPSYw7Yz7JjkePdSX/HtFz35S2cAeiKYGsL2geacHnjc9T0NM9j
23Y04fLqEbX8unrEjF+09KP2R0L5hO6PcOH053K6PL5xI9Dp5+kzOWtkx70YE77gsLUpYYROH9V8
4/YsvnFz8RfxPx/gG7eDMWxtYedzIcOHXt8UOv2o+QSNF3V/Ie68Ou4eW0Lt6Jl+ofojWnz9uHAQ
tjaPvS/6WeUbN1Wvn/L4xo1gLtAGW5tL+lm9bil52fdblsc137jtT8DWprRv5P5NSk4jykvC8qON
t2x6kHB7FbofEu+PeOnrx4X9Dlsb0rH1XOjcYw5bW364DP0lf1sb/YUA37j9PGxtSvzsuLDP39ZG
m2N84xa3/Yu1f3SP5uOpb8XKJ6H8lq2dClMP/bjQjG/cXC6hc3t9vnHj64gm2NoIyZtziHHhMx7f
uBGMKz/nb2ujP+tia3OuIXYX8Rs3TZ8E7tuY+Rc6n7tGl+/2/lDzKdbYHa+d9GPCbs03bp/WfOP2
Kc03bj/jb2uju/xtbfSnXWxtahk/maCtrVjy499vyyc/AeVr2cYlf+rl/ZOKrc1xGVKW/L9x+4S/
rY3u9LG1EcjrTq2tzf6725DZ0uP37SNp8aSWfDH9Dfpr5a+SOvKF9N/Q58r/Cb81KX0OlX+dVNND
6RFxt4H8Fvu//bcQ8TezyVB6ggyVnfT4+90vinbszpZhNdlNNpHJsnNl1a0HDz3x1NNt3B9/VR6/
fFltfDg9YXzYM80JJc0fffK+6p/67MHHW6r3Vdc+tGUpPftv8hgvsvRe9EzvX/LSK6/etf/pJ6v3
5aYmf7+92rjNUrvtmdqsS+k+/UTL/qfV0mX/9rj4bU/zsfTEA9x2+ljZQ+DBB4hHHgs+LbC5ttZR
ZvlFY8Z8Dam/htRf80l9zLM9lLSF1TZDH5Rp0wdl2ozeac/lpV1ht85m5992l7L7ArH+D5/Yz1Yw
VBzwgCAAAC2Yr812iY0rSUewpSYUAZCErtUxOgIUWjeVcJWZQejBWEcAAAAAAAAAAAAACgEAANkA
AAAYjDMAPA0qAD4gAAAA/nic7ZwHdFTVusf3zNn7mySU0DskRKSX0CJ40ShXwS6oXKP32rjCtYCi
AjY0wQpKVUSaUi0gAoJ0kNB7kd4JvSlESkiZZN7/+86eySSBJ2+9+9Z6b61H8fz+3zlnz5lz9pnZ
v32C7ZMU/9rjiVKlvYHiKpCnlPc29y//ojURHQTGq2dV17vbPxSvPEj/QHLav/pMj+eaNlfX8cuL
vxH461lcfdKSP916nBogf2vgtaJCR+FDCxEqVt3haW36eVoz+fqYfr4+Kk497bujleKlp3UrPtbh
ivgwPcyjVETgCEIVaXmEaqgilUPtu7zUpfczSjn4XUJ1UI2VViqgVINT73laYLuR+PulivNMdFv2
TLyOlut6VqpTnub5e3tPuHt7T1zP3k4E9m6Wv7eu5+6t613P3vpe7N00f2/Tzd3bdLuevc0g7B0f
2ttu7SkZ2nontjxmt7ZXRX6VUD1w5A0DC3ztuvV6I/bR7gWu2QhVhtmzRg2xywHeGirJOYG2PN7z
6qp/IrKUSvYHclVEtlLRORYSGShbZXPOQVtBcILgC0J0EYix4I0JpGUqX47yJOZdcZd+u8x0l8np
dplWaJl6fcvEwku7f0xwaduPDi7t6/rscTjBZeCKHLAnkIIDzlaeQKq7TEx3lzH+TD4vXl8gLesq
Z4ohOee/c67yT1ritU5a8r/ppBU5eWmFTl56oZNnXzfaHocv73pPWl74ScN7TAy+2X8rXKtnh/8h
fNLGX5RF4kXly+MueElF5PHpTrlsIfOyisxTTmIgkJoRJH+GiuKd8gIKpyuIeRZzAwoXi9EHxNuN
yrVVvGGg4w9kqSi/W0vPVhF+qWWrKL7iqGXmCHr8AZXiV1HZturn2xK11FwVhfszGjU/7sdMJTdq
plQAV9Dr8iz4BDL4fQB8l3E5bEGAMlRwy2gGuqK4iahM2ZNbZ0zOC70mV/P8glxNc4/O4WqOIJ+H
tBy3o+fat8Q1+zY9ufatx3DNPR2ouaeIa5mZXMM7S3HPYDTX8k9xypWwS5B/WdwrlX7ZvYaB4DVM
C126lNDWmRnhjQURnToiT06gW/PYa2iPyl5Dx72Gcun49LjIFznVfad8TjJd5GpKDvd0vsg57sdD
bsA9S9x8unsaY/LPqDTvnvJE9+zzRfUVuajReeHXkMEXsKs8wW1i8myfcHItJApkSVdzL2ai24H4
gHy2W/EnltvV5D24HRAX0y+dkq9gNHdUgN+9prlSyXJPmt89PXluf83LLHw7hN8k7q1z7YuZeTn/
RgzemfZGtbft9dzh/9N/6BJfTDlZsdLlBeP5s9zFNnJLC97KHSRXFeMPVZxVhatQXD5wc/lT0wZc
f090MGQixAQDrpQnORiwlItfIkf5ogMpeOVgwscqLlwgz01OIB2vH0BDxbMVBbjjBtLdkIyziPPt
hphACtpLwdFlKxMdSEUDfmEnkBYd8LvsCWRib+mrGoODQKrbbeVW8qvILOVEBwL4HGBCj/S7hCPj
7p+pvIFAmlvilwqttIRdU12KkR2YknG75nCf5btB7hyNHRJxE7mH6cdbdw8NbxFv3OXkQJqHD5MZ
jSo+fJw0wq58E/ntaeJeyu+YE3bHFeOTwSmRT5rD58lNqbjGfApLyPdwCjpjst9eB5xmuRihKxS6
dtjb4wu/xJ5AwWsf1iUKdZSw7mM7le1mf9od/+e+TvGZgo8bnElfBt5knrt00KHkOyXV/W5JTnOX
/OZ5GWOX0Znu0ud3l05wmecuPcFlIH/Jb5njJTSPU/5fXUZcliFIIXBkk8vu/SZHZJfRdskX1P1A
zXMvAAZyKgz9+Zh5VUzPx7R8TLFnMifgfrAm+t2vcxdz/ssfOxGQOU8GX5Z/N1z/MciHctqlP10W
lyXfNClZ/x/+lwceBCVe4Q7x74ZrdaP/xHfZjute1XcfUHW95VRrb6NmqpDrlpQtOqrn7PIZz0YV
D98dCtfFkKHgHwyd+Y4ulsdumBvigN/l4lq537IcShj+WuXPj2Dib6z8hG+ttAIpPT8lpidmhqXU
aH9+Sk5x8sISXjA8qWCKVOpd3jiU+LymhhKPqNPCU3SB5EsvkDLDk1MgefxuwucBDtLJK5ACBRIO
xqY8HrulBtO7SDiYsBSdHkzJnDKDr5eYwkYRSqn8rZtiU0wmn/w0Tg6nPB4/2BSdKSNDm3ycYoLJ
4RQdTB5OTsC9sKpVrvvV7ctib80t3B0K/RH7xejk/+oy9Eby77FxaqDM6sWaIZ7WZoivj4pVbTyt
VRuZwWuDgXUrFWeSZHn12arb7f3I83V1KYKWOk0bJ+TPeKGNe1Q1tNHTXao2Zrjbpiz/8zbRnnkM
7TULb08fcdtzl8iN3PZk+aftOelOfONW4e05b7rtuUvVxrvSbU+Wf9qetx/aaxHenre02567xNl8
wm1Pln/anicW7RWZ8wvbfqdS3rdD57yHarB8UoX23V7u/Ey32Ee6dO/R5dVnevZ6tUts3XvrFb3K
VXjAi18+pfG7g072dNRjPa+oDt4rTmenovMe6B3nnPcrXRK0Rt/hPaWfBeXqvk51PV51cOromU57
vRV0l97tPKczQc/qLOcDUxnUx5R3xpiWoCGmkTPD3A+aYNo6y0xn0EzTydlqeoGWmq7OYfMRaJPp
5ZwzX4D2mvedbDMRdNwM0cbMAJ03Y3S0WQTKNN/pSmY1jlmZGTrWbAFFmPm6rtkDKmWW6XhzBFTR
rNc3mbOg6marvsVcAN1g9ui/mixQPZOm7yYFamJO6AeJQC3M7/oRQu/Vrc0F/RiVAd1qMvWTVAnU
1uTqzlQd1I68uivFge4ln36R6oAepOL6ZWoIeohK6VcpHvQ3Kqd7UwvQY1RZv0mtQU9Qdf0O3QJ6
mmJ1Ct0G+ifV0u/THaCuVEd/RO1Bz1MD3Z/uBXWjJnoAPQh6iZrqQdQR9Aq10EPpEVBPaqWHURKo
N92sh9PjoDfoFj2CngC9Tbfp0fQ06B1qq7+iznyl6U49lrqA+tJdejw9B3qf7tET6QXQh3Sf/oa6
gT6mB/R39BKoP3XUkwl9Q39KD+sf6DXQQHpE/0g9QYPoUT2NXgcNocf0DHoT9Bn9Xc+kt0Gf0z/0
LOoD+oKe1LPpXdCX9LSeSymgEdRZzyP0NT2KntUL6APQaOqiF9KHoK/oX3oxfQz6mp7Xv1B/0Fh6
US+hT0HjqZteSgNAE+glvYwGgSbSy3o5DQZNoh56BQ0BfUuv6lX0Geg7ek2vps9B31MvvYbQ1/C+
euu1NBw0hV7X6+hL0FR6Q2+gEaAf6S29kUaBptHbehONBk2nd/Rm+go0g97VW+hr0E+UrH+lsaCZ
lKK30jjQLOqrtxHuFP0zvae30wTQbHpf7yD0bD2HPtQ76RvQXPpI76JvhT4GfQeaR/30bvoeNJ/6
6z00GbQAtFdoIX2q99EPoEU0QO+nqaDFNFAfoB+FBoGmgX6hwfogTQctoSH6EOE+0qk0VKfRT6Cl
9Jk+TDMV951l9Lk+QrNAy2mYPko/C30Bmg1aQcP1MZoDWklf6uM0F7QKdMLSCNA80GoaqU/SfNAa
GqVP0QKh0aCFoLWg00LraIw+Q4vkldfTV/osLRb6GvQLaAON1b/REtBGGqd/p1TZchON1+doKWgz
TdDnaZnQRNBy0BZQuqVJoBWgX0F/WPoGtBK0FXTB0regVaBt9J2+SPyJsh10ydL3oDVCk0FrQTtA
ly1NAa0D7aQfdAatlyPcRVP1Fdog9CNoI2g3KBPE6/eAs6S6h6aBNoH20nSdTZtl/T6aoXNoi+Wf
wL+C9oP8lmaC8ImL6ztL59I22fIg/azzaLvwIZqtA7TD8hzwTlAazTHK0lzQLtBhkAeUJNseoXnG
S7stzwfzZ+lRkGNpAWgv6BhIW1oI2if7HKdFxtB+y4vBB0AnQARKEv4FfBB0EuSztAR0SNafolQT
QWn2eE4jRUpiXgo+DDoDirK0DHRE1p8FF6MjQstBR20bv9EKU5yOWV4JPg76HVQClCS8CnwCdA5U
EpQkvBp8Uvg8rTHRdMq2eJ7WIp0GpYNKgZLsmj+QS8uaP2gd6IytX6D1pgydDaUNSL+BLoLKgpKE
N4J/F74ELgdm2gQ6Z/e8jFQeiWkz6HyovgUpHZQBqgBKEv4V/IfwFXDFEG8FX7D7ZiJVsolzFm0z
leliWN6OfAmUDaoCcuvZtAPpsnAOuCqYaScoI7S3n3aZanTFZq7k0m5THVaVn/cgZwnngWuEeC84
224VQIpBYtoHyslvET15n4kNVTjvR/YLe8A1hd10ACnXJi9SnCTmg+C8UBsO8g3ITIdAgbDXcyjN
3ODDmAH9Ps3UAgXXaDqM7BE24BuF3XQEyRvWCtFRU9vnhCpc89ExU8enw2rBNRFYU1fWMB8Hm7C1
kajUQ4XpBIgK7BtJJ1HzgaJA9UH566LoFCoRNhVDahCWTiNFhm1dHJWGUmE+A44qdJwl6Kxp5CtW
qPYbasWFS4IbCwfXlqTfUSkRytHITUK5YOul6JyJ95W8Sv086tGg0qCmoPC1pSkdtVKhXAa5WYH8
B3LpAvuURa251JgvgMsUedWydBH1sqByoBagguvL0SVUy9lUHqmlTcHKZVTKF9inAmoJtsYpA6lC
kVeuiPpNRerumitYU9GmSkitbEoK1TJRqxRWqYxK60KVLFQqF2m9Cuo3o86UDapy1atUhXKwriqo
KugvoMJbVCU/6tXCKtVQaVOokotK9UJ7Vkf1FlvllIdU4ypHwWtrUMDc6ou56lp3ixhskVhkC9R9
CvXYQtVYVG8LVTl7kGteo+2aPq+53Rd3zbUO1t5gUxxSW5vCt4rzadRrFdk/zN6mTFFsL/+Et70v
3rbC29R7zAs78P7De8Lbx4HReOc7Hbx7nB6gDGe0U8HB6MuJc3Y6bZ0M0J2anC66NugZ3djpqx8A
vak7OCM19nAG6pecHzVG1c5Y3d9ZojHydKbrcc5mnQparGc7B/QO0Fq91jmt8d3n7ND7nMs6B3RI
n3UCphjotM7WkaYK6IKJ0GVMXVC2Ka+rsBtqr4nVcYYdKNI0hJPdp9jgboLBPQqqYG7XCeYZUDVz
r25jXgTFmUdgYuwddcw/dHvDZtHQPKvvM+wOTU033dGwE7Q0r+lOhsf6N5u39OOGx/C3mr76ScMj
8rbmY93Z8Ei7nRmouxoeN99jhukXDI987zcjdXfD49iO5mv9iuEx6SNmku5peCz5qJmsXzc8Cnzc
TNNvGR7FPWFm6XfMNtDTZp5OMbv5yphF+n2zH9TFpOoPTRroObNC9zPHQC+YtfoTwyOG7maDHmh4
VPCy2aIHG/42f8Vs10MNf/f2NLv0MHMF1Nvs08MNzq5+wxzUIwy+o/DqR2BOXlAfc1yPIXwT6HfN
KfhSBCjFnNXjCFdBv2fOw5LwOak/MH/AjUqDPjSXYHrlQB+bK3CjiqD+JgtGhPscx+aHEVUDDTAB
GFGMYtPzwINqggaThgfVAg0lgv2gD8H5ImE/9UDDqBicp4Fi5ysB52kEGg4rniNWPILKwG+agUbC
j+eLH4+iCvCbBNAYqgSraaXY/qrCZf6i2P6qw2XYmcdRDRjMrYrtLxYGwz1nAsXBX9oqtr9asBb2
6ElUG9bSDvQNjHqlGPW3VA+ucrdiD2wAV2G3/p4awVDuV2x/TeAlbNk/UDxcpINiD2wGF3lIsQc2
h4s8rNgDW8JEOin2wJvgH48KtQLxaGUGtYZ/PKbYCP8C6/i7YiO8Ba7BNj6LboVrPKnYCG+DV7CX
z6bbYRPcx+fA0HeKoc+lv8Ig/il0J4hdfR61g0t0VWyEd8Ef2NoX0N3wh+cVG+E9MIYXhO4F8Z2y
CCa/X0x+MUz+gJj8L/QgfOFlITYH3Odww4fgCq8qdsOHYQhs90tBhy11AvVS7Ih/gxv0VmyGj8II
XhdKAr2h2BEfgxGw+6+E+x8X918J9z8u7r8KdEJoNT2Bcf87Qk+CeD5gDT2F8X+yYkd8GuP9FKHO
IJ4ZWEf/xHj/faFnQXyfr6cuGO3zHMEG0G+WuoI+UmyN/8LY/mOh50D9FNvj8xjZ8wzCZnoBI/lP
hF4E8VzCFuqGMf0Aoe6ggYqd8SWM5gfx5zGu38sYvQ8W6gHieYVt9ArG7kOFXgXxDMN20CVLr4H4
82cH9cQ4fZhQLxDPOuyk3hilDxd6HcSzDrtAVyy9AeL5h92gTEtvgkYqdse3MDYfJfQ2iOck9lIf
jMvHCL0D4tmJfaAcS++CeJ5iPyVjZD5WKAXE8xQHQLmgJOG+YP6EPEjvYSQ+Qeh9EM9ZHAIFLH0A
miT0IYjnMdLoI4zAv5V2DtPHGHN/J9QPxDMZR0BeS/1Bk2XLo/QJxtVTLH8K5nmNYzQAY+qpyvXJ
gRhF/yg0CDRNuT45GCPp6UJDQDy3cRLkszQU9JPQZ6CZig3zM4yg3fmOU/Q5mOc7ToMiLQ0D8ef/
GVCUpS9As4WGg3gO5CyomKUvQXOVa5gjMDKeJzQSNF+5hjkKo+AFlkeDef7jHKgkyLXNMWB3LuQ8
fYVR8GLLX4P5mycdVMrSWNASoXEgfA+jh47DONel8aClyjXNCRjdLrM8EcwzIxdBZS1NAq1QrnNO
wog1yN+AVyrXLb/FSHWV5e/APC+SAapg6XvQGuUa52QwfydeAVW0NAW0Trmu+QPGn+stTwVvUK5j
/ogx58bguAc9dxpGkZssTwdvVuyW0zFydGkGaIvd2k8/YbT4q+WZ4K3KNctZGCFus/wz2J0dyQPX
ADPNBu2w1Tlgnh0JgGIszQXZ2RH06rnwyl2W54F3K9cq58Mq99itPLQAaa845QI4pUsLQfvsFg4t
glHut7wYfMCu0fSLqUUHLS8By6wIevsScyOYKRWUFhohEnJtZKaloMO27qNlpo47MwJeDrbzIejv
K0xdmQ9x00okmQdBr19p6vHsCGgV6IStrgafFFdcbeq7MyLgNWA7I4K0Fum0OONa0yB/RgR3wFrT
UNYUp3WgM6H6eqSzyvXD9aYRmGkD6De7TUnaaBrLjIibNiHZmRDcE5tNk+D8B9IWJJn1wP2wxcTz
XAjoV9AfdptStBXpgvjgVtM0NOPhGuA20yx/zgN5O/Il5VredtOc5z9AO0CX7TZlaSdShnJNb6dp
EeJd4Ct2q3K0GylTbG+3aSnzHsx7wFl2mwpICUhMe0HZofo+pBzlet0+c1OBWY+KtB8VvxjdftMq
NMdRiQ4g5YbSQaQ8cbqDprWd4eB0CCmggsZ2yNyMxJQGd8uf0ahCh5E94myH4Wzu3EZVOgL2hraq
SkeRHbG2o7A2RwUd7hiSVkFbOwZb02HvoTodR8WIqx2HqxkVNLcTSBTaLoZOwsd8YfkUcnCeIhbp
NiSm06DI0HaxdAY5yqaaSLcjMZ0FFQttV5N+Q3ZnKOLAbe0MBaffkfJnJ25A/muBfA65ZCjXQr4D
mek8KDpsTTpyKZtuRLpTEvMf4NKhLW+kC8hlhGuD29m5B04XkcqGtqyD3F5mIOrQJVC5sDWXkYPz
CHWR7pLEnAEuOHfQAXd4hrnbVjldQaoYtr4+ZZp7CswR1KcsVCrb1ADpXknM2eAqYds2oBxUqgo3
BN9n5wQ4+ZHCvb8RDP/+At7PtTzUaoRyY+QHkJkCoKIG3wT1B20dCeb+YJjPc8WDChzGxIM6hFk8
V7yoxIVVmqLSERUmB3RDgddqCkvvaC29g2mG9JAkZgO+scDWzXyEWm3h5uCHhZNs9iHXKbB9c18E
avBl0wL0CCipyO8OpiXWdZJ1zJHgeoXWR6FW36YEpL8hheYRNmxQnon8jdfJ01H3knmEL7yPemd7
Mbr3VnGqe2924F3ePs4Q7xgHIyvvEueI95CGcXov6JpOGX07fL6Kfti5WcMW8N8+zuMa41Dnb3qc
01tmCrrrxc5AfQD0nt7tTJDnxMN0uvOzKQWaZLSzwtSSZ8IVna3mJtASU9c5ZO4CrTetnLMGR+7s
NO2cDAP/cdLMI1rxDIBzxjylo0yyzC28qMuYT2VuoZeuwk+Rtdck6zjDY91I01/XM/zkLNp8ppsY
Hg1WMKN0guEnVNXMeN3G8HOlmjD728Xsa5sZup08WW5o5ur7DD8xiTeLdQfDzzVamuW6kzmq+Dnx
Wv2YWPytZpN+0vAMfVu4e2dx9zvNHrg/P22+2xzQz5tcxXMLR3V3wicm2jqpe5BP8dzCb7onFVc8
t3Bevy6e/jjs/C2x8ydMpn5HnkA/ZXJ0MlUFdYaTvydO3oW8+kN5Fv0cTLyfmPgLFKU/ofqg7vDv
geLfL8O/B4t/v0JlYe3NQa/Buj8X6+5NlWHo/Hz6DaoGQ28DeguuPUpcuw/VhJfjSut3Ydhfi2Gn
wLDHiWG/B6+eIF79Abx6knj1h9QY5v2A4qfI8fBttun+sOnJYtOfUAv4Nj+9HgCHnioOPQgOPU0c
ejDMebqY81CY809izp9RIjz6KcVzC7fDntmXv4AvzxZfHk53wJ6fVTy30A6mzJY8EpY8Xyx5NNx4
objxGLjxInHjr+h+WHF3xXMLD8KF2YjHUUcYMD/lHg8jXipGPAEevEw8eCI8eLl48CTY7wqx329g
vyvFfr+lx+G4bymeUfg7fJbtdzKcd6047xSY7jox3R9guuvFdKfSMzDWvornFjrDU9l0p8F0N4np
TofVbharnQHaIvQTrPZXsdqZsNqtYrWzYLXbxGpnwWW3icv+DJfdLi47Gy67Q1x2Dlx2pzwhnwuT
3SUmOw8mu1tMdj5Mdo+Y7Hz46x7x1wWw1r1irQthrfvEWhfBWveLtS6Cq+4XV10MOiD0C1z1II1Q
PKPwJrxwpNDbIDbUVBhqmhjqUnjpYfHSZfDSI+Kly+ClR8RLl8NGj4qXrgAds9QXxFa6ElZ6XKx0
FVz0hLjoKrjoCXHR1XDRk+Kia+gjOJ7romvpY7gdu+g66geP+16oP4g/EdaDzlr6BDRF8UzCp7A4
9tCNNADeNlVoIIgtdBPonKVBIH7SvpkGw9jYRrfQENjZDKGhIHbQX+kz2JlrnlvBF8RHt9LnIDbP
bTQMRvazrN9OX8DCZgsNB7Fn7qAvYWCuZ+6kEbCteUIjQTxLuYtGwbZcy9xNo2FYrlvuoTEwLNct
99JXMKrFQl+D2Cf3gXIsjQUtERoHYp/cD/JbGg/iT8gDNAFG5XrlQZoId1oufIgmwZlch0yDTyp5
6p4Gm1TyrD0NLqnkWfthkMfSdyA2ySMgr6XvQWuEJoP4s/goyLE0BcRP3Y+BtKUfQOuFpoL46ftx
kLH0I4ifuJ8AkTVNnhWYBjvaZHk6mO3yFCjC0gwQf/6fhmNGWsc8DceMlOfvZ0BRlmaBXNc8C78s
Zl3zLAyzGAyT5wNmw3pcmgPib9vfQSUszQWJW6IvzYXtBHkeeLfweXhmtHgm8wIwP39PB5UCJQkv
BO9TPAuwEJ7j0iKQ+0z+AmyzjH0SfwGuWUaev18ElbW0BOQ+ib8ELsfOCUoFBZ/JX0Yqz8YJWgo6
LNUM+GYF8U1OV2CcFcU4mVeA3efvmeBKdExoJch9/p4F26wstumm1UjwTfTO1fAPl9aAgs/fc+CU
VcOeuvuRq8lTdz8cs5o4Jhv/evhF8Jl7LsyyujxzzwPVsM/c82CYNewz9wD8Mib0pD0Av4yBX7Lp
b4ZHnJdxk4JbxlrP9IBrimd64Jk1Q57phV3G5T9PR0/dCku4ILQNdDFU3450SUx/O+zAtU0Nx6zF
T9LRX3fABOT5OngnOMPuSTDM2iHDJHhlbTFMH6iOfbLOaQ+SPEtHH96DcX+W0F5Q0DAjYJV1YZVs
+fsw6s9/hh6FXF/WRMEu61u7dNccQM4V1z+Akb37/LwY7LKB2CW7/UGM6/OEDoECoX1LwC4bWbvk
dBjJNcqS4MYhPgL22q2iYZRNQs/JOR9D1mL0xzBWD39azm5/HONxE5ZPIJM4/Qkee9t6GRhlMzFK
NvmTPPIWOsXj7dDeZeGTzeGT7PGnMf6OtPVyMMkWIa8sj9RSvLI8vLJlmFdWgEsmhJ52c/4duYRw
RfBNBZ5zs62fM63CbLISHLKVOCQb+3nT2vokp3SkoE1WQboZiekPUL5LVoE/3gx/ZEe/AEcvE1pT
Fe74F3FJ9vSL8PQgXwKHP6euDnu8JfScmnMGcgXhGuBbi9hkDPwxsYA/xsAfE8Uf2cozYeWV7JpY
mONtoWfN7OJZcPHKQtmgKmFrcpBdi4wDtw1ZZBwssm3IItnK/bDyakK5oII2eQPs8a9ij7VAd4R5
ZS1Y4x0ha7wR6c5CbokqXPJOuCRsHNSugFXWhku2E5eEgYPbW6/k5EUKd8q6MMm7CplkXbjjXdYd
64HvDj375WyQbwzl+sj3IDMRqHaBlurDJO8Rk4R9g+8NWSXnCOS6odwQ+b4iXsn1SNTrsX+D7g8z
Sq5EoVI/lBsjPyCZuRi4QaHWmviKw7gbFqqVQK2RTfFIHWxyc0nkxmHbN0WlIypM0aAmhV6jqa8U
qvHCzcAPCQfXNvOVRqVpWKU5Kg+HVcLXlMGaZmLdZWDdzQqsbeEri1rzUG6J3MlmTuWQWhRpM8FX
Htbdski1AqoJwjeBH/UlhLx8HH7n/4S2+//VeNrzMu64OKwZX3g7+VmAWM83nifQi66yhbX8WHUI
W7QttIX7E+BxaqPn7oYNZdlrOy+PIivJT6mG+TMG9t/Z+OS/8aqH6e9MjqimmqnnTF/np4ha9njd
NeMjyqlYZ7wZKlRTvYH/FvrJczUO/ryXbrjGz8Ovtj/fHnxd+bcFaje9WCy2K/8PLZJi4xu3DP10
e+jnIjwlzWnPXddsdU2hVuu/FGWbaxqf/xP3odkRTx+0NuearS28ZmuxTRPCjy38enodM93rUKdr
tDmsSJsRsV2f7/nU1d5trPdfaOtf12xrQuG2nnXbutp7jfWuR1vrr9lWvyJt+dy2ElSRtmzPcpqb
0wkJvKSYdbx8AFlJ1irhGq8zovDr9KXmjRP4/19y7X8PcRaheujfQ7RSdZ0E32j5d2AF//XDQBX4
D0kYYukwVBzwTCcAAE+Idp85SLTZu3AyxQ1DCLa/q0VgbnDpBjdUz3QrzdXXXvAAAAAAAAAAAAAA
nwEAANwAAADka1AAEKIqAAonAAAA/nic7NpZjJRXeoDhU13dXQ1uKHZbE02KfYmSEcNilptyBGbN
RRSxg6KxZlgNHmuUYGNsV9+xw2ikJOyQO2Oz5pK1gJtILDaLokjDUmw6c2Oow1rQ1fXnO//31tY0
0OMh9iTymOY5p2i6q//lrXNqyP6j8f+7EtllutYEjSYoGFPzDh9Daz7s0CW+KPyMfze/MgsmT/yH
oSYis3kyq/u791b8+p//aaRpx/9q5KNBPiLHfvrFL1/52bvN+vDjL+V7dSw9i2E1s2r+u+EP8Xfa
eC7Rib9578NFQ1/yNaeauZGfRv7wnZ+LfybF7x+Tv99getfsrV0Z+6J2pR91Xhr7ovNS85NfmF+Y
IJDPqJH/+tZcq/2PehN6Gi/jHXys1sXwLRyCY3EqzsNl+Dluwt14CE/hJbyNj9T6enwTB+MYnIJz
cSl+hhtxFx7Ek3gRb+FDNVaHvXAQjsbJOAffx09xA+7EA5jGC3gTH6gNtdgTB+IonISzcQmuxPW4
A/fjCfwGb+B9tUMUe+AAfBsn4ixcjJ/gOtyO+/A4fo0ZdGrHGuyO/XEkTsCZuAhX4FrchnvxGJ7H
65hV34hgN+yHI/BdnIEL8WNcg1vxKzyK5/Aa3lMbDXbFvjgcx+N0XIAf4Wrcgl/iETyLV/EuBmqn
LtgHh+E4nIbzcTmuws24Bw/jGbyC32JB7RzH3vhzydxPaJj2qm/N7zuPGO3/9Pe1K0f7ov+rqfcB
jfjxVtMQ3JTJ34bN22z+2nQw0fqJ8z+Yv/w9Y6LyXyfz9+ZnptaYwJgu9b9tXOQ/zOCalujV6PCf
jZS/tUU+/q11A6PrtYHiabyMd/Cxqg0U38IhOBan4jxchp/jJtyNh/AUXsLb+EjVBopv4mAcg1Nw
Li7Fz3Aj7sKDeBIv4i18qGoDxV44CEfjZJyD7+OnuAF34gFM4wW8iQ9UbaDYEwfiKJyEs3EJrsT1
uAP34wn8Bm/gfVUbKPbAAfg2TsRZuBg/wXW4HffhcfwaM+hUbaDYHfvjSJyAM3ERrsC1uA334jE8
j9cxq2oDxW7YD0fguzgDF+LHuAa34ld4FM/hNbynagPFrtgXh+N4nI4L8CNcjVvwSzyCZ/Eq3sVA
1QaKfXAYjsNpOB+X4yrcjHvwMJ7BK/gtFlRtoNgb22hgdI02MLqmHQ38q/0StqHmRWWrHatlE0/j
ZbyDj1Utm/gWDsGxOBXn4TL8HDfhbjyEp/AS3sZHqpZNfBMH4xicgnNxKX6GG3EXHsSTeBFv4UNV
yyb2wkE4GifjHHwfP8UNuBMPYBov4E18oGrZxJ44EEfhJJyNS3AlrscduB9P4Dd4A++rWjaxBw7A
t3EizsLF+Amuw+24D4/j15hBp2rZxO7YH0fiBJyJi3AFrsVtuBeP4Xm8jllVyyZ2w344At/FGbgQ
P8Y1uBW/wqN4Dq/hPVXLJnbFvjgcx+N0XIAf4Wrcgl/iETyLV/EuBqqWTeyDw3AcTsP5uBxX4Wbc
g4fxDF7Bb7GgatnE3thG2WpHadlqR7WvbMNkyfbCslnKZimbpWyWslnKZimbpWyWslnKZimbpWyW
slnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnK
ZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimb
pWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyW
slnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnK
ZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimbpWyWslnKZimb
pWyWslnKZimbpWy2zbLdpmy321O2fVK2F6/Z6v5Fyyaexst4Bx+rWjbxLRyCY3EqzsNl+Dluwt14
CE/hJbyNj1Qtm/gmDsYxOAXn4lL8DDfiLjyIJ/Ei3sKHqpZN7IWDcDROxjn4Pn6KG3AnHsA0XsCb
+EDVsok9cSCOwkk4G5fgSlyPO3A/nsBv8AbeV7VsYg8cgG/jRJyFi/ETXIfbcR8ex68xg07Vsond
sT+OxAk4ExfhClyL23AvHsPzeB2zqpZN7Ib9cAS+izNwIX6Ma3ArfoVH8Rxew3uqlk3sin1xOI7H
6bgAP8LVuAW/xCN4Fq/iXQxULZvYB4fhOJyG83E5rsLNuAcP4xm8gt9iQdWyib2xjbLV/U7LVve7
9q3Zfv6SNVv9OC2beBov4x18rGrZxLdwCI7FqTgPl+HnuAl34yE8hZfwNj5StWzimzgYx+AUnItL
8TPciLvwIJ7Ei3gLH6paNrEXDsLROBnn4Pv4KW7AnXgA03gBb+IDVcsm9sSBOAon4WxcgitxPe7A
/XgCv8EbeF/Vsok9cAC+jRNxFi7GT3Adbsd9eBy/xgw6Vcsmdsf+OBIn4ExchCtwLW7DvXgMz+N1
zKpaNrEb9sMR+C7OwIX4Ma7BrfgVHsVzeA3vqVo2sSv2xeE4HqfjAvwIV+MW/BKP4Fm8incxULVs
Yh8chuNwGs7H5bgKN+MePIxn8Ap+iwVVyyb2xjbKVv+Olq3+nfaW7cVrtnpH2Rxlc5TNUTZH2Rxl
c5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TN
UTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH
2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxl
c5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TN
UTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNUTZH
2Rxlc5TNUTZH2Rxlc5TNUTZH2Rxlc5TNtVm2u5TtbvvKNvQla7bYLi2beBov4x18rGrZxLdwCI7F
qTgPl+HnuAl34yE8hZfwNj5StWzimzgYx+AUnItL8TPciLvwIJ7Ei3gLH6paNrEXDsLROBnn4Pv4
KW7AnXgA03gBb+IDVcsm9sSBOAon4WxcgitxPe7A/XgCv8EbeF/Vsok9cAC+jRNxFi7GT3Adbsd9
eBy/xgw6Vcsmdsf+OBIn4ExchCtwLW7DvXgMz+N1zKpaNrEb9sMR+C7OwIX4Ma7BrfgVHsVzeA3v
qVo2sSv2xeE4HqfjAvwIV+MW/BKP4Fm8incxULVsYh8chuNwGs7H5bgKN+MePIxn8Ap+iwVVyyb2
xjbKFtuuZYttb2/ZKtZsfHakc+mz/8uY6HA+O2I6lv5FXSfzoRlc959m3F9Mm7/sw96Dpw7p/d4H
v+o94de/+eXiDxb2Hjxz2d8MG1L17+02m27+L9YvNL/F9TVLokMbLkSPmkjNPfOSXw1PTU08yD0z
HZ/Jz1kITLbZNMgw1RI0m47N8lheHsuHw6QMC3nT0GyeBaapxXTMyx/LMKvDhAzzLaZBhqmngTzW
IocmF5h0wXSRYbQQ1GT87yYTPhCNB0GuUKRzi6lJBkHe1KSCgk5TgXzfmlgQ6DQImppNbRCkjelc
MDXRIP/M1CaCjE5jQVam8rscv4L/kZqemmiQM6axYCLJQs5EkwWdpHI5/011EmRlEguaTKdaebJB
Wmbyu2mUWTRoeiLfNWPeiPoj81ieX1bHeRknGOdkHGeckXGUcVrGkazp6MdNj4wMO8gFFXtoIh+G
o3oZDQ1HtTLq8rJT9KJf8iWMHGZ4I++ff3M4bmzxByRXniSCQCed5LjLYW7KF//Inw6dyFE0kUJ4
sotTf7Jy5am/PPLlabwQXg7hF/LTlkAn8YKpSwTpVCCXSGleMPJQeZ7Mm1iQqZjn/LmomMt5rJyn
5DSnchXztL8cq+eJQsW8yT+/6nks0HmXgqmXM+5PcKHqATl+pQf8P/StKT0QVyJBpnqeylbPk63m
iVz1PJ5vNS9Uz2NB9TxaPa+L+KdZNU8X5xF/uGv97cA85eepbPVcjnNpnvbzQvU8EZTmSTk9tXIf
leZyOuQGy5Tmcjpqo3LDMU/I6aiNyBPWuVxz8g2jcr/q5eJvSTn+qULVNFmcxsJpojiNhtNYcRr+
cP5ylOvcnwa5fgt6NcuPlQ/LobOEn8WLs5ifRfwsJrdgUmz/3RXzV2T62Y9iOw+bvJ6YVF6OtH8R
iTczSPpB/TN53WjxLx8mUhxEi4NYcRB/bpBgIFdUJmdizb7nT9Q85tRUFjOtTLfPZGv5+4mifP14
Ub5vjOcRLRo8CZ+wXKjyhJ/pC4s3mVUT+Zw/LnLVZ562caTCF+DmP+VYlQ9a8kUHLfWaDtpzBy/T
6uBlWx08vm+c5xErtPegFSoPml+PFH/Y1zpo10uvZHPog5DkA8mUvwQfmoaCP9zyaq+D3CPToRC+
3MpigJEsHToWwuwZOVzFYYFhi7wY58JhTIby4/olVPio/MA+gPngabjU8o/JescvteSxZ+HqLCGP
5XTNFpGFmqTPL+nCR/P+tpTHpPAdn4av1H6hVp8z4Y2aCx+RwRPy7Adhehsek1afz4AHwkH9Y1P8
zLgf1D8x/kt0zLFK0GGqUPqeMV0s+GFK1xz+2fkFRqE5HPrjkGnWC72FH8k/xo8ZaeFHT/jH9HDI
Y3qI/GOyqpPH5Cdr0iPoVye58iGWtVz5FJRPi56p7CM9h0HxHGZKp66p9Nm5x5VfrDiUi7pBFz/6
WIRzyLPiHEb1HIanzh8eHfqTnNaf1B+TnA79o03hIryltBqPh6vxZ/rls3oYE+UjGn55PeRJPfr+
pMaeO6nxQuU59INYwB9Fip8TvgT7vx5tYZAMB0/DS01PZlIvoHDLwGWlWwZ/qRU3DU3hTiEfXpT+
DMb9hSqDvJ7TlvCRp3rQ8np4Cnq9FnKtb4fKm0RvnRefzNyj8o1YvDO5Ublt23OHl1fm1at1XcFX
LOsrV/vP7QIqdweVuwZ2E1XbjFY7kMrNyXPbltKGpnqv02oj1Hqb1GoT9fwWq2ID9twG7bktXMX2
rrzlK28DKzaH5Q1jeRNZsbUsbzcrtqDFbel32Bd9/7866muHkf1EcVhg+NQfsdIwVx7Kyevgh7kg
Uh41lUbp0ihTGmVNZ0lEPEj7VbccnXCa9E3xG698OPUbpZi/j3Sq25omvyDvLK+xEb9pkJMf1WlU
dkh1yYx8RjiNyWmrS/gdQziNywK/Ll6eypmsi/mqN3UO10QyjeafmybDaTLtdyetpv4mTFdNE+lO
zbqEr62eBa9v1rlZ9zayWXrVVJ9dKvxRStNkOC2UfpTwMJSnOaYcBn8I4+Wj4g9wIl88hAl/+JN+
oy4LvvDGla2pnMdoOH8j7u9Sf27l6/l5zG+o4zJP6NxvpqTcmYg83uhf5puD2rSfyI0jw6aIfKnG
Z+H6u9bXw3R6Fla0zrckE87khaQuXNCHM3mFqMuG10cnfW2pS/vnZjo9NR2SPgrGn0I/k0TIhRDx
F1fOv1B+t/1A7Dutcp9f7lbsCLK6uE0ET6oXubl27gxe92K3vTuFdi962SnEf/hFb+WvN+R1IZHT
v/t9jtv79OTIRf17N/Ly4sdxP87rOBm+p5P3d4qcTt44aXym7/5E/JtUnZp56yfi36Lys6jOsjqL
6SzX1iyuM8lAI/d/+Fs4yfm3JIqTbIv2t5HEhG2umrwRXmf6nlrluDG8Dn1FJB+NtE5++54nVc+g
OGn9PNv+yRrpqFz+bR2aqkk+fJtMJ/HwPbZ88Ug3+WWRzmL+janSWYhFKWdxJr0L/KyjVtMvlht8
M0tL13y4PgnTlNeg6i5JhzFWtizAM+F+yq9Em02Hp36J5t9rfXEYf9AA5V4eoIgPp7/46U8qQ39K
3Un/GXSneGzLR7t0AmTgt1HsJ9keVZ+zcE+Rrz675TOuV4G/TvS1lXs+5t/KNInizL8s+9fmtgsQ
Xok5LtLwnicA8fDyzb8yAJU3w6tr8OL77/9uASoPR9WBqjqEpYNbfdyfOyfV56vVuSyf51dGgEun
1QXFZVa69P6oGrS+tMO32h++0nDblwnfx3/64+TPfOLfEko+8aF73YMffK/7iuV+jbxEPvZP+HUP
ZOlWF/f7H13GhbuqRCFcxtWnwn1TcRnXxDKukQ1vWB0/ifqS+ND4Scw3Jl5stq9PLF8xiRabHRar
2KU0kxctzcJxU6txquV/K74vL3E4yVRMnq9vOxZjlesvv38Nl7Pl9Vey1OJMRX3DnWus3OI/cf0V
Lb2J/R1WXz/uSf/f70n9P4GI6r+ESOk5jBRPZqLqrP4R/xekv1TjcoUWdJjQq1bugvpEwaSa4nKV
+ms7kZVJuIX0s2TGpNImlS7NkmmTYNUhQ/kVZ0WSbPKzGLOUzDImmquasbNJyTfPmEjV7H/aOxvY
OI7rju/t7N7xU7IoCnADo2RJSVCLIJBEUXKLwExRSiKQAg7qSKKQAq2bOKJYR3adFqZENFQDpbUk
GnFhNFBFElEaFYXMjyixU9gtKbIw2iatRYpAUKd1IlJy66p2ZR5JWyYl6rbz8d/j3tx+3+6RcgV5
/dvZ2Zl9O/ve7Jt5s0cls5xKy6mubGptbmpBTjXdZdNSJWbqeMZMppYck1RwKSnmxuyTY2xuS+la
TiYsSXZbbH2BmUzziSmWZDIykZifJiTmKx7SxFge7XUtrbWmDCNj9ja02bOphEgtLadqeAqvDTa3
LRK0xVO8j2IJKhnhDiJLpJiY7Amz1w6bAuuizz51ixnQ0sq/cX12ePcXea3uRV6s70rctfZkKYG1
AjV3efSrVlgt290qzJntPixW9ZTT3U8vYrhI9x9ZFC91tt+0KKZPeEsdvy3e5cJnZT27mUizKYAM
Egu3xUxWJX/P8zfCAlIZPimWRsoQDoBYq1NjiDU4Y+Y6H+qPiMVAleIRMseF9Z78+S4w/4Tqm1jl
Qy+mcg+Prd5hJswuIlJdBl/URt/+a/iCtuNm3SzJZ93ElSv5aWmIVcmrWGAakREpWj2foLujVCwp
ST7HzfwHlugymNOSFokaFjUxpkWC1s/Wr91hq+x0pn/M1WD7TPu6MmKfzcQzfS1jGpxJGCKeq3UZ
hKkt220y/syYFrtrjQkDsV9mkPSJ8HdRxlhk4R6qn0aGrwyhFrEgdqiliJ0mLBrB3AxfEUENgb2Z
mTiMCWoLSerlLAl0CFCNWT0Dk/sB1vsBVq//XKb9zLnYseXJmXTOuMF1ts8yDskdoAh3gq2IWR7K
WCaWLZPO2en9JtuRknUMlTu7ZzvVx0OW07x78h7TxTOlZx2vZse0Xfnj2xrrPls7nLEZKeeMoflQ
O5tgzZTCuJtN+PFzc8fqZjCGOdLcUUsrIkzDB/58cc8SJgSmFfa64GOGj6jtRr4TwtW6v/7x/vpH
a+N9DNc/Lg8r+NrgskXm24wlpoVVJtg6hQWxn2L7mKar4esXjmO8xRNj3KYzBhkzY61sJRpLic6Y
vQvzU9mueaFpLGGO7ag3xIbY2RQfbWMUWLPER9tmaoGlCFLUTeDjUmtKMVPTOakxM8XHxSJlDmbl
5PHiJo1cMcxB9LLIy6lEzs3lpswBdk06J7Vgbb61S9ampQNzNsmRDcMqloeQ4o/EEpJpGiNmij63
pjEeooUC8PG2+bLGvGDT8rxgjXVeMJMzLygtjOSrTsUkYY05SUiyk4Q17pOEPNwy9sHHnvENBFb6
zorF7Jd955Tn+S/g16Yuap2pi2ueVGrV81qnej7/9+5Tz675gnKb8svgPrAZbADrwHWgIpicAa+C
l8FhsB88C54EO8BD4H5wN7gDrAerwISgnganwHFwBBwAe8BT4FGwDTwA7gEbwY3gelAV1GbBaXAC
vAQOgr3gafAYeBhsBfeCO8FNYDVIBMkceA28Ao6CQ2Af2A12gu3gQbAF3AVuBjeAmqA6D17nlH+f
/PyaVuVhqg0dnPbfn7bji1L2a+RbSrZUzmnbd2x1/u2Q1LMVk0IjwX1gM9gA1oHrQEUwOQNeBS+D
w2A/eBY8CXaAh8D94G5wB1gPVoEJQT0NToHj4Ag4APaAp8CjYBt4ANwDNoIbwfWgKqjNgtPgBHgJ
HAR7wdPgMfAw2AruBXeCm8BqkAiSOfAaeAUcBYfAPrAb7ATbwYNgC7gL3AxuADVBdR68zpmnkRXj
QiM53TWSamNFm7a9wVUby/cIbQT3gc1gA1gHrgMVweQMeBW8DA6D/eBZ8CTYAR4C94O7wR1gPVgF
JgT1NDgFjoMj4ADYA54Cj4Jt4AFwD9gIbgTXg6qgNgtOgxPgJXAQ7AVPg8fAw2AruBfcCW4Cq0Ei
SObAa+AVcBQcAvvAbrATbAcPgi3gLnAzuAHUBNV58DpnnjaW/4bQRk5PbSz7ubZ9u6s2lg4LbQT3
gc1gA1gHrgMVweQMeBW8DA6D/eBZ8CTYAR4C94O7wR1gPVgFJgT1NDgFjoMj4ADYA54Cj4Jt4AFw
D9gIbgTXg6qgNgtOgxPgJXAQ7AVPg8fAw2AruBfcCW4Cq0EiSObAa+AVcBQcAvvAbrATbAcPgi3g
LnAzuAHUBNV58DpnnjaWvia0kdNTG0sf07Zvc9XGkm1CG8F9YDPYANaB60BFMDkDXgUvg8NgP3gW
PAl2gIfA/eBucAdYD1aBCUE9DU6B4+AIOAD2gKfAo2AbeADcAzaCG8H1oCqozYLT4AR4CRwEe8HT
4DHwMNgK7gV3gpvAapAIkjnwGngFHAWHwD6wG+wE28GDYAu4C9wMbgA1QXUevM6Zp40lnxLayOmp
jakfabRrdNPG5N8IbQT3gc1gA1gHrgMVweQMeBW8DA6D/eBZ8CTYAR4C94O7wR1gPVgFJgT1NDgF
joMj4ADYA54Cj4Jt4AFwD9gIbgTXg6qgNgtOgxPgJXAQ7AVPg8fAw2AruBfcCW4Cq0EiSObAa+AV
cBQcAvvAbrATbAcPgi3gLnAzuAHUBNV58DpnnjYmzwtt5PTUxuQj2rZfddVG/SGhjeA+sBlsAOvA
daAimJwBr4KXwWGwHzwLngQ7wEPgfnA3uAOsB6vAhKCeBqfAcXAEHAB7wFPgUbANPADuARvBjeB6
UBXUZsFpcAK8BA6CveBp8Bh4GGwF94I7wU1gNUgEyRx4DbwCjoJDYB/YDXaC7eBBsAXcBW4GN4Ca
oDoPXufM00b9F4Q2cnpqo/aytu3hrfm/7WQp8W808Wx2JP40LfVGqaIdfOLxZ/Lnjc7Rf5+guiwk
eoD+q02dofb/hvZNpV77F7pN0e0G3W7SbZZuH9DtQ7rdUurJAuUi3W5btjt0W5K2uzZbZpkkg7R1
M6R9Qzpu5G/E7rhif25enmWfyGWUgMQ+kfPszvdxjMjH5H2feSRkOce6PM7xc5z4PdfjPOLzel55
Nvd1jtoVs5NA9XjeX8D2sr0/nzIElsfvvRUoSyiZXK7l2kYB5CQ+z/O8rwjqiKWewuvL2kRkOlDg
MwulAy71F1RPDG0euU6GbJfI2tqrnrh0yE894drX8T2x6nXS7X5y/MQx/TMJ4SGqr3APsVhP5H49
91Q9q1GmGOtx9xDv/ftb8bru13Nv1aN5eYgfg3u8X8+9J9MK1xOPh7hy9eR5iAp54w0FHqI+yD3E
q3R7T1meO7xFNzZviPlCwug2V2jOAVr3beYGid08oZ95v6jn/hRLPXZ5Afdd67FLO5zjaxwadB7K
7xydQ57veQ0/81CFzLMFlcejXpu2Du8h2j27EDLZyhWyvaKaZ1sxmVzqvSfmNFZqbiSsLtpvhXmI
Ueh31G1VyHx03M9OKWCePSZ5fNXlU+ZV19YB5cd2b3mI3veW7yEmnktQH7GOeYjaq/ScMbr9B93+
k27v0m1GyYkzE9NflGPNdyyb7D8ymj4jNiL7kE6b4UIDNuTlX/rwPYmTPxpkX7GJMQelKY/NMbvz
vPId/UM3X9EhL3Dc2+GYbb/nw9d1lCeILHby5B939g99+NSONh3Qrw4Vq3J6D/vt94L4h0H60iDv
4gD1Bro3l+v47ofjGrNI11gV/nPuPRQ+gxilPxbm2XlssfhjBdQZu38Y97jFpf4i+z3R3ZeDTcR6
fxHcY8gZxO8o55VEQsmuSbT+bUrzL2Ge017ULij1Cqvh78E3wbfB/wHfB9PgPPiBIPMuefojcEHi
Inhb4h0HLnnwrkMaJGY6I+U7pZ1onmd4nOeUj+NEzndKy/TKD1mOaVWoek16lXfKdzhOgpYLWL9D
+XPKd6mlvKLoiqLW1opj7G+yDmon+Dfg3EYSNyh/R/tWgo6qlAzd/0XtL1V6LPlz7dsKW3X7Lt3v
1S6oi7APg6a/oI0kMkp2xEXYevFPaO8RcyRlmaFnx1SDryP/ZMJQbGfnCcv/qf6VnNGOsXwetfQ6
/Uf6UEKR8pHm5Uf0GSIdN/d5+VeTaxQlpz1Er/LDnB7F2pM4tm+efjmlgz7XkPU6yhOVnF7nORwP
LFfI6/i9DxL3dQLme7ZP3O3k3j6e/QezqRw7VCSbu5h8VLUcs57HbfZC8gVbD0bIU6efT06qdvl0
U1n+t1NVtuUVlO9JPaYqufXmlD+Tei5wn1BgGxd6nm+dCXpeSF1ztKm4rl9seSIq5ylXgc8hKPN8
En/07hOoTbna5F+kfpzXJygWm/zzkrIE0kTKz/YL3yz5rLWvIXId3SXdCbksziemHCdLLufVj433
Xc+VksB9Q4HPxKm8b92J6fqB5SlUjrDyFPm6RZOnwPocn1e08nn3DdSmnGYMuE3+aWmz6pDP7fpE
6Tdcy/9J6T+pNnnZ8sfLUq7lv1bWQhT7mTJe/o/Lvha4TwjY1kWzdZ/1+5anSHKFfG/FJv+qa58i
Xcfn/Xj3CdSmrHaWZ5OdZaOuNn20XLHLy5bvKP912/IGyj9b/nXXPuGPyl93vf4fli8G7RMC60zM
OrXiOlyo31OkdotMnojaL7Q8MfUNPuXx7hOoTRHF3ua4b/7Vil8zbVI+j7D8Zyo65T6FWMv/QcWw
q5/xVMVd1z7lSOUjrn3CkcqvBu0T4n42gXWmSO+Pe1Yef3J56zrVFVlXc3TtK5WvuM6BPVn5YU45
Qyr/+2t2uupq+5rfdtRVm4ibovCYm1V3RaytB/c9BE6APwPlmNtNcAacRftLsTftlkQ59uYVg/Mb
izPTUuyNOMXm/DKqGB3SebG2kDG7vHy/aYmOsT+/lMvJdhWQxCnfq16/17U/L1is7QaPs51BnK2X
s1f7qwTVZTXN42sDZI7u3+JxtWH1tmL+kk6d/u/aW0wnrasbabpO79OreXzN/pdzqB+s7yNS3I3v
G3gn/q7+rbz4GjY+V/85/U3b+JpZfneI+JpDmxOnZ+H3eNC0x3mO8duVSoeVK+jxgPWRsNeJ6Xie
HsnnRX1dr+eVm+/tG1Cbstoasexzm/t08lFVtknoBWH5DckX5DyTCsv/JOJrNudw32BzqirH55B9
i1pLfE06j5d/qAjxtXifUeH+aIH1+J7vCtsOAc8rWJ6YzvPd90T8fHz3hf7q9+4THvKIrz3oEF8z
bbLaEl+TzzHreADxNZvzeB2VlviaVAcx6ygruey0UpT3XakQ8bWodCmaZxX9+YpPGwtZb2zyRC2n
R3nP5xXTdYve9+TSu2+gNpVnb9b3ve4RX1Pd42ua4RBfQ9+i3S1L2V07W/6OFF+T+hVtsYD4ms82
jc3WQ5aPXZdXqzxhn1eRr7/i7eNer2efwGzKzh6zNvmRFF+TbfJDm/iapU/R5h3ia2b52fKv2+Vl
y6fLX3frk7T3ixhfi+nZrbaYddF0OWrbKtLzKtpzC3gfPtvHu0943z2+pt20xNfy/fs67T3E13KP
L5d/1z2+pt1wj69p/20TXzMs5d8pIL4Wsw7FblNB5Sny9bzuM2Ib99b1dxBfk/Qoq2v/hfiajb5y
XXtbiq8pUvnr7vE17VrQ+NpLLxmGTXztIu57DHwLfAf8X9D8hm0OlOJoRP6GbVGiGQeT42ZynCzg
N2tO8a+8b9kKpeFxXM6XjpOgcaywcS9Zvx2YF8/yKhc03+l8h/M85YknHSy+NkvfQx/xGNvZBLWD
xC0eZ/uOSm2BbizWdpHZAbMJ9Q6Pt03y2NmSkvtLIezbtQzN/2V9ndOvgDD7TD6g/1Z2Ht5QcmJr
fFxt6C9m+x5zW77HOv1D/Sd28/jZ8jdX4bdrXuf5PE6KfD2/7xnHdiqw3oLliUquAusJLE/Mckvy
eM+V3fT4du0dl2/XWP40vl2T/QbTpn+WnFSlsla/QH/T8u2alM/L/wSxNZv6efnJAmJrQX3CiM7P
05liyeNPZ+LX2ajkKfS6AcuHtvWY5Cfhynv3CZOIrdmMBbhNjiO2Zm6yTf+ry7drZh0/9vh27Z8R
W7ORgZh1/KNHbO31CGNrBdpmYJ2OWsek+kLLE5N8IXU5Njl9t0+R5A38vMLJ5d03vC7F1uT39T+U
Nruu0x0t/YadvWb9hRGPb9eGpdia5Tq8/N/ZfLtmLf9aBLE1jzaPzLYi0rUi6U54eWK+XuS2FXN7
RiZPNO3q3Se8ZomtWTfTpl9FbM3mXc1t8m89vl37oXtsTX/FPbamv+zw7Zo5hvhBAbG1YuuuwzOO
XYdD6lrR5fJ4Hv/v5YnmeXn3CT9AbM3G5rlv/n3E1oz8dzXhv5nj8e3a9yqGXf2MISm2Jvspgx7f
rg1EGFuL+FmtuK076cwKv8djah9vXR+QYmuWjetav+XbNTtde8k9tqZf8Ph27YJnbM38O9pM7lb1
pyU31n5GSfEjW9W3y/r1Nyv/WtmuvlX2XX2qchC/HSlyJir7lFp9ouxlvvdL6nv0/+bfNsTfwCZb
yibJlvKnHP4e94u8Dc9kZahUPqdsIZ8tf76k9stPPfPFw0cOsXz8tXj8kmUt6aZ1djvWeVOq81e+
VFG798mnfu+J2tbarZ9qXK7P/Bs7JE3rSzvWN5lXX1ntbz5+5Eu1rbm1id9jr9U+Xzapfd6xtkUb
6R794hOPH5Gly/4tcf5bndpw2eSDLFY6XF4FPvag4nCNJZcW2LZ1q0Vm8aVinV4ratdrRe2UzrVP
ObaHVDeP0tbpJ1D3CdR9wqXu23l1l5uts836t9qF7j6f1WGmu1vVp0sfWNtGdfU59QzpIArPMTX5
BfUceVq9nc1VbSR4lSYaIUGlMkb1N6208W0LaVHPJB63vb7xfzqPqN4wVBzwZFsAAAikM7khKr4M
/1T+s5OJkeOSmE+jUxmwCKwe/r+lgUe/auEBAAAAAAAAAAAA0QEAAL4BAABcHFoAyG1WACJbAAAA
/nic7NpZjJRXeoDhU13dXQ00FLvRRJNiNRAlI4YdbsoRmDUXUQRmvRgrw2rwWKMEs1ffYTDg0UhJ
ALPlzuyQSwy4bG4isS+KIg1LsenMjaEOa0FX15/v/N9bW9NAj8exJ9GMgeecopfqf3nrnBpuLTXy
v8ipyCXTrSZoNEHBmJp3+D3MZLr2jS/2H2H+3fzSLJw6+R+GmYjM5sus7u/eX/Wrf/6nUaYd/6uR
3w3+G5386RcT3/jRe83m8PdfyvfqWHoWw2tm1/x3w+/j77TxXKKTf/3+R4uHveZrTjfzIj+N/P47
Pxf/TIrfPyaf32D61hysXRP7onaNH3VZFvuiyzLzk1+YX5ggkI+okf/619yo/Y96E3oar+I9fKrW
xbAPDsXxOB3n43Jcj5/hXjyG3+AVvItP1Pp6fAuH4DichvNwGa7DrbgHj+LXeBnv4GM1Voe9cTCO
xak4Fz/AtbgFd+MRTOMlvI2P1IZa7IVv4xicgnNwKa7BzbgLD+NXeBFv4UO1QxR74iAcjZNxNi7B
1fgp7sRDeAovYAad2rEGe+BAHIWTcBYuxlW4CT/Hg3gSz+NNzKqdItgdB+BIfBffw0W4EjfiDjyA
J/Ac3sAHaqPBbtgfR+BEnIkL8WP8BLfjfvwS0zqqtsJu2B9H4iSci0twDW7DfXgCL+FdrDKto+pH
Oprqbh1Ndf+830e//HRHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ
0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBH
Ax0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0N
dDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ
0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBH
Ax0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0N
dDTQ0UBHAx0NdDTQ0UBHAx0NdDTQ0UBHAx0NH+3oRTp68fN+H/2bT3Y0a751VD2OF/EOPsVa0zqq
dsY8HIETcTYuxtW4FffiMbyAt/EJ1pjWUbUT9sXhOAFnYTGuwi24B4/iebyFjzFtWkfVjtgHh+F4
nImLsBQ3YzkewXN4Ex9htWkdVTtgbxyK43DP4nW8j4HauSv2w+E4AWfgAlyBG3Ab7sPjeAav4bdY
ULvEsS/+XDL3Exqmvepf87suI8f6v/1d7Zqxvuj/aup9QCN+vMM0BLdl8rdh87aZvzYdTLR+8oIP
F6x435io/NfZ/L35mak1JjCma/1vGhf732ZITUv0enTEz0bJZ22X3//WuoHRzdpA8TRexXv4VNUG
in1wKI7H6Tgfl+N6/Az34jH8Bq/gXXyiagPFt3AIjsNpOA+X4TrcinvwKH6Nl/EOPla1gWJvHIxj
cSrOxQ9wLW7B3XgE03gJb+MjVRso9sK3cQxOwTm4FNfgZtyFh/ErvIi38KGqDRR74iAcjZNxNi7B
1fgp7sRDeAovYAadqg0Ue+BAHIWTcBYuxlW4CT/Hg3gSz+NNzKraQLE7DsCR+C6+h4twJW7EHXgA
T+A5vIEPVG2g2A374wiciDNxIX6Mn+B23I9f4lm8jvcxULWBYj8cjhNwBi7AFbgBt+E+PI5n8Bp+
iwVVGyj2xTYaGN2oDYxubEcD/+qwhG2YeVXZasdr2cTTeBXv4VNVyyb2waE4HqfjfFyO6/Ez3IvH
8Bu8gnfxiaplE9/CITgOp+E8XIbrcCvuwaP4NV7GO/hY1bKJvXEwjsWpOBc/wLW4BXfjEUzjJbyN
j1Qtm9gL38YxOAXn4FJcg5txFx7Gr/Ai3sKHqpZN7ImDcDROxtm4BFfjp7gTD+EpvIAZdKqWTeyB
A3EUTsJZuBhX4Sb8HA/iSTyPNzGratnE7jgAR+K7+B4uwpW4EXfgATyB5/AGPlC1bGI37I8jcCLO
xIX4MX6C23E/foln8Trex0DVson9cDhOwBm4AFfgBtyG+/A4nsFr+C0WVC2b2BfbKFvtGC1b7Zj2
lW24LNleWTZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxl
s5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TN
UjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL
2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxl
s5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TN
UjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNtlm2u5TtbnvKdkjK
9uo1W92/aNnE03gV7+FTVcsm9sGhOB6n43xcjuvxM9yLx/AbvIJ38YmqZRPfwiE4DqfhPFyG63Ar
7sGj+DVexjv4WNWyib1xMI7FqTgXP8C1uAV34xFM4yW8jY9ULZvYC9/GMTgF5+BSXIObcRcexq/w
It7Ch6qWTeyJg3A0TsbZuARX46e4Ew/hKbyAGXSqlk3sgQNxFE7CWbgYV+Em/BwP4kk8jzcxq2rZ
xO44AEfiu/geLsKVuBF34AE8gefwBj5QtWxiN+yPI3AizsSF+DF+gttxP36JZ/E63sdA1bKJ/XA4
TsAZuABX4AbchvvwOJ7Ba/gtFlQtm9gX2yhb3W+1bHW/bd+a7eevWbPVT9CyiafxKt7Dp6qWTeyD
Q3E8Tsf5uBzX42e4F4/hN3gF7+ITVcsmvoVDcBxOw3m4DNfhVtyDR/FrvIx38LGqZRN742Aci1Nx
Ln6Aa3EL7sYjmMZLeBsfqVo2sRe+jWNwCs7BpbgGN+MuPIxf4UW8hQ9VLZvYEwfhaJyMs3EJrsZP
cScewlN4ATPoVC2b2AMH4iichLNwMa7CTfg5HsSTeB5vYlbVsondcQCOxHfxPVyEK3Ej7sADeALP
4Q18oGrZxG7YH0fgRJyJC/Fj/AS34378Es/idbyPgaplE/vhcJyAM3ABrsANuA334XE8g9fwWyyo
WjaxL7ZRtvp3tGz177S3bK9es9U7yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5
yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYo
m6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6Ns
jrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5
yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYo
m6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6NsjrI5yuYom6Ns
rs2y3ads99tXtmGvWbPF9mjZxNN4Fe/hU1XLJvbBoTgep+N8XI7r8TPci8fwG7yCd/GJqmUT38Ih
OA6n4TxchutwK+7Bo/g1XsY7+FjVsom9cTCOxak4Fz/AtbgFd+MRTOMlvI2PVC2b2AvfxjE4Befg
UlyDm3EXHsav8CLewoeqlk3siYNwNE7G2bgEV+OnuBMP4Sm8gBl0qpZN7IEDcRROwlm4GFfhJvwc
D+JJPI83Matq2cTuOABH4rv4Hi7ClbgRd+ABPIHn8AY+ULVsYjfsjyNwIs7EhfgxfoLbcT9+iWfx
Ot7HQNWyif1wOE7AGbgAV+AG3Ib78DiewWv4LRZULZvYF9soW2ynli22s71lq1iz8dGRLqWP/i9j
oiP46IjpWPoXdZ3NR2ZI3X+aCX8xY8Hyj/oOmT607/sf/rLvpF/9+h+XfLio75BZy/9m+NCqf2+3
zXT3n1i/yPwGN9csjQ5ruBQ9YSI1D8xrfjU8NzXxIPfCdHwhP2chMNlm0yDDVEvQbDo2y2N5eSwf
DpMyLORNQ7N5EZimFtMxL38tw6wOEzLMt5gGGaaeB/JYixyaXGDSBdNVhtFCUJPxf5pM+EA0HgS5
QpEuLaYmGQR5U5MKCjpNBfJ9a2JBoNMgaGo2tUGQNqZLwdREg/wLU5sIMjqNBVmZyp9y/Ar+R2p6
bqJBzpjGgokkCzkTTRZ0ksrl/DfVSZCVSSxoMp1r5ckGaZnJn6ZRZtGg6Zl814zpFPVH5qk8v6yO
8zJOMM7JOM44I+Mo47SMI1nT0Y+bnhgZdpALKvbYRD4KR/UyGhaOamXU9XWn6FW/5EsYOczQKe+f
f3M4bmzxByRXniSCQCed5bjLYW7KF//Knw6dyFE0kUJ4sotTf7Jy5am/PPLlabwQXg7hF/LTlkAn
8YKpSwTpVCCXSGleMPJQeZ7Mm1iQqZjn/LmomMt5rJyn5DSnchXztL8cq+eJQsW8yT+/6nks0HnX
gqmXM+5PcKHqATl+pQf8P/StKT0QVyJBpnqeylbPk63miVz1PJ5vNS9Uz2NB9TxaPa+L+KdZNU8X
5xF/uGv97cA85eepbPVcjnNpnvbzQvU8EZTmSTk9tXIfleZyOuQGy5Tmcjpqo3LDMU/I6aiNyBPW
uVxz8g2jcr/q5eJvSTn+qULVNFmcxsJpojiNhtNYcRr+cP5ylOvcnwa5fgt6NcuPlQ/LobOEn8WL
s5ifRfwsJrdgUmz/3RXzV2T6xZ/Fdh42eT0xqbwcaf8iEm9mkPSD+hfyutHiXz5MpDiIFgex4iD+
0iDBQK6oTM7Emn3Pn6l5zKmpLGZamW6fydby+YmifP14Ub5vjOcRLRo8C5+wXKjyhF/oC4s3mVUT
+Zw/LnLVZ563caTCF+DmP+ZYlQ9a8lUHLfU9HbSXDl6m1cHLtjp4fN84zyNWaO9BK1QeNL8eKf6w
3+ugXS+9ks1hj0KSjyRT/hJ8bBoK/nDLq70Ock9Mh0L4ciuLAUaydOhYCLNn5HAVhwWGLfJinAuH
MRnKj+uXUOGj8gP7AOaD5+FSyz8m6x2/1JLHXoSrs4Q8ltM1W0QWapI+v6QLH83721Iek8J3fB6+
UvuFWn3OhDdqLnxEBs/Isx+E6W14Slp9PgMeCAf1T03xI+N+UP/M+C/RMccqQYepQul7xnSx4Icp
XXP4Z+cXGIXmcOiPQ6ZZL/QWfiT/GD9mpIUfPeEf08Mhj+kh8o/Jqk4ek5+sSY+gX53kyodY1nLl
U1A+LXqmsk/0HAbFc5gpnbqm0kfnnlZ+seJQLuoGXfzoYxHOIc+KcxjVcxieOn94dOhPclp/Un9M
cjr0jzaFi/CW0mo8Hq7GX+iXz+phTJSPaPjl9ZAn9ej7kxp76aTGC5Xn0A9iAX8VKX5M+BLsPz3a
wiAZDp6Hl5qezKReQOGWgctKtwz+UituGprCnUI+vCj9GYz7C1UGeT2nLeEjz/Wg5fXwFPR6LeRa
3w6VN4neOq8+mbkn5RuxeGdyo3LbtucOL6/Mq1fruoKvWNZXrvZf2gVU7g4qdw3sJqq2Ga12IJWb
k5e2LaUNTfVep9VGqPU2qdUm6uUtVsUG7KUN2ktbuIrtXXnLV94GVmwOyxvG8iayYmtZ3m5WbEGL
29LvsC/64X911NcOI/uJ4rDA8Lk/YqVhrjyUk9fBD3NBpDxqKo3SpVGmNMqaLpKIeJD2q245OuE0
6ZviN175cOo3SjF/H+lUtzVNfkHeRV5jI37TICc/qtOo7JDqkhn5iHAak9NWl/A7hnAalwV+Xbw8
lTNZF/NVb+oSrolkGs2/NE2G02Ta705aTf1NmK6aJtKdm3UJX1s9C76/WZdm3dvIZulNU312qfBH
KU2T4bRQ+lHCw1Ce5phyGPwhjJePij/AiXzxECb84U/6jbos+MIbV7amch6j4bxT3N+l/tzK1/Pz
mN9Qx2We0LnfTEm5MxF5vNG/zDcHtWk/kRtHhk0R+VKNL8L1d62vh+n8IqxonW9JJpzJC0lduKAP
Z/IKUZcNr4/O+tpSl/bPzXR+bjokfRSMP4V+JomQCyHiL66cf6H8bvuB2Hda5b683K3YEWR1cZsI
nlUvcnPt3Bl834vd9u4U2r3oZacQ//EXvZW/OsnrQiKnn/tDjtv79OTIRf17N/Ly4sdxP87rOBm+
p5P3d4qcTt44aXyh7/5E/JtUnZt56yfi36Lys6jOsjqL6SzX1iyuM8lAI/d/+Ec4yfm3JIqTbIv2
t5HEhG2umnQKrzN9T61y3Bheh74iko9GWid//MCTqmdQnLR+nm3/ZI10VC7/tg5N1SQfvk2mk3j4
Hlu+eKSb/LJIZzH/xlTpLMSilLM4k94FftZRq+kXyw2+maWlaz5cn4RpymtQdZekwxgrWxbgmXA/
5VeizabDc79E8++1vjqMP2qAcq8PUMSH01/89CeVoT+l7qT/BLpTPLblo106ATLw2yj2k2yPqs9Z
uKfIV5/d8hnXq8BfJ/rayj0f829lmkRx5l+W/Wtz2wUIr8QcF2l4zxOAeHj55t8YgMqb4c01ePX9
93+3AJWHo+pAVR3C0sGtPu4vnZPq89XqXJbP8xsjwKXT6oLiMitden9QDVpf2uFb7Y/faLjty4Tv
4z//8+RPfOLfEko+86H7vgc/+l73Dcv9GnmJfOqf8Pc9kKVbXdzvf3QZF+6qEoVwGVefCvdNxWVc
E8u4Rja8YXX8JOpL4kPjJzHfmHix2b4+sXzFJFpsdlisYpfSTF61NAvHTa3GqZb/rfi+vsThJFMx
ebm+7ViMVa6//P41XM6W11/JUoszFfUNd66xcov/yPVXtPQm9ndYff15T/r/fk/q/wlEVP8lRErP
YaR4MhNVZ/UP+L8g/aUalyu0oMOEXrVyF9QnCibVFJer1F/biaxMwi2knyUzJpU2qXRplkybBKsO
GcqvOCuSZJOfxZilZJYx0VzVjJ1NSr55xkT+h70vAZCiuN7vmZ7pmpma3eU0qOhulkOMqNxgoq5G
EIwaReX6aRJvERWQoFyJux4ol/FW5DAeaEQOD9Rg5FjjfXAlnkFhwTMisoDA7O7s9P+rqtezPd1z
7oXmDzB83/equ7q66tXxunp2E5QWq1OVTlUaVwWJKuJUJbXisVTAUmUxS7JoSomCO6R6NpZclotn
W1ppnfTYpLgt8X6BJSvlgykhRRlFkcQ6TZVYvvFQqZt10V5ptMCuTDNmjTao9rjyKBWtU4VS0bQh
nm0rgRpncowSAiXT5QJRCCaKKVpYTDviEVgp2p7tFR0ouv9n3CwHvAMvef24X/ISY5en1j6SMQUF
Cgpr5e5Xkeq1gnZT3VnQfuqtHg56fBWFi+AnVqlJXfCSKvX4RNZUWbWay9WaVYzslqgUjwBiJCLV
6klWnpzn5YwQIRWTD8UqSZlqAaDe1Sk01Ts45dZ7PliPqJeB8lQTioWLGD1l+0bE+gT+pt7ywcW8
coUn3t4RXVhcRKlSU77Uhtk/X77QVmblLaR86qaunCcPq6Ri5cksIsIjYkohe/mArkYLRzVDPuMW
6wchSk2xaKlUolDsmpgVSiB/8f5ajXjLzi/8Tyw1BBfeVxpTXDyJF/4aEh4c85hqP9dXaurCbQUt
MW8zKxQtMNeZtPcrOiRaRM5FMbNKbPfAP82YfDMEPSKiCHqKIiX00gg9m5FvRKAjiJlZFEegB33B
wConqmCiAnjMjycwObDBemCDNdO/NI/9rGex5XUPZyoT4oa0T/tscUhigKKWE+KNmLpQxvZg2fbQ
Of54vyRppGSPoRKf7iV91Ce3LCvk8JQ5pmuaR3r2eDUe05a649tCOxfvDseSRMoJMbQMteNCVBOj
uFs88JPHJsbq1maMWEjLhVqlprZpZOAvX+6J0gOBCk1MFzJm2Ie+2+ikHkutA+8/Hnj/0V55/4Pv
P9aFFfLd4FCVWNuUeypUr/SI9xQiijPB6TFdoXx/oYziLSnKZZ+OmXq5tdcq3kQTSg3GYi50q/jQ
HCkp91ixHVZDIsSOKxltUxRYGJXRtqUiQumksEyQcaldaZaqSFDllpJxsVJWMOuUZc0rzcRiWEF0
XZHrlCfh5hKVFWAXViaoiL36CqL2qkVgLh5yxLdhNVsjMNkkti2ZknLdUmi3knK5RUsOIONta7Km
54Ildc8FC+3PBWMJzwUdL0bKt07VQ8JC6yGhHn9IWJj+IaHcbin/4X8emy4Q2N931lwY/2bfw9rt
8ifgF7FnfFPYM/lXa0XeBb4p3gXun3fPJuSfr1UDLyccQtifsCdhMWFLQk2hsYNwE+EawhWEiwjn
EE4nnEh4BeFQwgGEvQg7ELYi9Cj0VxJuJlxLuJJwMeFcwhmEkwhHEg4jPJWwN2FHwtaEXoW+nYQV
hOsIVxEuIZxHOJNwMuGVhMMJBxL2IexE2IZQV6jvItxCuJ5wNeFSwvmEswinEI4iHEE4iLAvYWfC
toQ+hd7dhFslOn8++YL84Vo/eMNEicm/fzqKvlEqfhp5l0CXvF2+Hr26pf7ZIWxCeIPySMIhhP0J
exIWE7Yk1BQaOwg3Ea4hXEG4iHAO4XTCiYRXEA4lHEDYi7ADYStCj0J/JeFmwrWEKwkXE84lnEE4
iXAk4TDCUwl7E3YkbE3oVejbSVhBuI5wFeESwnmEMwknE15JOJxwIGEfwk6EbQh1hfouwi2E6wlX
Ey4lnE84i3AK4SjCEYSDCPsSdiZsS+hT6N1NuFWiyyPDa5VHSkzvkfDG8Ehfj55pvZGfqryRcAhh
f8KehMWELQk1hcYOwk2EawhXEC4inEM4nXAi4RWEQwkHEPYi7EDYitCj0F9JuJlwLeFKwsWEcwln
EE4iHEk4jPBUwt6EHQlbE3oV+nYSVhCuI1xFuIRwHuFMwsmEVxIOJxxI2IewE2EbQl2hvotwC+F6
wtWESwnnE84inEI4inAE4SDCvoSdCdsS+hR6dxNulejyRn6K8kaJGb0x9JmvR4+03hhcobyRcAhh
f8KehMWELQk1hcYOwk2EawhXEC4inEM4nXAi4RWEQwkHEPYi7EDYitCj0F9JuJlwLeFKwsWEcwln
EE4iHEk4jPBUwt6EHQlbE3oV+nYSVhCuI1xFuIRwHuFMwsmEVxIOJxxI2IewE2EbQl2hvotwC+F6
wtWESwnnE84inEI4inAE4SDCvoSdCdsS+hR6dxNulejyxuBLyhslZvTG4Lm+Ht3TemOgu/JGwiGE
/Ql7EhYTtiTUFBo7CDcRriFcQbiIcA7hdMKJhFcQDiUcQNiLsANhK0KPQn8l4WbCtYQrCRcTziWc
QTiJcCThMMJTCXsTdiRsTehV6NtJWEG4jnAV4RLCeYQzCScTXkk4nHAgYR/CToRtCHWF+i7CLYTr
CVcTLiWcTziLcArhKMIRhIMI+xJ2JmxL6FPo3U24VaLLGwPHKG+UmNEb2Vs+DI3pvNH4m/JGwiGE
/Ql7EhYTtiTUFBo7CDcRriFcQbiIcA7hdMKJhFcQDiUcQNiLsANhK0KPQn8l4WbCtYQrCRcTziWc
QTiJcCThMMJTCXsTdiRsTehV6NtJWEG4jnAV4RLCeYQzCScTXkk4nHAgYR/CToRtCHWF+i7CLYTr
CVcTLiWcTziLcArhKMIRhIMI+xJ2JmxL6FPo3U24VaLLG40FyhslZvRG40Rf9+PSeqO/vfJGwiGE
/Ql7EhYTtiTUFBo7CDcRriFcQbiIcA7hdMKJhFcQDiUcQNiLsANhK0KPQn8l4WbCtYQrCRcTziWc
QTiJcCThMMJTCXsTdiRsTehV6NtJWEG4jnAV4RLCeYQzCScTXkk4nHAgYR/CToRtCHWF+i7CLYTr
CVcTLiWcTziLcArhKMIRhIMI+xJ2JmxL6FPo3U24VaLLG/0HK2+UmNEbfct83ft1c/9sJ9sZH0JM
iEfiY3HWe0HNN+Kyi8a5nxs9jL+HwJdViVrgbxGbjf7/nu8OrYPvHXw24/MNPtvx2YnPD/jswWev
1kGPAKvwqbZ9avCJOj61ST6xOtRjpO0f08FNh910f/Rkdi35sa40G9ed52g5InHdmZbs+CxsutPm
5Fmm6fU8L2VeGY7Jxq5ne2yG4/Qsr5cpLcl9PYx+JfpJTvlkvL8c6yvp/WVZhpzLk+29NbAs9SpT
mmulraMcyqlneVzG+2qEPJokn4bnF+8TjeYDDWyzevlAmvwblE8T1Hmj+2Q966XR6jpTPk3lQ9nk
U7/6TTlP/Oh9Mt39JKwTy/0nedQK0fu8XCE2V4scyOcnlc+PsUxNmE/6FeJP//72e14H8vlp5ePL
tEL8H7jHA/n89Mq0n/NpmhXi/svHtULU9Pfe02iF6F8iV4ib8Nmm1T073IuPeG5Izwt1gemeFVrP
AO08ybNBPdlzwmye+zX2sz/Nlk+ytBx52nyS6RTHZBWH5vocKttndCnSsn6ukc1zqIY8Z8u1PBny
TVLX9V8hJmu7epQpabnqWV+N9Zxtv5UpTb4/iWca++vZSH19MfmnYSvExvDvxq6rhjyPbuq20xrw
nL2JypNVXlmW+UdX1zmWnz4/rRVi5ntzrxA90zxYIxaLFaJvOY4px+c/+HyBz7f47NAS9pl1a73o
3GuusX2c60eB1pqRPrpzDZnqY6ZBk/pQpvVlFmtPPdV6NBeuJdljzhWt8iSxJTsuU3rK9WG6tWKK
tJz3vVPYko57Wax1U5Ynl7IkK4/bnnp9mMWaOmWfznFdXa+9qlTzcLbjXi7rw1zG0lzm4hzyzene
0lwn63G4qWIWxzV+FOvnxHto+BPExlyP1aftMnyaZD3WgDybfH3Y1HFLmvybed3TePeVok806f01
wj3W8wniI9oCzePR4u8k2n83pfWbMB/23eNbqHXQRA4vE35E+Dnhfwm/J6wk3E34g0KxupR6H2HE
gVWE1Q6sSYHRDFibQhPqlo450lPpVGgdZ2Y4LlU62XVneirtxEzp9TxPeFW98rUw0/mp0lPY9VzP
yzH/FOc/rD2GnvK85tc0b1GRsonfybrEd4v8DrjsI55vgH/w3e9BVKXFwA/3PeiFzfjM91dNvHX7
Lfg830JvFfUPE/p830pPTItHXLp4X/wQ3zbdiqRsT+iFzWvK98i7ekwt6dN5XaR/7L8mIdox645D
Ty/2v+Vf6tEc6aTl+Sv9O3SH3eLy/OVGvqYl1IcaVV5IGFHsI0nK+nX5Vyqda7vWM9+U5WmscmY6
LoU953LV8zrZ3ofe1NfJMT1j/TR1PaWvn4zjh+hTCf1Qc/S5Z4yzvDab/TjZZxcadyZdwajyFPsX
GBu8ydLx8Yr0v7JWSc/X6Py57Fyvlphvwvmz2bScx4QG1nFDj8vaZ3I9rp6+lrJPNdX1m7s8jXRe
xnI1sB1yRdeaJDvMPCagT6Xtk/ext11jgmbrk3cFQh7SuiM9Pi7cETjdPtbozjxmBWZ5nOfS8bpV
jumBNa786SPHrmlBPeexoYFtkur8rH2nia6fc3kaWo76lqeZr9ts5Wlgfinbq3HLl3lsQJ9K9cRA
9slbg/29KdJlv74lODXt+TcG3/AmSYufXxZiac+/ITRI15I/KZPn/zl0Q85jQo513Wx9Pcv8sy5P
M5WrnvNWk5X/R1c/zXSdLO8n85iAPmXvZ64+OSW0Om2fnsS1ZGnx8yfyk5Oeb9L5E/hNaceE6/ir
aa8/nlflOibk7DNN7FP73Ycbuu5ppnprtPI0Uv3VuzxNNDZkWZ7MYwL6lK4l73Nybf7H8C+tPuk8
Thfp48JTnGOKbj//2vCKtOuMMeHatGPK6LwT044Jo/P+mOuY0NRtk7PPNNP88ZMtT3blyuzr8BWn
ryb42jV5z6d9BnZ13p6E80zH+Vfl90nrq6PyL0jpq0l23DRN7rnZfVfttc2l+15KuI7wU0Lnntt2
wh2EO6n+HXtvvr0OdO69ZdqDy3YvztKOvTc91d5ctthYe3SkXXtt9dyzc6Vnqx2Ycu8vW3Se5+xX
OaKeKj1TvtleN/lxue21fSP32WbTPts8ifN8j3rgy95Kub+2WN8Fvlfuq63wVmvWT9Ip9n/i2yh8
0v52I3Sxf76/jdxfS/6Tc7AO9g/RHftukps0J17ov9+1v0Yf+az+bP9HSffXrPMH1GN/LUWd66na
Ilt7rjrDcSn3b/eXrm+5crXnmJ9e3+s0kd3lR87jGvu6mdorMT3z2gB9yt7XdBuXfe544yyvs0+S
X+givadxpzPNQk2kd6X9tSTHyLVBZ9YqYc3hXFsU2fbXHMfJ89s3w/5a07ZRw9ejDcwn6+dd9a2H
HI9rcHma6Lisx55Gbp+sx8Ls8s88JrTPsL/WLsX+mtUn29j215zHWHm0oP21JMfJPPJs+2uOPHQr
j1BgTao3ReXYxeqxv9ZYvtQ4bdX4x2tZ9rF65ttk5WnscmY4P2N7NdF1m33sScTMYwP6lKu/2ed7
f4b9NW/6/TWfmWJ/jcYWX22IJbt2/Pwax/6aY1zxVTVgfy3LOm2yvl7P85vcl3+s5alvezXz9fd7
/aTPN+OYIPpUsv4Y75P7HPtrzj65J8n+mm1M8e1Osb9mnb+T35QsLX5+JX813Zjk+74Z99eaqO1+
bHvWzebLjd23mqm9mq3dcryPLOsn85jwffr9Nd922/6ae31f7NtG+2uJ9rrzv02/v+b7Jv3+mu/r
JPtrpu38rxqwv9bEPtTkfSrX8jTz9TLdZyP38cy+/hXtrzn8KO5rX9L+WhJ/lb72uWN/TXOcvzX9
/ppvS677a089ZZpJ9teeofsuJ9xI+BXhd4TWd9h2ETr20XTnd9iqHGjtgzn3zZz7ZDl+Zy3V/pfr
u2wNRTOD3ZnusOu57mPVd9/L6d8p0LWflem8XNNTHZ/iuIzlaRqd2/7aTsxD++Qe2xwP+oFnr9xn
e8SLvoCP2Gt7RvQD0Se8NXK/bYPcO4tqiT8pRHx3LYb0I/0tU/0UENE/jRb+c+LP4U0tYW9NxtWm
/5742GN96u6x2L/H/36y5/jx87f/CL+7lum4LO16M18v23kmZT01MN8Gl6exytXAfHIuTxOX21Ge
zM/Ktmf47tpXab67JtIr6LtrznWD1ac/NTZ4Hefa1wX+j2zfXXOky/Pfp721JPnL8zc0YG8t1zVh
Ix3v8pnmKk92PtP0PttY5WnodXM8v959vYnKr9fv/MxjwgbaW0sSC8g+uZb21qyPs0+/m+a7a1Ye
b2f47tqbtLeWpAy6lcfrGfbWXm3EvbUG9s2cfbqxfcyRX73L00Tlq6cvN1k5s66fZipvzu1Vv3Jl
HhtedeytOefrV4L9076nuzo4NVl/ja8XVmb47toKx96a7Try/H8k+e6a/fyXGmFvLUOdN1rfaiRf
aybfqX95mvh6jd63mrg+G608jVOvmceEl2x7a/aP1aeX095akrla9skXM3x37YX0e2v+59PvrfmX
pfjumhVDPNeAvbXm9t0UbdzkPlxPX2v2cmVoj//vy9M47ZV5THiO9taS9Hm5Nn+W9tZM91yty5+Z
k+G7a0+HV6RdZyx17K051ylLMnx3bXEj7q01clvt976eymf28zzeRPWT2dcXO/bWbB/pa4ts311L
5mtPpd9b8y/M8N21hRn31qzfoy3KPdz7ceCbgpM0Ji3dvJ+HFvk/yntc6+HdGHrMvzlvCf3sSJWy
Lm++VuRfF1om2c+92/C/9bsN6Xdg611CG/QufEyK38d9j6zD2fEy5Glna1300/ntgaLLx4y75MrR
V4h0+m3x9JMsi/RZyHNWyjy3O/L8xaXhooFXj7n4sqLhRd2O6V2Xn/U7dvRK5FeZMr8NrvxCRWdc
NPrSouGJuamfx17kOy+0wXdeytyqkpTurEsuu2i0s3Tx3yUuf1anb0VoQzuxV7qCtyI8t52W4hrR
NDXQvVs3W5nVNxWL/UUqd3+Ryh2YOvfNKevDkbfcpS3230J530J535Im72pX3tyqne7239WufPf2
uA8L3+2mVbQoKhip9Qi28wQKIsELke+l2uWnDTynm7iIdgGUPnDcRWNHdu+hpfrj6aD93GN6uoKi
+6DmYVp52JP9U55g/VG71LIk8esXBS/1Lspf7l0kWGBW/vLALK04+EjgvH6aQO+ifqnq4WSqhxZG
RWC4+Ghdgq968/Qex9TVcHFoq8optDWLnLpwH87vbvOw4nAHdX64QzbnhwfI823Xz7tEnZ93STbn
503F+XYPL85foM7PX5DN+flvyPPrrk/He/Ljx3+IRjuEjrfPvnnaWJS/v7milfRT8VFO1eX0I7WE
FputtRIn+HppdxLOCmmeO/N7edtrHu8OLf2/QJXmLTAj1VoIfsxiplZZowVAS2vNGi1UA1sUtqik
JaCxqBao0apNraxWC6HTMtBKRQtBo7VaALS0yoStFgWNmFp5TGsBqsdMb4X4X6uQBr3ANCMxC/Jr
NW+JaUY1b6kZU7LUxHW9zDSVNM2yGs2HoVrT8mOaVzej1Zqv0KxQkpmVkPgfVRcTt1RWpelmRNPC
Mc1TEotoeklMidJIRFxUCbMSgpllWh5mH49ZDoX/tTCUbpbtw1UrNK6LmtmL8lUqHgUvJB4BLyBe
Aa4TLwf3VGohwcv2aKBBdE72g+YZK5kB1k0yH1iLdE2EQzVPrQRdAVNQoKAQVY17K8LNlijaLSIa
UNJ+oGgLDnp8FdZ4xE8E14mXgBeAy5oqq9Y8hZaogCixBOrXUxojAYfxmGjsPCGiNbhXM0IqViMa
p5IUvAhtU1ErG6nQLIuKtilXEiQqjfJY0YRRXAI+kCfbNwJlwt/EofJi4n8k1gpzrbyIUqUoorhI
VPoJ8rPyFhLEunKePKySipUns4gIj4gpheyFS+B2wlHNgNtBRJQohb/gVCWQmVZgViiB/LVCs7xG
41HNL/yvxKyWXHhfaUxxZKoJfw0JD455ZH8DLTV14baClpi3mRWKFpjrzPJq1fnQW9Ai6HGi41Rp
wRrhn2asSvRR9IiIIugpipSYFYqgVIow0RFYtWjtiEQP+oKBGT2qYKICeExAuMI+VGWjk4yDkONf
Xa9I7Cmq99i6lL2nuXqgvWfaeyz15IQu7uj99oHBNWTEB5PEccYxCDmHKMcA5h7ebIOfa3B0DZ+2
obVuuK0bgm0Dc91gXTeA24b1uqHeNvxbU0Ku7bZf/qG0WmlUuJu4gxoiJRYplQQ37KkmoluEuUiB
RQqJYNyAH7AaMSbuk1gSI4wkYmklYUUKLM8NSyysSMRCC+l6BRZSOVhUoU7l1FHugByfy1T/F14u
sKRSYSEGAjViiKFDOIlVCY1Ksm9Q2zxXqtrQYzVmYUKrGtVadebGlW0qPL6gBs6vKPLRMCWFazCW
x7TSsgIx59RoDENEaZlHzkdQJRVaaTn+xVUJRvoKUuVCFVSSKhOKkSqFQk+NJKgoKVy8QvMkKFEq
S1U6VWlcFSSqiFNh7s9H57UUJkGSLJpSouAOqcdSy3KMdLhqnfTYpLgtDJemJSuFq0kpyiiKZFaI
1YdUyNWs1Elh5kYPLrAr06Ra0KFK4sqjVLROFUoVrsYMXaGJwVIJ1DgG1kolUDLdFEsQIZgopmhh
Xo1pGZUv1htsr+hA0WzHG3QmMT9XiVm73INlh8wLA7snojgTHAOtvLrg4oKyXFKUy6vHTB1c+ZPm
UUp5kBjl3Spi1U+kpNxj1QHmeeGKcSW9kmqrMCq90lIRoXRSmABl+9mVZto9Pa7KLSX9Rymr0Z2y
rHmlmVgMy9nqilynPAk3l6gsRyysTFARe/UVRO1VCwcWg0HUahLN1ghMNonVXFjglZTrlkK7lZQX
iIYlB5B+KeZeTGFauaJili6jAS8K7xS2glo1c1eLsdHUIop6alVsJqZAzN1Y8YrZsDCG+TyIZQm8
HstXFhGzV6bZnIslIpYTIj/BCwSPKl4iuCndGfOTWBwpd/aYUqgB0ktKOTTWPlIpF8YqR6pIMlWg
VFSOx55C1LD8Twoc4mGWQF4enUQJLiODmQTB5cQZVRGPjYflxCrCCXiIFGUi0mhukVACSzjLmfzO
pJAVYCarmgSBmvQUkBCjqoc8UyxWxWI27qcVWrwV4KcoQgG1F5QYu4US06VHTZdwyJq4k5bWOWmJ
3UmjirJEJ61QnllieSaLe2ZJRs9Ui5NolSyKWP9WqoCopBanipWuB0VBMCYXvaARReVaV1GsFjQ0
hFw0V8vCCKpXq85TK9cIouBYhgcwXEfE3BGL0qo8JqNH3GGBXLNj8a2rCYSW9NJKAa2MT8VKypJi
ha9bUhcRqtdDobGIzIQfRFREzUzR0UgUxKpVOwpRGBXd0RIi8GYUhReKkFyP2eJz3R65e0iUIhRU
fucSCF6Ue6YVphTopeJpgRlRA0Jz8oRC5FDw1HeeUEEJVZdQqYnVLRsilqSJ4o2X2K6ORk/iEnaH
SXSnZN5mc0aHq9qc2OHalsPbukFi57B1GepIdZ3L1uGsTrjf473kY4QXpd8rVvyNTcRyrkAs2tRc
6C8UUTYt7bDkFI8QaC4so7lQDLseOeyqEMMj1v5y9hKCiaG6IEKjsxjRWdQmdGsalAO/NaKXk0g1
v0le5uCltU01h6Wf0KSosAn3JJbFjGafxMTzSLkmqJvErCmNiS5iWxsLh66b0ho4idFKCzNXA6ew
Aw8rDjysOPCw4sDDimZ/WHFgJj4wEx+YiQ/MxAdm4gMz8YGZuLlnYrZHDbAHsGmx+d9ccL7VN0sr
yi/3LsovD4AFL/AuCl4g35u7IHCo1k8rzp8mMf3bYvI90oJ+bJPe/Zg+dW+cBS9gY7X24o0zhcEL
jDdUnhIzvIFW0M+Yjvx62PMzDlX5KQxe4L9W5ScxY37+Xnq3Y/rZ8/O9ofJTCN1e5ScxY376ZuTX
y56ffq3KTyFq802Vn8SM+XlnJHvjzna8eONubLzOx2pHfXD1QeJN04uuLhp/2TVjLxt30fjrxl2m
3rNztrL1/u3g/Nnel/OXezdqg3mB72l+rG+dNji0zt8rtMN/HtiT/qmht/yPg93uXx1a4t8MNsG/
PfSAkQd2mdEqNNXoATbM6B6aYAwG+41xemiUcRVYiXFx6A/GTWC9jetDQ4z7wY42poXONJ4E62TM
Dg0wloMVGk/g2DfADjaWhY4z/g3W2igP9TQqwPKNd0PHGNvAgsYHoSONPWA+Y1OooxED04yvQ0WM
aYODUaMy1J61AIsY+0Lt2M/A9hixUFt2ONhO5g+1ZJ3AdrBwqIB1BfuOtQqFGUof/C9rFwqyfmBf
s8NCjJ0A9gXrEPKxU8C2sCNCHjYQbDPrGjTZGWCfsW7BWnY22EbWO1jDhoB9wo4LVrERYB+xE4L7
2O/APmAnB/ewi8D+zQYEd7PLwP7FBgV3sZFg69kZwUp2Ndg6dhZKNgZsDTsnuJ2NA3uPDUUZrwd7
hw0Pfssmgr3Nzkdpp4C9xX4f/IbdAPYGuyj4FbsR7HV2SfBLdjPYa+xy3MGtYK+yK4Ofs+lgr7Cr
cC8zJRsN9hew1WwM7uoOsFVsXHATuxtsJRuP+7sXbAW7Pvgpu1+yiWCzwf7BJgf/w+ZI9ieweWDL
2Q3Bj9lDkpWBPQz2d3Yj6uERsBfZzcEP2WNgL7CpqBF4U/B5dmvwffaEZNPA4BHBZWwGaukpsOfY
LNTSYrBn2e3BDWyJZHeAPQ32DLsTNfcM2NPsLtTcs5LdA7YMbCm7N7iWPQ+2hN2P2nxRsgfA/g62
mM1GvS6X7EGwl8AWsbnBd9nLYE+xeajrFZLNB1sJtpA9hFpfJdnDYOVgT7JHUP+vSPYo2D/B/sYe
C77JXgV7gi1Am7wm2eNgr0v2BBh8PPg4exLt9BbYArDXiC0Ee1uyp8DeAXuMLULbvSvZYrD3JFsK
thbsUbB/SvYIexrtuU6yZ8DWS/Ys2Aawh9lzwXL2L8mWgaFvBf/Knke7v6+NkPwF8A/AHmIvwgc+
lOzvYB+BzWfL4Q0fS/YS2CfynHnsH/CH/0g+l70cfJltlGwF2KeSrQT7TLJVYJvA5oD9g9hqsM3y
7DmsHBy9PPggeyX4EtsirbPZP+FHWyV7FexzyV4D+0KmP8Beh3d9Kfn97A3411fE3wT/WrK3wL6R
1vvY2/C7/0r2Dti3YPeCPU/sXbBtOHKEVO9BfQd2D1sDf9wurfewteDfg90N9hyxdWA7JFsPVimP
vJttAN8JdhfYs2Aq37vYv6B2SfZvsN3Seid7H778A/EPwDG2Be8Ae5rYh2B7Zfod7CPwfZTfX6CW
Qgn2MVhEWm9nn8DTq4j/B7ya+EbwGuKfgkfBZoEtBlM5zoRaJO0z2WdgtWTdBB4jvhncpONnsIrg
UwGN+BZwD/Gt4F55lNDToRdKLfjn4Lrk09gXwScDPjpqGvsSyh9XX0EZkt/Gvg7+LcAo5Tb2DVRA
8lvBn5B8BOn/Qgfj6luokORTwR8HF2wbGKdjprLvoMJgt4AtABsh+XbwvHi+t7DvofNJC8vNsDwG
i2A7wApsKZXQYg66CexRsBGS7wRvGT/qJrYLupVN74ZuDXYj2CNgI2xXu5H9AFsbm94D3ZZUGdTD
Ugm+F/yg+JGlbF/wr4Gf2XQEup1NV0EfnHC1G2B7iGxCVUMdYkv/M6sJzsca0G6JwtI+wVILy2E2
y59YLDgvcHiCxYSlMK6nQM+Na7IFNNiKHDYPbD+3WSYHvME5geKEoyYHdNg6kJoE9aBN+aA6Jhw/
KeCHrZPNZk+diNTZgU6SGWCdXekM1iNc1gCsXRJsEwLB4AOBIx1HTgiEYP1FXF8PfT9poTjUUUnL
NsJ2ThhHdbVZroPlPmkRPA/8aNdZ1wXyYT9G8vHg90pelz4+UADbsa7zxgdawN4tZWn+iPR74ulC
t4TunuTIcYFWwbsDPZKmtEZKzyT2NrD3SnpGW6T0JnUt1F2k6o65NnAQrH1c546F/U6XvS71Z0jt
mzSlHVL6pTjrYKQdBzYG7A4w9zFjAocg5ZcprjsmcChSf5UirT3Sjpd8NPhfJM/0d3DwGhx7O513
TeAw8BNSHnk4Uk9MmVqI1JIUqVcHioKzAie5UuriD/WNPVv8kd/a93R+TxF/5D3k75W3SsQfecP8
U/MmiPgjr4N/dd4pIv4IR/3b89qL+CO80WgVrhHxR7jc6B6uEPFHeKFxevhtEX+E7zMuDr8g4o/w
zcb14cdE/BEeb0wL3yvij/BlxuzwVBF/hEcYT4QnifgjfKaxLHyNiD/CvzbKwxeL+CN8nPEujkD8
Ee5mfBA+W8Qf4SOMTeGBIv4IFxlfh08S8Ue4nVEZ7ifij3BLY1+4u4g/wtyIhY8S8UfYz/zhTiL+
4CYLhwtF/MGrWavwISL+4HtYu3BbEX/wSnZYuIWIP/g21iHMRfzBv2ZHhJmIP/jnrGtYF/EH38y6
ISfEHxzxB5fxB/+IHcf3ifiD/5udwHeL+IOvZycjT8QffA0bwLeL+IO/wwbxb0X8wd9gZ/CvRPzB
X2Nn8S9E/MFfYefwLSL+4KvYUL5JxB/8ZTYc10H8wV9i5/NPRPzBX2S/5x+K+IM/zy7i74v4gz/H
LuH/EvEHf5pdzteJ+IMvYVfi2og/+CJ2FX9XxB98IRvN3xbxB/8bG8PfFPEHf5yN46+L+IM/xsbz
V0X8wR9h16M8aDf+MJvIy0X8wR9ik1EyxB98HvsTXyHiDz6X3YAyIv7gD7IylBHxB5/NbuTLRfzB
72c3o7SIP/i9bCpKC2/i97Bb+TIRf/C72DT+rIg/+J1sBn9GxB/8DjYLd4D4g9/ObscdIP7gs9gd
fLGIP/hMdifuBfEHn87uwr0g/uDT2D38SRF/8NvYvbgrxB/8VnY/f0LEH/wW9gBfIOIPfjObjfuD
1/Gb2IP8UYb4g9/I5uJOEX/wMjYPd4r4g9/A5uNOV0r2EBjiD/5n9jCfL+IP/if2CO4e8Qefwh7F
3SP+4JPZY3yOiD/4JLYA9YD4g09kj6MeEH/wCewJ/oCIP/j17EnUCKIOfh3YfZKNZwtRN29L9hQY
4g8+ji3id4v4A2wxGPoqv5YtRX0h6uBjwe6UbAx7GvWFXstHs2f4X0T8AfYsGOIPfg17DnWI+INf
zZahDtG3+FXsedShjD/4KPYCnyHiD34lexH1+aFkfwdD/MGvYMtRnx9L9hLYJ2CXg90q2WXsH3yq
ikP4pexl1PJGyVaAIQ7hl7CVqG/EIfxitgr1vUkeeRFbjRrHOMIvBCsjVg5WIdkrYFvA/gBWKtnv
2T/RClslexUM8Qj/HXsN7SHjEX4Bex0t8iXY+WBTiL0BJuMS/n/sTbQO4hI+gr2F1pFxCfjb4IhL
+HD2DloK0QgfBjaB2LtgGHX4ULDrZYQymA9h76HVvpNsDZiMT/h5bC3a7XvJz2Xr+B9FXAK2HqwS
7BywccQ2gO2URw4Gv1bEKvxssLHE/gW2S7J/g+0GOwtsDLH3wX4A+y3YaGIfgO2ROZ7JPkR7y3iF
n8E+QotTvMJPh7pKxCtgH4NFyPoJeBXYb8BGSXYa+w/aX8Yt4BvBZdzCB7FP+UgZrQzmA8GvsCIX
qM+gasFOBbuc2CYwjM98ANhlxDaDUfzC+7MKfqmKX/gpbAu/RMUv4FvBZbzCfw1+cV0sw09mn/OL
VPwC/gW4D+wksAtlJCP4l+B+yUvA/wAu2FdgBtiJYL8n9jUYxTVQ30AFwE4A+x1FNYP58VAXqHgH
/L/gFN/wX7Fv+fkyvlFqGxSX/Jfg/wcu2HdgMqrhx4GPELEO2HaweHzD+7Hv+XCKbwbzvlDDbGoH
VAGpPlBDoQSrBJPRDe8NPkTEPGA7weJxDvQu6FZgvcDOo4hHqN1QiHd4T7BzE+Md3oP9wM+pi3eg
90BTvMO7Qw1W8Q74XvCDJO8Gfnac7wOPxz3QEeh2YMeCnUURkFBVUAeDHQP224RISKQfDeuZMv1o
Vg12CNm7Qp0hleA14LZ4CJYoLO3BjgI7PR4ZDea/YLX8N/a4CJYYLIfH9ZHQp0ELZoIVJpRIHNEF
9kHSDh7QwIso5QiogTblgbLFSbB4YSkG6wx2qi1iGsw7BXQ+gCKkOpsPto5x3RG6v9SC+8E7UUoH
qFOSRE8ixUBKZ8mLwX9ti52EhcFyBNjPwU5OiKCELQBbF5ulCJaTYBEsCOaIo2ANwRqPo3ghdIkV
R0FxqKNIHQ51YsqoajA/LBDmJ9jiKWVtH8jjx7vjKNjzYT/GZjkUll+RRagCqGPjqYdA/zJBt4BO
Fk8N5gcj7biENGFrCZsznhrM28HeD3bBWoH1cKT/DNa+0ip4a3BXfAV7G9h72SwHwdInbhG6LXTv
uG4L3Tsh0hK2g2BLFk8N5m2Q1ssdg/HWsPeEXbCfgSWJt5DSDin9EmytYOsRtwl9MPRxtiNawtLd
YTkElhRxF1IPReqvJG8B3s0Vgwl7e9iTxVyDeQHSjk2SNpjnI+UYShHqMKgU8RdSD0fqiTZLHixH
J0RkwlYIWwmpMFRXV1Qm7EWwp4nHytrJ3+rANB/+FiMqezs/X+uwS3x2aR3yd2nFeZv1+S7bQN9p
Tlt4m2+xy7bQ94PLdp3/KJftN/7hLltnf6nLxvx/ddr4d/6XXbb3/R+4bKv821y2RX7TZXvQaOmy
TTeKXbYpRg+X7RqjxGW70DjTZTvPGOGynWZc6rKVGGNctt7GJJetq3Gzy9bBmOWyHWrc57K1Nua5
bGFjgcvmN1ztG4oZy1y2fcZLLttOY7XLts143WX70njXZaswNrhsG40PXbYPjY0u2wZji8v2nvGV
y/aW8a3L9qqxw2Vbbex22V42Ii7b340al22Z4fK10NNMd9kWMeayPclCLtsCHOa0PcJcvht6iLV1
2eaydi7bbHaoy3YfO9xlu5v93GW7g3V02W5nR7hs09kvXLbbWFeX7RZ2rMt2E3P1t1Ap6+Wy/Zn1
ddmmsONctonseJftenaCyzaeneSyjWOnuGxjWX+XbTQb6LJdxVxjZ+hKdrrLdgVzjRuhy9lvXbZL
2WCX7WJ2rst2ITvPZfs9G+qy/Y65xuLQ+ez/XLYR7HyXbRj7ncs2lP3BZTuPXeiyncsudtkGM9eY
GDqbXe6y/ZZd4bKdyUa6bKezUS7bb9hVLttp7BqXbSAb7bINYGNdtv7sWpftFDbOZfs1G++yncSu
c9lK2ASX7cQktuOZa14I/YpNTmL7k8t2HPuzy9aP3eCy9WWuOTnUm5Ulsd3ksvVMYuvBXPNWqDub
6rJ1Y7e6bMey21y2Y9g0l+1oNt1l68pmuGxHsZku2y+Yaw4NHcn+4rJ1SWI7gt3hsnVmd7psndhd
LltHdrfL1oH9P+bOO0qqKtvDpK5d1bvISfCAUIiKAQNjTjBGzDI66jioYxjDKI6Oo8+AgCISRBCQ
nDOSc84giCAISJKgAgoICkoGYU7tvVet92qfWufersI3f/3W91v7nHvppqtv+JSOqktAJ0enfsfn
V4fOqqsGXVR3BnRVXVXoproq0F11xtn1UF1lUNcbtlPXmPmVoLejU9d/+RWdXV/VVYB+qisP/VVX
DgaoriykXw/VUDNlYJB3pjQMVl0pGKK6kjBUdSVgmKP7RHXFHV0chnvPDUFf3+XDSEc3SnUxZzda
dVEYozqAsd5zi6iZRH4ejHN0+nq0GExQXVFnN1F1RWCS6gqrTp9vIZjs6Kakd7GTju4EqOtn201T
3W+Qft+jziN2HGZ4Z46pmUTsKMx0dLNUd8TRHQZ1rW+7Od7zOARzHd081R1Und7rAMz3zuyHBar7
1dmp+xTbfaq6XxzdPljkPY99sFh1e1Wn1/0M6ffqeuYnWOLo1D1WbI+zW6q63c5umep+VJ0+t12O
dbvgC0e3XHU7Hd0OWOE95g5Q95KxH5zdSu9e38Mq1W1XXfo6vc82WO2d2QrpzzNcM+qeOPads1ur
um+d3TrvMb+B9arbojr/12ALbFDdZmeXfo+v99oEG70zG2FTgJnNqvva2W1R3QbV+b8G6x37rIdv
VLfO2aU/59D7r4XvvDNr1Eyy2xpg3TbVfeXstnv3Wh1gZpWaSXbpz3Vc635Q3UrV6XVfwo4AMzu9
MyvUTLJTz55iy1Xn+/ujj/UFpD/vdM3s9s4sUzPJbo/qlqpO77UUfvLOfA7pz930zBI1k+z2hv4a
feZdk4gthn2h910Mv6huker0uk8h/fmiayb9mbr/fBbCgQKsOai6BarT6+Z7Z1xrDnln5qmZZKee
vcbmqk7vNReOhD7HOXDUOzNbzSS79GfB/mPNhuOqm6U6vW6md8a15jfvzAw1k+xOhD7WDFDPwGPT
VafXTY8WUt001fmPPy1a2DszNcDMlEAzRbL+DJ8cTX8/oGcmqZlkVyz0sSZF87wzEwPMTIhGQh97
QjT9nYd/zfjQa1x7RFU3TnX+fcZGYwVYk/5Ox79mjFqT7FB1o1Xn33t0NB56zSi1JtkV964b6Z0J
/70cGVXvw2IjVOffZ0S0ZOg1w9WaZFfKu+6TQDPp7/TCf22GRctkvcfQaNkcf8/0MYZ4j5GcKae6
warzH2twNP29aPjzHRStEHrNQLUm2VXM+ddyYFS9440NUJ1/nwHRSqHX9A+9Ru/Rz7tHcqZyDo6j
3nvH+qrOv08fxz59oibr8+sTreKd6e2dca1R7/ZjvVSX659xfR49HefRM3pG6H16eNckZ6rl/Px7
RJUPEeuuuvD7do+mO0f+Nd28a5Iz/n26emdca9IdkOy/tl2y3jMR66z2SHY1c36unaNneWc+9s64
1iiPJtZJddmff6foOaHXdPSuSc7UCr1vB++a5Ey6S5T7z6aPcn6M5J7p/mP4Pdp790jOpHtVeqad
d8Z/Lu2iF+T8a/Sh2jPZ1c5637Zqj2SX7prl/u9R2+hF3pkPvDPhj9vmlOx5cc73bO3dMzmT7v/l
/vvUOlpHda1Ul/1xWkbTvcWwe/yvf0mU/81Hl7tdopjD3f5Qu9vFb9PudvHKDnf7gMPdXutwt2c5
3O2h2t2Od9budvw97W7HX9PudvxZ7W7HG2p3O95Au9vx+trdjl+v3e345drdjtfW7nb8bO1ux6tp
dzteSbvb8bLa3Y4X1+52PKrd7XhRh7t9wuFuH9buNu7X7jb+rN1t3K3dbdyh3W3cpt1tdLjbuFG7
27heu9u4RrvbuEq727hcu9u4TLvbuES727hIu9u4QLvbOE+72zhbu9s4U7vbOF272zhFu9s4Sbvb
OEG72zhOu9s4RrvbOFK72zhcu9s4TLvbOFS72zhYu9s4ULvb2F+729hPu9vYR7vb2Fu729hTu9vY
Q7vb2E2729hVu9vYWbvb+LF2t7Gjdrexg3a3sb12t7GddrfxQ+1uY1vtbmMb7W5ja+1uYyvtbmNL
7W7j+9rdxhba3cbm2t22nXK38R3tbmMz7W5jU+1uYxPtbuPb2t3Gxtrdtp1yt/FN7W7bTrnb+Lp2
t22n3G18TbvbtlPuNr6q3W38t3a38RXlaatrAXxZe9u2U942vqS9bfyn9rbxRe1tYyPtbdtOedv4
gnK09fn+QzvbtlPONj6nnW18VjvbtlPONj6jnW18WjvbtlPONv5dO9v4FKT72frP9aT2tW2nfG18
Qvva+Lj2tW2nfG38m/a18THta9tO+dr4qPa18RHta9tO+drYULnZ+s//V+1q205fXzysXW3bKVcb
/6K9bHzI2SlX23bK1cYHtauND2hX23b6+ufPzi7d107g/c5OOdt4n3a2baecbdspZxv/pP1sbODs
vM423qudbbxHO9u2S/ez9V53a1/bdsrXxru8vrbe+07tauMd2tW2XbqXrfe6XXvatvM62Xibdrlt
pzxtrK+cbL1Xfe1o463a0bad/m9Tb3F2Xk8bb9aetu2Up403KSdb73WTdrTxRr+jjTdoR9t2Ph9b
7/NHmB9gRrnYWM/Z6XuRusrF1vvX9bvZeL3fw8brtL9tO6+bbWeUm43XKg9br7tGOdiuGa9/jVcH
mlE+tu2Ue41XObt0HzuBVzq79HtEfR5X+n1svMLrXifw8kAzXh8bL/P72HZG3+de6uzS3Wu916XK
xU7gH5ydz71OYJ1AM+nutZ65xO9i2xmvi21n0l3sBF7s7NLda73XRaG9a/9n1YXKt3bN6GcVtZ2d
z8HWe9dW/nUCL3B2yrfG852dz68O/zU6z+9e2xnlXuO5fvfaznjdazujvGqs5fex7UzWnjWeo/1t
23ndazzb61671vgca73mLL9zbWf087Kafg/bzoR1rvUeZ6o9kp3PuU5gDTWT7HyOtWsfr3NtZ9Sz
cEx4PezkTLp3ncDqXhc7ORPWodZ7VPO72nbG51271nj9ajxDe9m2C+1cY1Wvc+1aE9q3tmuUb41V
wrvUaPyOtp3x+dauNT7XOoGnq5lk53Or9T6VQ3vVrj18frReU6lAa7J2rO0e+jn+aX7v2s74HOsE
VlQzyc7nUPvPuWJ4xxorZO9LY/nwnrZdE9andu2R7lcnsJzXuU7O+BzrBJYNNBPWp3btEdqvxjLa
r7ZdWHc6gaWz9q2Te4R1qV17KE8aS4X3re0anzcdZA+fV53AkoFmfG51AksEmjnVfrX/a1I8tEet
94hn71XbPcJ61a49fE51AjG0d51c43OoE5gfaCZbRzr773dMnUOyy9qpxmhofzrInlm71HYPr0uN
EN6ltmt+d28aI95jJmfCetR6jzy1R7LLuUdt98zWmdZ7FgvtUPv3LBrajQ6yZ67daf8xi4Q+ZnJN
WG86gYW9a5IzYb3oIMfNuSONhbSLbbuw3rT3OPknQzvTQfY81b60/xxOhD6H5Jpsfekgx8jag87/
ze9b25lsXelE/nHvHsmZbF1p156n3JO2x0j3lRP5x3LuMPvP42jWx0zukWtPOsgxwzrSifwjBVqT
rROdyD/s3SM5kztPuvDJk81WkCc93RjKtdtsFu9ZdLzhXJ7k+MFiLxrONsSdin1tOA8R35l3juG8
kbhi3pOGs2mScXdeJ8M5hnhxHh3PJh0Ph+VtNJyHidvlHSZuFylH/FqkjOGsTfxEhI5nk46H90Su
MZwPEteN3GU4nyO+OPKI4XyDuEbkecPZkrhi5A3D2Zk4P/K+4RxAXCjSwXCOSnL+wUgvwzmVeHdk
sOGcR7wtMsZwLiXeGJlqOL8iXh2Zazg3ES+NfGY4txMvjKwwnLuJZ0fWGc79xFMjmw3nUeLxkW3E
46EQ8cjILuKRECEeGtlLPBTixP0jB4j7Q2niXpFjxL2gInE3KGQ4DXEnyDOc1YnbQ8xw1iT+AEoY
znOJWwJ9v2zS9yu/OVQ0nHWIm0Jlw3kZcWOoajivIn4dEobzOuJXoabhrEf8MtQynDcRvwjnG85b
iZ+HCw3n7cTPQh3DeTfx3+Eyw9mA+Em40nDeT/wYXG04HyB+BK43nA8TPwz1DGdD4ofgRsP5GPED
cLPhfJz4PqhvOJ8ibgB3GM5niO8B+vtqk/6+5t8J9xrOF4hvhwaGsxFxfbjfcL5EfAs8aDhfIb4J
HjKc/ya+AR42nK8R14OGhvN14uvhUcP5JvG18LjhfJv4GnjCcDYhvgqeMpzNiK+Apw3nu8SXw7OG
8z3iS+E5w9mCuA7Qz59N+vnLvwQaGc7WxBcBfd7YpM+b/NrwkuFsS3wB/MtwtiM+H14xnO2Jz4VX
DWcH4lrwmuHsSHw2vG44PyY+C+jn3yb9/OfXhLcMZ1fiGtDYcHYjTkATw9mDuDo0NZw9iatBM8PZ
i7gqvGs4+xBXgeaGsy+xgRaGsz9xZeHKwpWAPo9sDhBuJTyIuCK0NpyDiSvAB4ZzKHF54fLC5aCt
4RxGXBbaGc7hxGWgveEcQVwaPjKcI4lLAX0e2uTPw5LQ0XCOJi4B9Hlvkz7v84vDx4ZzLHEcOhvO
ccQIXQzneOJ86Go4JxDHoJvhnCjcXXgSMUAPwzlZuKfwFOI84M/rPJgq3Ft4GnEx6GM4pxMXhb6G
cwZxEehnOGcSF4b+hnOW8ADh2cSFhAsxx07CQMM5h/gEDDKcc4UHC9Pvj9hxGGI45wsPFV5AfEz4
mPBR4aMpHia8kPgIfGI4PyU+DMMN5yLiQzDCcC4WHin8GfFBGGU4lxAfED6Q4tHCnxPvF94v/CvQ
70ObS4XHCi8j/gXGGc4viPcBXX/YXC48QXgF8V7hvRn4Z5hoOL8k/gkmGc6VTt4Dkw3nKuLdMMVw
rhaeKky/v2M/Cv8ovAumGc41GXi6MF3vxHYK7xTeATMM5zrhmcLriX+AWYZzg5O/h9mG82vi7cLb
M/Ic4Y3E24CuR2zS9Uhsq/DWFM8T3kz8Hcw3nFuc/C0sMJzfOPkbWGg4v3XyFuEtKf5U+DvizbDI
cG7NwIuFtxFvEt4kvBHoesvmduElwt87+Wv43HD+QLxBeENGXiq8g3i98PoULxPeSbxOeF2KvxDe
RbxWeG2Klwv/SLxGeE2KVwjvdvJX8KXh3BOIV8NKw/kT8SrhVSleJfxzBl4tvJd4pfBK4S/hK8O5
LwOvEf6FeIXwihSvFf6VeLnw8oD8BdD1tc39GXi98AEnL4MNhvMg8VLhpRn5a+FDTv4c6H7I5mEn
LxFekpE3CR8h/kz4sxRvFqb7h9hi4cUZeYvwMScvgm8M53EnfwrfGs7fMvB3wieIFwovLCAvgK2G
86ST5wvPT/E25mihDLxduDDxPOF5GXgufE88N1okA/8gXNTJc4TnpHiHcDHi2cKzC8izYCfxrGhe
Bt4lTPePsZnCMzPyj8Lg5BnCM1K8WziagfcIx4inC0/PwNPgJ+Jp0fyc8FThqSn+WRiJpwhPych7
heOBeDLsI54cLe7kSfAL8aRoiYD8q3BJJ08UnpiBJwhPyMj7hUsF4vFAzxti46OlA/JB4TJOHic8
LiMfEi5LPFZ4bEY+LFwuEI+BI8RjouUD8Wjh0YH5qHAFJ48SHpWRjwnT85zYSOGRGfm48GmBeAT8
RjwiWqmAfEK4spOHCw9P8Unh04k/Ef7kFPGwKD3/smkC8VDhoSkuLFylgFxEuCrxEOEhGbmo8BnE
g4UHB+ZiwtUC8SDhQSnOE67u5IHCA3PGEeEE8QDhAYEZhGsUiPtHo4bzzEDcT7hfimPCNQvI+cJn
EfcV7huYUfhs4j7CfU4R9xbuneK48DmBuJdwr4xcXLhWAbmEMD2/jvUU7hmQe0RLGs7zcsSlhM93
cnfh7r8Td4uWNpwXFIi7Rul9gM3aOeKywhcG4i7CXVJcTvgiJ3cW7hyYywtfnBP+OFrBcF5SIO4k
3ClnXFG4TiDuKNwxI58m/AcndxDuEJgrCV+aE/5I+KMUVxa+LEd8uvDlTm4v3D4wG+ErnNxOuN3/
E38o/GGKqwhfWSBuK9w2xVWFr8oRnyF8dSD+QPiDwFxN+BriNsJtcsbVha8tELcWbp3ihPB1/xXc
SrhVYK4hfL2TWwq3LDCfKVw3J/y+8Psprilcr0DcQrhFRj5L+I+niM8WvsHJ7wm/d4q4uXDznPE5
wjfmhN8Vfjcj1xK+KRC/I/xOYD5X+Obfic8TvoW4mXCzU8bnC9+aE24q3DQjXyBcv0DcRLjJfy3X
Fr7NyW8Lv50zvlCYfJ5YY+HGvxtfJHxHTvgt4bcy8sXCdwbglM9Xt3DdYvL/Pf2/Pt8x8fmOsc9X
/A32+WySX1P8Qvb5bLLPd0x8vmPi860Un28l+3zxcezz2SS/I96VfT6bdLz4O+zz2aT3UfFG7PPF
G7HPF2/IPp9Nup+L38U+n00+Xj32+WySzxe/lH0+m+RHxc9ln88m+Xzxauzz2SSfKC4+X1x8vnhJ
9vlskj8TB/b5bJK/Ei/EPp9N8kPwKPt8NsnHwF/Z57NJ/gLuYZ/PJr3/xx3s89mk9+W4lX0+m/R+
GTexz2eT3r/ievb5bNL7RVzNPp9Net+GK9jnwxXs8+FS9vlwKft8uJh9PlzMPh8uYJ8PF7DPh3PZ
58O57PPhLPb5bNLzSZzOPp9Nep6GU9jns0nPl3AC+3w26fkGjmOfzyb7l6PZ57NJ93M4gn0+m3R/
g8PY57NJ19M4hH0+m3Q9hgPZ57NJ1x/Yn30+m/T7CPuyz2eTPk+xN/t8NunnEXuyz2eTfD7sxj6f
TfL5sCv7fDbJ58PO7PPZJJ8PO7HPZ5N8PuzAPp9N8vmwPft8Nsnnw3bs89kknw/bss9nk3w+bMM+
n03y+bAV+3w22T9tyT6fTfL58H32+WySz4fvsc9nk3w+bM4+n03y+fAd9vlsks+Hzdjns0k+HzZh
n88m+Xz4Nvt8Nsnnw8bs89kknw/fZJ/PJvl8+Ab7fDbJ58PX2eezST4f/g/7fDbJ58PX2OezST4f
vso+n032aV9hn88m+Xz4L/b5bNLnDb7MPp9N8vnwJfb5bJLPh/9kn88m+Xz4Ivt8Nsnnw0bs89kk
nw9fYJ/PJvl8+Dz7fDbZ5/0H+3w2yefD59jns0k+Hz7LPp9N8vnwGfb5bJLPh0+zz2ezl/C7wuTz
4VPs89nsK9xCmPw9fFL4SeEn2OezyX7x4+zz2Rwk3FqYfD78G/t7Nsnfw8eEHxN+lH0+m+Tz4SPs
89kcLtxemHw+bMg+n82Rwh2E6fMQ/8o+n03y+fBh9vlssr/9F/b5bJLPhw+xz2dznHAXYfL58EH2
+WySz4cPsM9nc6Jwd2Hy+fDP7PPZJJ8P72efz+YU4V7C/Hl9H/t8NqcJ9xEmnw//xD6fzRnC/YTJ
58MG7PPZnCU8QJj8PbxX+F7he9jnszlHeJAw+Xx4N/t8Nvn3x3+qu5fYqKowDuDnzrQznTkz05bS
59D29kWnLS1ToAOU97u8ROKGpfhIcEMwbnTnkoUkbFRwBTs1EhONCRJJVCQQHkZQFOWNqYK8C5S2
QMev5/t7Q+Acc3Izg9jJnX9/ve13bpubzEzzn5nnuM9HuQ/+EP5O69XwangV9/ko98Mfw6rPJ1dy
n4/yAPwJfBDeBas+n1zB/T1K1d+Ty+Hlnj+FD2vdx30+Sr49XMZ9Psqj8Gfw9/DnsLr/IZdyX49S
9fXkEniJ0V/Aqs8nF3N/j/K41ou4z0f5I7wb/gn+Eubb74XwQs974J+1XsD9PUp+/sJ8eL7nr+CT
8F5Y9fnkPO7vUf6m9Vzu61GesvIc7vNRnoa/gfn+yGx4tudv4bPwPvic1rO4v0d53uD9sOrryV64
1+CZ3OejvAgfgH83+CCs+ntyBjwDns59Psp++BD8h8GHYdXXkxk4Y3AP9/coLxl8FL6s9TTu71H+
pfVU7u9RXjH4B/iq1lO4r0d5zdLH4etad3N/j/KG1mnu71HeNPgEfEvrydzfoxww+BdY9fNkF9xl
7ZMw37/uhDs9/wrf1XoS9/UoBy19ClaPn2QH3OH5NDykdTvcbvQZeNjgszA/fmiD24w+B983+Dys
+nsyBac8X4BVf0+2wq2eL8KjOfFE7utRZq3cwv092cL9PY37YcfKzdzfk83c39P4T1j19WQT3GT0
JbjAlxvhRs+X4UKtG7ivJxu4r2fhK3DYyi7396TL/T2Nr8ERS1+HVf9O1sP1lq6D64y+AUtL34T5
8XYtXGv0LVj19+QEeILnAThh6dtwsZWTcNLSNdzXkzXc17PwXbjU0oOw6ufJarja2vfgMksPwfz8
0Sq4yuhhuFzrSrjSt0fgCitXwBWe78OVVi7nvp4s576ehR/C1T49Cqu+nhwPjzc6Cye1LoPLcmXu
51FOsPI4eJxnB661cilc6jkA11k6CNf7cgn38yhdny6EG3y5GC62dghu1DoBJ4wOw00+XQQ3ax2H
40ZH4BYrx+CY5yg80acl3OrLEpa+HYNVH09G4ahvx+E2n07A/P/rCByxdjHcoXURXGTtEnjSU3EY
DhtdCnf69Di4y5dDcMhzGTzZlwu5j0eZzpHL4e4cuQJWfTpZABfkyEE4aO1KeGqOXAVP8+UAHPBc
Dff4sgM7RtfAmRw5CU/PiQX35Shn5MPRLJsyV66FZ+bIdXCv1qPwqLXr4Vl5sgvPtvJD+KG1G+A5
vvwAfuC5EZ77v/R97t9RzsuLR7h/Rzk/T26BF+TJE+GFWg/Dw77dCi+y8hA89Mw6BS/Oie/B94xu
g5fkye3w0rx4EB703AEveyq+y307yr6n5E54+TPhO/CdnLkLXmHl2/Bt354Mr/yPnIZX+fIAPGDt
bni1hR95H3P1EVbXaXki9HpiZ2SDmCKPhl5LfBTZRHuK6MJ7tkdeFG5ie+gt9VmDPEPXNSJ45Ihw
xNpYYehYbF5Yip3iPRFyaBxtO8UHoih7kXCWth1im7diXDwvUrE54Reku2r9xlfcdW66q4e+Yztt
74+9buBmh+aujb1BU3cZpw4/NrV9Y8xd8/Kr6zc+Pu/tqmyWfjQsCujSGLsQuppMiqb+sa1fNCX7
DfOvPTEfh+uu606nxSPHi/eDj6+xnDyimYwjf2wyXkExvjd0LJMZy3D4UMYwdf8TUyP483ZnHpnp
tTg7eGai419m7nliZhEfKY38ZyKfT1u888oR0UBanC9xi+lcCmwObAu+GRRqD860wNbAjuCmwIi3
N6BZfTehB6vHxdeiRNwUG9SWCvYFtjnrNeu/I6ZEUo4brXK2KqUjaScVLXG2eF9/17BSL1YaW2WT
2lKRS47rvKT9LbN/AwvqshowVBzwjyMAABQlkLikGIET4yQ/Zll3z/wTWVEZVSx2hfp5wnOppA1a
OJoAAAAAAAAAAAAAiwEAANUAAAC0i0wAzEYpAE0jAAAA/nic7Z17kBzFneczK6u7Rw/U7C0giVeP
We6QBMYSh209bDdwjnCAZMzDceEFiadwmEMSAsSuNwLUA8gO39kgCQT49jZAEuIRGxsBeoDNHxc7
SOLl2H9AEg9zsTsnJAHGcR4fkqanp7vr8vGp6uzq6pkBY5uLAGg++cuuym9mVuYvf5nViL+fK8xf
++RPxV8E0WQRNYUIznMf81f+qcnfs4lNYqn4/oXfumy2kNparC31rVuvXfmDc66eI8b+K9CfHv2R
//OUx48d8+qN4mf2c6rWmpjUoqBL6BG94rvyrdwP5FsmNWlN7geT1ogTrxHXiCjSVwT679PE9UEx
Lyx74Rx4AbwcLoW3wx/Dh+FT8Hn4K/gO/C1sOKopsARnw/PhZfB6uAr+CD4En4S/hK/CX8MPYd0x
PAaeCr8Ez4OXwuvgbXANfBA+AX8BX4Fvw9/AEcfcZHgKPBuW4SXwWngrvAdugI/D5+DL8C34Aaw5
5ifBk+EX4Tfgd+A18BZ4N3wAboHPwpfgm/B9OOxYmAhPgmfBr8OL4dVwJbwL3g8fgzvgi/AN+B6s
OvZMgCfCM+HX4LfhVfBm2AfXw81wO9wN98FDcMhxQg+cDmfBBXARXAJXwApcBzfBbXAX3AsPwqOO
EwtwGpwJ58OFcDFcDlfDtXAj3Ap3wj3wADziOCkPp8IZcB68SDu/E/FSzh+dJq6ZtGiu+fYa+dZc
4ycfEnnjIqVJ/73oifZbf2m82s/FWWKCUPlv3bDihr+5Vgil/z5GXCLOFqEQkRAzxN0yDOecPXe2
ufq/68/Dad8mNzvfptkL58AL4OVwKbwd/hg+DJ+Cz8NfwXfgb2HD0fk2zRKcDc+Hl8Hr4Sr4I/gQ
fBL+Er4Kfw0/hHVH59s0T4VfgufBS+F18Da4Bj4In4C/gK/At+Fv4Iij822ap8CzYRleAq+Ft8J7
4Ab4OHwOvgzfgh/AmqPzbZonwy/Cb8DvwGvgLfBu+ADcAp+FL8E34ftw2NH5Ns2T4Fnw6/BieDVc
Ce+C98PH4A74InwDvgerjs63aZ4Iz4Rfg9+GV8GbYR9cDzfD7XA33AcPwSFH59s0p8NZcAFcBJfA
FbAC18FNcBvcBffCg/Coo/NtmtPgTDgfLoSL4XK4Gq6FG+FWuBPugQfgEUfn2zSnwhlwHszwbfJR
59vko+PwbTPkC9Z7ffXLXb1X8L+d99LshXPgBfByuBTeDn8MH4ZPwefhr+A78Lew4ei8l2YJzobn
w8vg9XAV/BF8CD4Jfwlfhb+GH8K6o/NemqfCL8Hz4KXwOngbXAMfhE/AX8BX4NvwN3DE0XkvzVPg
2bAML4HXwlvhPXADfBw+B1+Gb8EPYM3ReS/Nk+EX4Tfgd+A18BZ4N3wAboHPwpfgm/B9OOzovJfm
SfAs+HV4MbwaroR3wfvhY3AHfBG+Ad+DVUfnvTRPhGfCr8Fvw6vgzbAProeb4Xa4G+6Dh+CQo/Ne
mtPhLLgALoJL4ApYgevgJrgN7oJ74UF41NF5L81pcCacDxfCxXA5XA3Xwo1wK9wJ98AD8Iij816a
U+EMOA9meK/gX533Cv51PN5LCee9usdeYa/zXpq9cA68AF4Ol8Lb4Y/hw/Ap+Dz8FXwH/hY2HJ33
0izB2fB8eBm8Hq6CP4IPwSfhL+Gr8NfwQ1h3dN5L81T4JXgevBReB2+Da+CD8An4C/gKfBv+Bo44
Ou+leQo8G5bhJfBaeCu8B26Aj8Pn4MvwLfgBrDk676V5Mvwi/Ab8DrwG3gLvhg/ALfBZ+BJ8E74P
hx2d99I8CZ4Fvw4vhlfDlfAueD98DO6AL8I34Huw6ui8l+aJ8Ez4NfhteBW8GfbB9XAz3A53w33w
EBxydN5LczqcBRfARXAJXAErcB3cBLfBXXAvPAiPOjrvpTkNzoTz4UK4GC6Hq+FauBFuhTvhHngA
HnF03ktzKpwB58EM7xWe4rxXeMp4vFdYtt7rK91jr9zVzntp9sI58AJ4OVwKb4c/hg/Dp+Dz8Ffw
Hfhb2HB03kuzBGfD8+Fl8Hq4Cv4IPgSfhL+Er8Jfww9h3dF5L81T4ZfgefBSeB28Da6BD8In4C/g
K/Bt+Bs44ui8l+Yp8GxYhpfAa+Gt8B64AT4On4Mvw7fgB7Dm6LyX5snwi/Ab8DvwGngLvBs+ALfA
Z+FL8E34Phx2dN5L8yR4Fvw6vBheDVfCu+D98DG4A74I34Dvwaqj816aJ8Iz4dfgt+FV8GbYB9fD
zXA73A33wUNwyNF5L83pcBZcABfBJXAFrMB1cBPcBnfBvfAgPOrovJfmNDgTzocL4WK4HK6Ga+FG
uBXuhHvgAXjE0XkvzalwBpwHM7xXbrHzXrnF4/FeudXOe3mxF3fIKckd/0uI4BXu4L2A/esY7eZm
qCmN+qmX37DithtX3fg3N676u95rVyzt/daym6+7oXfVDctX9s5YOFO0vU34ubDvIXLrxQ8TfkH8
JLdN68ng96LbPz01EZSj/hHRMyJEsRnZRCMSg3Uxsa6br5NNlyzXI9HfED11MaK/boiJDSGUTtZ1
nk4Wa5HLK9f0dU0xRWdXoqhflKNooKmLFkpG0WBTBFFU1V/rhIqaDREUonpTHKPNYqRF9TXuy1LU
Vxeh/rcwX8pyfUSEShcnJmsrGqwJFQ3qr0LdvKhfW+Wq/krpKkXDQhXrzig0tVFoOqNYHTZ1EGKS
NkqDVV2TPpce0OkK6T6dLvWJiYFOD+lKueSpOllwyZN1UrnkNJ2UfWKCTh57VOhUZhfnj+o6NiyU
Q8Gh6FBq2MLksO67hq2E7KsJUSGtGyd015oWyIERIWVsDGqjEBu6e2QxNpraKMWGfqSyrDvadZXu
VFmpx1a/6fBqQ0yx1oB+GrprY1Pn60ekM03/R3X7qPQAMP1f0eVphbo1ylpJK9R5iH3m+7qzCubR
65KsVbBPTJqnbCydbZ7WgC5E90NkBpupjzHK+okVTVUnNUTODIGSboRJF814arq0LltEVZfWJety
R8w4DaOqLtQlK82CGdomWY50gSNiQl2oUvRoVLOpoh5sLqWiqO5SegBWa2YS6HE64BIVM8BMohzp
B1OwnTtsacaXoao7Sj3E8vp5DTpcMyx6zJOt6h76tBKjzOXUP61h6Y3V1Aj2xjWj3Z8EHZODSdM2
mzrmWTIDU5Ozbd62TenO+Z5yBp6n6HAk7X7G80BtXin2VIn3ank0z88lvq/lDWP/OP5+/+P9Yypj
x/kE06eR6bGJI2a+R2LAJQs6WXfJUtO57hHjViLR17DJSsN58RGhGz/gGi/rtksm10Ved7SeeVVn
mBkmzMTXhvY09pE5o9hsmn9h6KegZ4IzSvrBSBV5hvFXk4yh1QRflHUVZEV7ijGMPuNZPg3DVqCv
4TysSWsZ62FT6aKp5GovTbMKtiW0XpkGKwxZN63XPTZJ967tlkGbzuk5I0xrTLqsh3zknkBYjPTI
qhtfI0rDkRz81FPjHUwj9snbsSBKcaJiEvkRPUvsZDHzJpUoxIliOmHmsPaDpkurVcvyIByA/Sn2
jY+lmP3tLA60s4CeQl/WYbNq/XOlz/np8oBjSfut8TW/MHbzRckkbPWi6meiGwroq7gbItcNUdwN
g143xA34tBLjGYOFmvEcNevPtH+Za91VaFxNuW4nTtEk+5hEJs2Eqpg0Ey0ibVyWXTHK1diZ2YIS
Z+YbQkcgbm7n9VKlp21sVLWBm8qXBn1jwBiVlHFMXRTK/cYwbibD6vvTWJU2dRxovtTfUeesphWN
ISOvBxTdUah7HWV7rVSPO7e/1Z/SrMfxsmGeQdGEka1FprXweMuRXWMbUWvharaWMx0xmjGhF3a9
sJllT4dqI6IwLOzyN8qIMgF1pRFjNFdv02UWqn5v0fh0jEpXI0oMVsfEUL5hAviJ+hlJHc00M5P1
VrKamRxoJc2a75J1lzdi45wsb/JJ+OeKiD53IJ87kE/RgYw7wLZBQyzdqk5rQ0FMbZKqbidlRnjd
3wqvzTjV6zBG3QuvS9WsiNoaA55RHvBcyxgh9acSX2eG1BnhdbG/M6SeZIMUnfYjajmuiHqga0Rt
tsjFYfNMXMLu90wy3j9//IRZRsrj3nMno8ckSpHbPbaGjnLDcqLbWrLd7BhFWZs0JoUoRck2bdAd
0DjD9EvV26aV6t44KvjbNBUbdhw123dmHWme4p9qk9ZpZIp2LOQZ1W9rY2fr/X7xe6ytL9t7Oen/
cTil5JkWW06Jp5+MCH+MBGNFNWZw/WEjuTMxzkF9TEOoU11LdE8Ya3ViTWmKUDadWXdmod0sYjad
WWo3yy1zcmw2ImdUYkNf2GOOjIoD9slas9+ZegAcO9meamLr0XGsPfNs6pXfz2imMlSdjHLXjGqc
0d8loxBnlOKMwT92hj1rG6y5CHEcRjk2qjVmlW1IV6NeY775hj2Fbnqn0E3/FDqKjSany6qJYQ6X
CxiVgTqTzJwiVc10rmLo1dROsmOIeQNlj6DtGeCA+7cz7fGfOYx1g0AHZwN6RppFIIlsexrmeM/M
uIbdy1t/27D7e/tGQycLZo22V5o12h4Oi4oZzi5p1nf3NkTPTt03f67A9o837+2KqcOwpguQywPm
ubUvsHYVjldeuz7HS7J1mP7xV3Iwll7e7bLfHGML1tfagv0RVo5xLCP+0jHYWjpszBVHVna1SJaO
Zmvp0BFcn0jiWXtaWknWEQI9Lxb8uNFs3VstWvHoeJeLcZ3uyU92usdxUil9rPUHHm/9oad9KnXa
F2Wd9v05jrm8V39l9yAK8RMpj/+J2IQZT8W6OwYgORhvu2TdhsRud6YNM9TdJk4v0sWB2DC7M+6x
Wz9Z9QwicmNELUOPHBvDZxp9TOEso5QYZWvYHaZZQkUp3m+2W/qqgcQqdViDya5Vt6PYsvQCqbed
iTWoOybZw+qkjkqiZMoWonvclFfa0GFZEvmZ7X4c7PVJa9jjAZOuJx4yiqpsQfpEJWJroutWjtia
qD499XXXF6pmKNb/bCtHXo+PY4csTh1qn1hMoGQiR1Vm+MAwiapLFKJoOH4tmrwEHXSJon15OmK/
63NxbCXe/RSjuttEK+e0hu3rVJcomffBJqEL1wnzStF0l0mUTd+aRNF0/oSqK1sv9kO27DihHbK+
yGzLm2Ji1XrLQIeEJlnSSe2H9deNKND2pGHz3jkaNO+XTbqotUycadIVHdIXzRtM3R7z2leY6N8Y
hci++XKGCTH0WO43hq6piUH0mnnMiG2beQ1ZcpYp2VmT7Ttj4xv0sDyGd8rGGrSWKd28zXSWi2CM
Ndl2fL3uGYO+0e8Mu1bpwCVJV730gJfuc2njJk6u2SQjIsM7fX5k+hk7Mp2UM7G1W2L+2Omu3mOa
8x6lofbKs9yWmtVWXOASgy6hZ3/iNfri31DwY4qS+aGFSejZU7O+IrI/P7Lb4apL6C258x7G6zhf
UTZzwSSKZoZMGHZlO2dRMfPJeY26Sygz+wpD5gcEjiVYSLHsXWduLMSJUpywE9noKbsImFTRTmCT
qtg6UNO6C9N0EYNJwNZfp4mmQSP2y6pLlSJ+dWUU0j9CKdrfnkzAPdTo3Xqqm1sBWTP1ZPST4sHx
GD/LI+1zX/S5Lxr/CNH/mMCqOOhe9Zxsdu9uJ3uHXrLj+FeaQ4WI+FfpeWSnLC8kzAz1jWryGqcY
cR7fbpTqOq7gPN68+ChV4x2gCU8H4xcfOiQtJ4YOanWY0GZUGnGMq6OJ5H1LhuW9mTEBdcuKRrOE
Z8nuVn/K8t4ElfoVlmub8t79DBbqiVGsFj2jrrsneRFkwqi4C0zXJu9+TLCUMpJ3PzraKtTjd3H9
ohAH2LqBhTjA1lUpxAG2Cfn0s80PmY3U57vg/092wZ+/q/20rM/f1bIKVNhbKn5iLKU7MdaFTzHn
dNqyx2b2xNi+LzUq/e6wuazNpq2yeRdRGXCVcWfPodkAqtZbDmMW3GuN4iT7W2n7c2XzO+jEtq8h
nW1fI2mXZcLMojlLb5qXH3Xb7UXeNoTmR7HaTt4+WNt/+1AZbL2wsC8bKgOpjMh7YWFfFJg3I8n7
ibaMySaDdyWlzIyCy1D2fdhoGYWOjGYqo9iRUR8twzh0e+TqZ5RNRrlrhlmAzNmzbb7JaKYyzDJn
f35eSTL0QthPRtE81P6CtU2nu7dM9ufH5iFNadq3AmGfab4dLsbkrfwUN6pMGyPMkj0YsL+SN2bR
/jQ5MQv2oMD90t79fNnKGjdmosvIRJUDzihWG+483ixuehgbDHasca3/rmSjuNf+2VK9uZXyrdzK
SWtEr1gk3xKLOv8cqdxXJ90mapr/AR4PQ8fwI7gfvgb74dPwEXgvvAPeBK+AF8K58Ax4Asw5qsPw
Xfg6fAE+Ax+F98E74TJ4JbwIzoMz4FSYdwyOwANwD9wJt8KNcC1cDZfDxXAhnA9nwmmw4CiPwoNw
L9wFt8FNcB2swBVwCVwEF8BZcDrscRRD8BDcB3fD7XAzXG+Z/vOBFk1aKebqUTPXMvu/hPov/HdN
5k8DmpF7f9LE8JxzZ2f+l+hS/31a7rsTd4hhzW/Cc+Hp8DgYOoaH4QG4F+6GO+AWuAGugavgUoh+
iH6Ifoh+iH6IvkJfoa/QV+gr9BX6Cn2FvkJfoa/QV+gr9BX6Cn2FfoB+gH6AfoB+gH6AfoB+gH6A
foB+gH6AfoB+gH6AfoC+RF+iL9GX6Ev0JfoSfYm+RF+iL9GX6Ev0JfoSfYm+QF+gL9AX6Av0BfoC
fYG+cPodI3viM+JkOxoNO7znhI+c94THw9Ax/Ajuh6/Bfvg0fATeC++AN8Er4IVwLjwDngBzjuow
fBe+Dl+Az8BH4X3wTrgMXgkvgvPgDDgV5h2DI/AA3AN3wq1wI1wLV8PlcDFcCOfDmXAaLDjKo/Ag
3At3wW1wE1wHK3AFXAIXwQVwFpwOexzFEDwE98HdcDvcDNdbdoyxCYPOe1qO7j2155zw38Jz/uOo
nnPCl53nhOfC0+FxMHQMD8MDcC/cDXfALXADXANXwaUQ/RD9EP0Q/RD9EH2FvkJfoa/QV+gr9BX6
Cn2FvkJfoa/QV+gr9BX6Cv0A/QD9AP0A/QD9AP0A/QD9AP0A/QD9AP0A/QD9AP0AfYm+RF+iL9GX
6Ev0JfoSfYm+RF+iL9GX6Ev0JfoSfYG+QF+gL9AX6Av0BfoCfeH0O0f1HOc5LTs8Z88q5znh8TB0
DD+C++FrsB8+DR+B98I74E3wCnghnAvPgCfAnKM6DN+Fr8MX4DPwUXgfvBMug1fCi+A8OANOhXnH
4Ag8APfAnXAr3AjXwtVwOVwMF8L5cCacBguO8ig8CPfCXXAb3ATXwQpcAZfARXABnAWnwx5HMQQP
wX1wN9wON8P1lh1jrOcW5zktx/ScPZPCc84Z1XMWnnWeE54LT4fHwdAxPAwPwL1wN9wBt8ANcA1c
BZdC9EP0Q/RD9EP0Q/QV+gp9hb5CX6Gv0FfoK/QV+gp9hb5CX6Gv0FfoK/QD9AP0A/QD9AP0A/QD
9AP0A/QD9AP0A/QD9AP0A/QD9CX6En2JvkRfoi/Rl+hL9CX6En2JvkRfoi/Rl+hL9AX6An2BvkBf
oC/QF+gL9IXT7xjVha3Oc1p2eM78Yec54fEwdAw/gvvha7AfPg0fgffCO+BN8Ap4IZwLz4AnwJyj
Ogzfha/DF+Az8FF4H7wTLoNXwovgPDgDToV5x+AIPAD3wJ1wK9wI18LVcDlcDBfC+XAmnAYLjvIo
PAj3wl1wG9wE18EKXAGXwEVwAZwFp8MeRzEED8F9cDfcDjfD9ZYdYyz/e+c5Lcf0nPmfhufMGdVz
5r/sPCc8F54Oj4OhY3gYHoB74W64A26BG+AauAouheiH6Ifoh+iH6IfoK/QV+gp9hb5CX6Gv0Ffo
K/QV+gp9hb5CX6Gv0FfoB+gH6AfoB+gH6AfoB+gH6AfoB+gH6AfoB+gH6AfoB+hL9CX6En2JvkRf
oi/Rl+hL9CX6En2JvkRfoi/Rl+gL9AX6An2BvkBfoC/QF+gLp985qok585kxZ+525znh8TB0DD+C
++FrsB8+DR+B98I74E3wCnghnAvPgCfAnKM6DN+Fr8MX4DPwUXgfvBMug1fCi+A8OANOhXnH4Ag8
APfAnXAr3AjXwtVwOVwMF8L5cCacBguO8ig8CPfCXXAb3ATXwQpcAZfARXABnAWnwx5HMQQPwX1w
N9wON8P1lh1jLHer85yWY3rO3ORQh5yjec7wOec54bnwdHgcDB3Dw/AA3At3wx1wC9wA18BVcClE
P0Q/RD9EP0Q/RF+hr9BX6Cv0FfoKfYW+Ql+hr9BX6Cv0FfoKfYW+Qj9AP0A/QD9AP0A/QD9AP0A/
QD9AP0A/QD9AP0A/QD9AX6Iv0ZfoS/Ql+hJ9ib5EX6Iv0ZfoS/Ql+hJ9ib5EX6Av0BfoC/QF+gJ9
gb5AXzj9jlEdbnOe07LDc6ojznPC42HoGH4E98PXYD98Gj4C74V3wJvgFfBCOBeeAU+AOUd1GL4L
X4cvwGfgo/A+eCdcBq+EF8F5cAacCvOOwRF4AO6BO+FWuBGuhavhcrgYLoTz4Uw4DRYc5VF4EO6F
u+A2uAmugxW4Ai6Bi+ACOAtOhz2OYggegvvgbrgdbobrLTvGmPq/znNajuk51c/COfNG9ZzqK85z
wnPh6fA4GDqGh+EBuBfuhjvgFrgBroGr4FKIfoh+iH6Ifoh+iL5CX6Gv0FfoK/QV+gp9hb5CX6Gv
0FfoK/QV+gp9hX6AfoB+gH6AfoB+gH6AfoB+gH6AfoB+gH6AfoB+gH6AvkRfoi/Rl+hL9CX6En2J
vkRfoi/Rl+hL9CX6En2JvkBfoC/QF+gL9AX6An2BvnD6naP6HOc5LTs8Z3C785zweBg6hh/B/fA1
2A+fho/Ae+Ed8CZ4BbwQzoVnwBNgzlEdhu/C1+EL8Bn4KLwP3gmXwSvhRXAenAGnwrxjcAQegHvg
TrgVboRr4Wq4HC6GC+F8OBNOgwVHeRQehHvhLrgNboLrYAWugEvgIrgAzoLTYY+jGIKH4D64G26H
m+F6y44xFhBzBuOKOYPJ4Zy5szv/pFHvjje08bfJG/mVYkb+Z/kF4V/fcO2tnb8j2aj/PlGPafPX
abnFPctDIf7KfBRs+9S65MfXD3fJ9+4ftXzKGFUjVU5mWbXRNcZV1/G2eTz1+TTbFudn1P8T98XH
eD4fq+/G23+fpK7DY2t/7D5tlbtRzyUzN0a7z13TmkcFcaz+u1cslr/LfU/+n6SM08TiYLpU+p7T
9OdYXc4Jmsfrz1/qz3H6M1l/ijr/L0kX4ARHJd33YU5/JqJvygk1Jdfl+eg8pcjv4RO5e1XOfR+a
74PWNbZd5romGqacBveEXBt69yjqFH/i+00fRdS/CRuuPEUdrG3KqlO+Ih16dRshP+ATp01+XIfA
q4+kPiJVJ8n1hdSzjrxnGbc78p5znjyutf1h7mm22/aafCq/kcqP+7TRosrIs33R7Mwz99tn0KAf
mvRTgz6Ky6q3vrf58fWN1vX2ucV9n6K9J/2d7jsVlxN6GqacOB1fH1BOnB5pv0cFybWtuRVf1/59
Z35clsrI98eJP27870ZoS5fvVKqM+LukTkFKQ2aUY65Hp2181r0xKzPKr2WUny6j5l0f21K0zWNV
a7djrcQXyIyy0nWSXtv8esX5I6nyJW3Omo8Z17b1XapOSmaU4+f77ail6hp0yfevDzLy0xrpttVS
18Z9MdIl36uD/11S/nCq/Na9rTlRy7jGr1stlS+87/22ZNVhuPM7lS5bpMr39Ye7lC/xp+l+Sfvl
kdT16XKEN0bS7fPrlNVHfnkjo2skY1mMUU4cvwRd6iO8+ojUOOhWlmy/tmtZ8XPLWNPs9elnGXht
86+tZeQHor0vvPpl5qevr4mOtimvDl3b7Odn3dNe1/YYzNcKRHadu/VV3IZaRn6qTpnz2M/vHv+d
+C//IuRjb9gIcFBHgL9LWmByfi//qzwsvhCU5JC++z/pz+n6c7L+/IVw0Z8pNcfHj7RMPhGFXY3y
tLZGfkBeVdhIR8UjO44UTDkRK3bo9QIRS8eqxb125SdKs97X96KUmejEEYzJi1eTUCQrt6qJ9hHv
jwBJGV7EZcsJRSvKisv3o6M4Aml4UUecF+vG6dTKmayk8ZPuNnOHU/X0IsiOXUGcV/Dy/ciStM1P
R5hN2hxHlg3RitojLy/nlRM/37iPml4fxd/5fddslZk814ZXTkN0RqRxnmovU3nRph992rLSUWed
nYd/j/JmdxzJ+pEn1ys/6vQi2rbrve+UH3VmRbHxtX60OtJ+bRIRB56mN7aStvsRaxy1qdZ1ibav
OdKqR1s5I16dVPv9bVGkX1ZWxOtFrMqfD6nyVEZ0nPSfv+vyI+eR9vokvqDmPYd4fmWUnfRRRlTd
FkWmI2S/rv78TddJifbILK2REWknO9laeznJquXXV3raftncn7TZLy+r/DhSS9dFtu+MlN8Ob5VP
nl0q2mnr91rr+ra2+9FCPRVdes9A+WV7a4NKlRtf01aOPw5Sem2RVnqHkC4/ZjqqjdueXo8C0enL
43b5EVWWtsx4TnF+OqJXGXXynlVmfrqP4rUlHuP+tV4fqHR+um0iIz9rXIwnv1s5Xp261bXten9O
jNUXGTqp71pzIq5zepeRFbX5zy++JmvX4M/XOD8dFY5412fpZux6kut5xuGEzmjRnLrriDH5P44V
amOeW2ad+abPV7PORdPl1DLKyTqbzjqPTZ8RZ50Fj7f88Wpk6KiMdo2aP56+G0ddx31m3e18utsZ
e7f8j1vOaOfi3eo62rn7x+mLse7pNjban9voZ+9Z42CsPhmrjd3GR+d4ypjF//iP9m2eOfs/Lfe9
4G9tXPd7fafZ55mPidcO86nTA1VaUuUzhNIRrj/irrW+p46PGaEmNdFaO+L7BYwoK2qlk71Bw4vn
431Bw5Vr69xo6SXxWl201oW4Pn48EZ9CxPmxHdMfKXG+oG6xr4+8vLgtgjYI0dpD8Z3y94re90l+
1E7l2/7pfJz2v2uI1j4s1Vdte09vz5XsReI+jfdI/j4sTnOt8q+N+z5Hf3t7s3h/obx0Ui9FflxG
+jS/6T3L+Pr4Gab2VR37r1h3pP3+jv2Ut/9py3f3te3xOvZcWfsn/35/P1RP5cdtT+97uu2rRkRr
L5ne24x0lm37JGP/0nXv5O+5PsY9yR4g/UYivU8a8cr3Y9T025C0bhzbpN+EpOLxzHK8a9piZr+v
4vinfR/T2ov4cXYtpeHH0/5bD7++/j5MpcrP2gd1i+/9NyHpNxsZ1ybfBamy/FjQ32fF+1U//vT3
Qa22teaEV3eV7o90XJ3eA6b3Yem9ULqN6f1f1h7G15Cifd/j9V3mnjGrT4JUOennkd4zZLXBL0e2
67XVM70vydpjZNU1VV7HyW+6DePUSE6cU20Zcx+WakvmGw9Bfr2zTplvoPx+El5et7aJLm3zn3/g
XZseF+MpR7SN+Y49Xlu9Yg32u6n6dv4Kg/3UhHPHFbPGJ7wZMWSSP949zijlj6nxh+xZ0m0YLeYd
797q49SzSx+NGu9/nP3Yp7FP+yT16bzeH22tX/KZv2aLvtzz4fcnrBPniB/mtoYrJvycsei+uWrC
T0RveFXuBZv6gviJ/nf8y7v4l0Mf5v5NfJi/M+M3fb8T5v8U7n7TF+vaP21HTs//D9k7yq8B39HG
v/N+DTjzRH35KNd/YH4JyPVniQliav7yv1t+3c3LhFBiqpj57+U3R7t7f9vdPYXXcuffeuO1y4Qq
vCZmflN+d7R7D2pjZlLTi8WZ3zwzOOeHY91xZvzbSPFvhR3qhu9/f4zabfL64sz/PL/Q2/u93tln
f7n1S/T4LZ78p9x++U/5R7qUU0w9jRnyjfw/j/ok/Ltmlsb/FGy/lz6z/S7/ofDmJ+p33fFzvtLq
d3bSvcGNuf3BjePv9+CBz0i//wn6OvjrT9LXed3V7f+Fb+J3jH/qVVNy+9WU/BMZpb2t019N97g6
N//Pk3u/tezm625g8rSXrGdQr/qpLvOnXcuclipz1p0T4wKzxkTYk9sf9oy7hrPunJSU5rfbee57
RfT/ACtgZP0wVBzwIHwAANgCIoZBLSRDvzsVxL7cVbAjwG4wdYO8Rvr/CLdUJ/FKLCkCAAAAAAAA
AAAAJgIAAMEBAAAolWoAnAJXAN57AAAA/nic7NpZjJRXeoDhU13dXQ00FDtooklhMFs0GTHscFOO
2E0uogizGC7GyrCDxxol7FB9xw6jkZIABsPc2ax2LlnsAt9EYrdRFGkMLjaduQHqsBZ0df35zv+9
tTUN9HiIPYk8Bp5zil6q/+Wtc2oY+jMj/4ucrhlkutUEjSYoGFPzFr+HmUzXsd27+o8wvze/Mgum
TfnHYSYis3kyq/v791b/+l/+eZRpx/9q5HeD/0anfvrx4Fd+9AGzLfz91/K9OpaexfCa2TX/3fDH
+FttPJfolN+898GiYS/5mtPN3MhPI39s9VwGtfu5+GdS/P4x+fwG06/mcO3a2Me1a/2oy7LYx12W
mZ/80vzSBIF8RI3817/mWu1/1JvQL/EK3sbHal0M++JQHI/TcR4uxw24Ew/gZ3gGv8Zb+Eitr8c+
OATH4ds4F5fhetyB+/FTPI1f4U18qMbqsDcOxrE4Dd/FpbgOt+NHeAzTeBlv4AO1oRZ74SAcg1Nx
Di7BtbgN9+FR/AIv4XW8r3aIYk8ciKNxCs7GxbgGt+JePIKf40XMoFM71mAPfBNH4WSchYtwNW7B
D/EwnsIL+C1m1U4R7I4DcCROwpm4EFfhZtyDh/AknsdreE9tNNgN++MInIjv4AJciZtwNx7EE3gO
r+JdDNTOXfENHI4TcAbOxxW4EXfhJ3gcz+I3eAcLapc49sNfSOZ+QsO0V/1r/tBl5Fj/t3+oXTvW
F/3fTL0PaMSP95iG4IZM/i5s3i7zM9PBROunzH9//or3jInKf53NP5ifm1pjAmO61v+2cZH/bYbU
tESvRkf8fJR81m75/e+tGxjdpg0Uv8QreBsfq9pAsS8OxfE4HefhctyAO/EAfoZn8Gu8hY9UbaDY
B4fgOHwb5+IyXI87cD9+iqfxK7yJD1VtoNgbB+NYnIbv4lJch9vxIzyGabyMN/CBqg0Ue+EgHINT
cQ4uwbW4DffhUfwCL+F1vK9qA8WeOBBH4xScjYtxDW7FvXgEP8eLmEGnagPFHvgmjsLJOAsX4Wrc
gh/iYTyFF/BbzKraQLE7DsCROAln4kJchZtxDx7Ck3ger+E9VRsodsP+OAIn4ju4AFfiJtyNB/EE
nsOreBcDVRsovoHDcQLOwPm4AjfiLvwEj+NZ/AbvYEHVBor9sI0GRjdrA6Ob29HAvzkqYRtmXlS2
2vFaNvFLvIK38bGqZRP74lAcj9NxHi7HDbgTD+BneAa/xlv4SNWyiX1wCI7Dt3EuLsP1uAP346d4
Gr/Cm/hQ1bKJvXEwjsVp+C4uxXW4HT/CY5jGy3gDH6haNrEXDsIxOBXn4BJci9twHx7FL/ASXsf7
qpZN7IkDcTROwdm4GNfgVtyLR/BzvIgZdKqWTeyBb+IonIyzcBGuxi34IR7GU3gBv8WsqmUTu+MA
HImTcCYuxFW4GffgITyJ5/Ea3lO1bGI37I8jcCK+gwtwJW7C3XgQT+A5vIp3MVC1bOIbOBwn4Ayc
jytwI+7CT/A4nsVv8A4WVC2b2A/bKFvtGC1b7Zj2lW24LNleWDZL2Sxls5TNUjZL2Sxls5TNUjZL
2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxl
s5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TN
UjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL
2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxl
s5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TNUjZL2Sxls5TN
UjZL2Sxls5TNUjZL2Sxls5TNtlm2W5TtVnvKdkTK9uI1W92/atnEL/EK3sbHqpZN7ItDcTxOx3m4
HDfgTjyAn+EZ/Bpv4SNVyyb2wSE4Dt/GubgM1+MO3I+f4mn8Cm/iQ1XLJvbGwTgWp+G7uBTX4Xb8
CI9hGi/jDXygatnEXjgIx+BUnINLcC1uw314FL/AS3gd76taNrEnDsTROAVn42Jcg1txLx7Bz/Ei
ZtCpWjaxB76Jo3AyzsJFuBq34Id4GE/hBfwWs6qWTeyOA3AkTsKZuBBX4Wbcg4fwJJ7Ha3hP1bKJ
3bA/jsCJ+A4uwJW4CXfjQTyB5/Aq3sVA1bKJb+BwnIAzcD6uwI24Cz/B43gWv8E7WFC1bGI/bKNs
db/TstX9rn1rtl+8ZM1WP0HLJn6JV/A2Pla1bGJfHIrjcTrOw+W4AXfiAfwMz+DXeAsfqVo2sQ8O
wXH4Ns7FZbged+B+/BRP41d4Ex+qWjaxNw7GsTgN38WluA6340d4DNN4GW/gA1XLJvbCQTgGp+Ic
XIJrcRvuw6P4BV7C63hf1bKJPXEgjsYpOBsX4xrcinvxCH6OFzGDTtWyiT3wTRyFk3EWLsLVuAU/
xMN4Ci/gt5hVtWxidxyAI3ESzsSFuAo34x48hCfxPF7De6qWTeyG/XEETsR3cAGuxE24Gw/iCTyH
V/EuBqqWTXwDh+MEnIHzcQVuxF34CR7Hs/gN3sGCqmUT+2EbZat/S8tW/1Z7y/biNVu9o2yOsjnK
5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iib
o2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yO
sjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK
5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iib
o2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yO
sjnK5iibo2yOsjnK5iibo2yOsjnK5iibo2yOsjnK5tos213Kdrd9ZRv2kjVbbL+WTfwSr+BtfKxq
2cS+OBTH43Sch8txA+7EA/gZnsGv8RY+UrVsYh8cguPwbZyLy3A97sD9+Cmexq/wJj5UtWxibxyM
Y3EavotLcR1ux4/wGKbxMt7AB6qWTeyFg3AMTsU5uATX4jbch0fxC7yE1/G+qmUTe+JAHI1TcDYu
xjW4FffiEfwcL2IGnaplE3vgmzgKJ+MsXISrcQt+iIfxFF7AbzGratnE7jgAR+IknIkLcRVuxj14
CE/iebyG91Qtm9gN++MInIjv4AJciZtwNx7EE3gOr+JdDFQtm/gGDscJOAPn4wrciLvwEzyOZ/Eb
vIMFVcsm9sM2yhbbq2WL7W1v2SrWbHx0pEvpo//LmOgIPjpiOpb+RV1n84EZUvefZsJfzZi//IN+
Q6YP7ffe+7/qN/nXv/mnxe8v7Ddk1vK/HT606t/b7TLd/SfWLzS/xW01S6LDGi5HT5pIzT3zkl8N
T01NPMg9Mx2fyc9ZCEy22TTIMNUSNJuOzfJYXh7Lh8OkDAt509BsngWmqcV0zMtfyzCrw4QM8y2m
QYapp4E81iKHJheYdMF0lWG0ENRk/J8mEz4QjQdBrlCkS4upSQZB3tSkgoJOU4F835pYEOg0CJqa
TW0QpI3pUjA10SD/zNQmgoxOY0FWpvKnHL+C/5GanppokDOmsWAiyULORJMFnaRyOf9NdRJkZRIL
mkznWnmyQVpm8qdplFk0aHoi3zVjOkX9kXkszy+r47yME4xzMo4zzsg4yjgt40jWdPTjpkdGhh3k
goo9NJEPwlG9jIaFo1oZdX3ZKXrRL/kSRg4zdMr7598cjhtb/AHJlSeJINBJZznucpib8sW/8qdD
J3IUTaQQnuzi1J+sXHnqL498eRovhJdD+IX8tCXQSbxg6hJBOhXIJVKaF4w8VJ4n8yYWZCrmOX8u
KuZyHivnKTnNqVzFPO0vx+p5olAxb/LPr3oeC3TetWDq5Yz7E1yoekCOX+kB/w99a0oPxJVIkKme
p7LV82SreSJXPY/nW80L1fNYUD2PVs/rIv5pVs3TxXnEH+5afzswT/l5Kls9l+Ncmqf9vFA9TwSl
eVJOT63cR6W5nA65wTKluZyO2qjccMwTcjpqI/KEdS7XnHzDqNyvern4W1KOf6pQNU0Wp7FwmihO
o+E0VpyGP5y/HOU696dBrt+CXs3yY+XDcugs4Wfx4izmZxE/i8ktmBTbf3fF/BWZfvaj2M7DJq8n
JpWXI+1fROLNDJJ+UP9MXjda/MuHiRQH0eIgVhzEnxskGMgVlcmZWLPv+RM1jzk1lcVMK9PtM9la
Pj9RlK8fL8r3jfE8okWDJ+ETlgtVnvAzfWHxJrNqIp/zx0Wu+szTNo5U+ALc/Occq/JBS77ooKVe
00F77uBlWh28bKuDx/eN8zxihfYetELlQfPrkeIP+1oH7XrplWwOexCSfCCZ8pfgQ9NQ8IdbXu11
kHtkOhTCl1tZDDCSpUPHQpg9I4erOCwwbJEX41w4jMlQfly/hAoflR/YBzAfPA2XWv4xWe/4pZY8
9ixcnSXksZyu2SKyUJP0+SVd+Gje35bymBS+49Pwldov1OpzJrxRc+EjMnhCnv0gTG/DY9Lq8xnw
QDiof2yKHxn3g/onxn+JjjlWCTpMFUrfM6aLBT9M6ZrDPzu/wCg0h0N/HDLNeqG38CP5x/gxIy38
6An/mB4OeUwPkX9MVnXymPxkTXoE/eokVz7EspYrn4LyadEzlX2k5zAonsNM6dQ1lT4697jyixWH
clE36OJHH4twDnlWnMOonsPw1PnDo0N/ktP6k/pjktOhf7QpXIS3lFbj8XA1/ky/fFYPY6J8RMMv
r4c8qUffn9TYcyc1Xqg8h34QC/irSPFjwpdg/+nRFgbJcPA0vNT0ZCb1Agq3DFxWumXwl1px09AU
7hTy4UXpz2DcX6gyyOs5bQkfeaoHLa+Hp6DXayHX+naovEn01nnxycw9Kt+IxTuTG5Xbtj13eHll
Xr1a1xV8xbK+crX/3C6gcndQuWtgN1G1zWi1A6ncnDy3bSltaKr3Oq02Qq23Sa02Uc9vsSo2YM9t
0J7bwlVs78pbvvI2sGJzWN4wljeRFVvL8nazYgta3JZ+h33R9/+ro752GNlPFIcFhk/9ESsNc+Wh
nLwOfpgLIuVRU2mULo0ypVHWdJFExIO0X3XL0QmnSd8Uv/HKh1O/UYr5+0inuq1p8gvyLvIaG/Gb
Bjn5UZ1GZYdUl8zIR4TTmJy2uoTfMYTTuCzw6+LlqZzJupivelOXcE0k02j+uWkynCbTfnfSaupv
wnTVNJHu3KxL+NrqWfD6Zl2adW8jm6VXTfXZpcIfpTRNhtNC6UcJD0N5mmPKYfCHMF4+Kv4AJ/LF
Q5jwhz/pN+qy4AtvXNmaynmMhvNOcX+X+nMrX8/PY35DHZd5Qud+MyXlzkTk8Ub/Mt8c1Kb9RG4c
GTZF5Es1PgvX37W+Hqbzs7Cidb4lmXAmLyR14YI+nMkrRF02vD4662tLXdo/N9P5qemQ9FEw/hT6
mSRCLoSIv7hy/oXyu+0HYt9plfv8crdiR5DVxW0ieFK9yM21c2fwuhe77d0ptHvRy04h/sMveit/
dZLXhUROP/f7HLf36cmRi/r3buTlxY/jfpzXcTJ8Tyfv7xQ5nbxx0vhM3/2J+DepOjfz1k/Ev0Xl
Z1GdZXUW01murVlcZ5KBRu7/8I9wkvNvSRQn2RbtbyOJCdtcNekUXmf6nlrluDG8Dn1FJB+NtE7+
+J4nVc+gOGn9PNv+yRrpqFz+bR2aqkk+fJtMJ/HwPbZ88Ug3+WWRzmL+janSWYhFKWdxJr0L/Kyj
VtMvlht8M0tL13y4PgnTlNeg6i5JhzFWtizAM+F+yq9Em02Hp36J5t9rfXEYf9AA5V4eoIgPp7/4
6U8qQ39K3Un/BXSneGzLR7t0AmTgt1HsJ9keVZ+zcE+Rrz675TOuV4G/TvS1lXs+5t/KNInizL8s
+9fmtgsQXok5LtLwnicA8fDyzb8yAJU3w6tr8OL77/9uASoPR9WBqjqEpYNbfdyfOyfV56vVuSyf
51dGgEun1QXFZVa69P6kGrS+tMO32h++0nDblwnfx3/64+QvfOLfEko+8aF73YMffK/7iuV+jbxE
PvZP+HUPZOlWF/f7H13GhbuqRCFcxtWnwn1TcRnXxDKukQ1vWB0/ifqS+ND4Scw3Jl5stq9PLF8x
iRabHRar2KU0kxctzcJxU6txquV/K74vL3E4yVRMnq9vOxZjlesvv38Nl7Pl9Vey1OJMRX3DnWus
3OI/c/0VLb2J/R1WXz/uSf/f70n9P4GI6r+ESOk5jBRPZqLqrP4J/xekv1TjcoUWdJjQq1bugvpE
waSa4nKV+ms7kZVJuIX0s2TGpNImlS7NkmmTYNUhQ/kVZ0WSbPKzGLOUzDImmquasbNJyTfP/A97
XwIgRXG93zM90zUzNbvLaVDR3SyHGFG5wURdjSAYNYrK9dMk3hwqIEHlSNz1QLmMtyKH8UAjcnig
BiPHGu+DK/EMCgueUZEFBGZ3Z6f/X1W9nu3pnnMvNH+A4fu+V93V1VWvjtfVs6t5EpQWq1OVTlUa
VwWJKuJUJbXisVTAUmUxS7JoSomCO6R6NpZclotnW1ppnfTYpLgt8X6BJSvlgykhRRlFkcQ6TZVY
vvFQqZt10V5ptMCuTDNmjTao9rjyKBWtU4VS0bQhnm0rgRpncowSAiXT5QJRCCaKKVpYTDviEVgp
2p7tFR0ouv9n3CwHvAMvef24X/ISY5en1j6SMQUFCgpr5e5Xkeq1gnZT3VnQfuqtHg56fBWFi+An
VqlJXfCSKvX4RNZUWbWay9WaVYzslqgUjwBiJCLV6klWnpzn5YwQIRWTD8UqSZlqAaDe1Sk01Ts4
5dZ7PliPqJeB8lQTioWLGD1l+0bE+gT+pt7ywcW8coUn3t4RXVhcRKlSU77Uhtk/X77QVmblLaR8
6qaunCcPq6Ri5cksIsIjYkohe/mArkYLRzVDPuMW6wchSk2xaKlUolDsmpgVSiB/8f5ajXjLzi/8
Tyw1BBfeVxpTXDyJF/4aEh4c85hqP9dXaurCbQUtMW81KxQtMNebtPcrOiRaRM5FMbNKbPfAP82Y
fDMEPSKiCHqKIiX00gg9m5FvRKAjiJlZFEegB33BwConqmCSAnjMjycwObDBemCDNdO/NI/9rGex
5XUPZyoT4oa0T/tscUhigKKWE+KNmLpQxvZg2fbQOf54vyRppGSPoRKf7iV91Ce3LCvk8JQ5pmua
R3r2eDUe05a649tCOxfvDseSRMoJMbQMteNCVBOjuFs88JPHJsbq1maMWEjLhVqlprZpZOAvX+6J
0gOBCk1MFzJm2Ie+2+ikHkutA+8/Hnj/0V55/4PvP9aFFfLd4FCVWNuUeypUr/SI9xQiijPB6TFd
oXx/oYziLSnKZZ+OmXq5tdcq3kQTSg3GYi50q/jQHCkp91ixHVZDIsSOKxltUxRYGJXRtqUiQumk
sEyQcaldaZaqSFDllpJxsVJWMOuUZc0rzcRiWEF0XZHrlCfh5hKVFWAXViaoiL36CqL2qkVgLh5y
xLdhNVsjMNkkti2ZknLdUmi3knK5RUsOIONta7Km54Ildc8FC+3PBWMJzwUdL0bKt07VQ8JC6yGh
Hn9IWJj+IaHcbin/4X8emy4Q2N931lwY/2bfQ9pt8ifgF7GnfVPZ0/lXakXehb6p3oXun3fPrss/
X6sGXk44hLA/YU/CYsKWhJpCYwfhZsK1hCsJFxPOJZxBOIlwJOFQwgGEvQg7ELYi9Cj0VxJuIVxH
uIpwCeE8wpmEkwlHEQ4jPJWwN2FHwtaEXoW+nYQVhOsJVxMuJZxPOItwCuFowuGEAwn7EHYibEOo
K9R3EW4l3EC4hnAZ4QLC2YRTCccQjiAcRNiXsDNhW0KfQu9uwm0SnT+ffGH+cK0fvGGSxOTfPx1D
3ygVP428S6BL3i5fj17dUv/sEHZdeKPySMIhhP0JexIWE7Yk1BQaOwg3E64lXEm4mHAu4QzCSYQj
CYcSDiDsRdiBsBWhR6G/knAL4TrCVYRLCOcRziScTDiKcBjhqYS9CTsStib0KvTtJKwgXE+4mnAp
4XzCWYRTCEcTDiccSNiHsBNhG0Jdob6LcCvhBsI1hMsIFxDOJpxKOIZwBOEgwr6EnQnbEvoUencT
bpPo8sjwOuWREtN7JLwxPMrXo2dab+SnKm8kHELYn7AnYTFhS0JNobGDcDPhWsKVhIsJ5xLOIJxE
OJJwKOEAwl6EHQhbEXoU+isJtxCuI1xFuIRwHuFMwsmEowiHEZ5K2JuwI2FrQq9C307CCsL1hKsJ
lxLOJ5xFOIVwNOFwwoGEfQg7EbYh1BXquwi3Em4gXEO4jHAB4WzCqYRjCEcQDiLsS9iZsC2hT6F3
N+E2iS5v5Kcob5SY0RtDn/p69EjrjcGVyhsJhxD2J+xJWEzYklBTaOwg3Ey4lnAl4WLCuYQzCCcR
jiQcSjiAsBdhB8JWhB6F/krCLYTrCFcRLiGcRziTcDLhKMJhhKcS9ibsSNia0KvQt5OwgnA94WrC
pYTzCWcRTiEcTTiccCBhH8JOhG0IdYX6LsKthBsI1xAuI1xAOJtwKuEYwhGEgwj7EnYmbEvoU+jd
TbhNossbgy8qb5SY0RuD5/p6dE/rjYHuyhsJhxD2J+xJWEzYklBTaOwg3Ey4lnAl4WLCuYQzCCcR
jiQcSjiAsBdhB8JWhB6F/krCLYTrCFcRLiGcRziTcDLhKMJhhKcS9ibsSNia0KvQt5OwgnA94WrC
pYTzCWcRTiEcTTiccCBhH8JOhG0IdYX6LsKthBsI1xAuI1xAOJtwKuEYwhGEgwj7EnYmbEvoU+jd
TbhNossbA8cob5SY0RvZmz4Mjem80fib8kbCIYT9CXsSFhO2JNQUGjsINxOuJVxJuJhwLuEMwkmE
IwmHEg4g7EXYgbAVoUehv5JwC+E6wlWESwjnEc4knEw4inAY4amEvQk7ErYm9Cr07SSsIFxPuJpw
KeF8wlmEUwhHEw4nHEjYh7ATYRtCXaG+i3Ar4QbCNYTLCBcQziacSjiGcAThIMK+hJ0J2xL6FHp3
E26T6PJGY6HyRokZvdE40df9uLTe6G+vvJFwCGF/wp6ExYQtCTWFxg7CzYRrCVcSLiacSziDcBLh
SMKhhAMIexF2IGxF6FHoryTcQriOcBXhEsJ5hDMJJxOOIhxGeCphb8KOhK0JvQp9OwkrCNcTriZc
SjifcBbhFMLRhMMJBxL2IexE2IZQV6jvItxKuIFwDeEywgWEswmnEo4hHEE4iLAvYWfCtoQ+hd7d
hNskurzRf7DyRokZvdG33Ne9Xzf3z3aynfEBxHXxSHw8zno3qPlGXHbRBPdzo4fw9xD4sipRC/wt
YnPQ/9/13a518L2NzxZ8vsZnOz478fkBnz347NU66BFgFT7Vtk8NPlHHpzbJJ1aHeoy0/WM6uOmw
m+6PnsyuJT/WlWbjuvMcLUckrjvTkh2fhU132pw8yzS9nuelzCvDMdnY9WyPzXCcnuX1MqUlua+H
0K9EP8kpn4z3l2N9Jb2/LMuQc3myvbcGlqVeZUpzrbR1lEM59SyPy3hfjZBHk+TT8PzifaLRfKCB
bVYvH0iTf4PyaYI6b3SfrGe9NFpdZ8qnqXwom3zqV78p54kfvU+mu5+EdWK5/ySPWiF6n5MrxOZq
kQP5/KTy+TGWqQnzSb9C/Onf337P60A+P618fJlWiP8D93ggn59emfZzPk2zQtx/+bhWiJr+7rsa
rRD9S+UKcTM+32p1zw734iOeG9LzQl1gumeF1jNAO0/ybFBP9pwwm+d+jf3sT7PlkywtR542n2Q6
xTFZxaG5PofK9hldirSsn2tk8xyqIc/Zci1PhnyT1HX9V4jJ2q4eZUparnrWV2M9Z9tvZUqT70/i
mcb+ejZSX19M/mnYCrEx/Lux66ohz6Obuu20Bjxnb6LyZJVXlmX+0dV1juWnz09rhZj53twrRM90
D9aIxWKF6FuBY8rx+Q8+n+PzDT47tIR9Zt1aLzr3mmtsH+f6UaC1ZqSP7lxDpvqYadCkPpRpfZnF
2lNPtR7NhWtJ9phzRas8SWzJjsuUnnJ9mG6tmCIt533vFLak414Wa92U5cmlLMnK47anXh9msaZO
2adzXFfXa68q1Tyc7biXy/owl7E0l7k4h3xzurc018l6HG6qmMVxjR/F+jnxHhr+BLEx12P1absM
nyZZjzUgzyZfHzZ13JIm/2Ze9zTefaXoE016f41wj/V8gviwtlDzeLT4O4n2301p/SbMh3x3+xZp
HTSRw0uEHxJ+Rvhfwu8JKwl3E/6gUKwupd5HGHFgFWG1A2tSYDQD1qbQhLqlY470VDoVWseZGY5L
lU523ZmeSjsxU3o9zxNeVa98Lcx0fqr0FHY91/NyzD/F+Q9pj6KnPKf5Nc1bVKRs4neyLvXdLL8D
LvuI52vgH3z3eRBVaTHww30PeGEzPvX9VRNv3X4DPt+3yFtF/cOEPt+3yhPT4hGXLt4XP8T3rW5F
UrYn9MLmNeV75F09ppb06bwu0j/yX5UQ7Zh1x6GnF/vf9C/zaI500vL8Vf4dusNucXn+CiNf0xLq
Q40qzyeMKPaRJGX9uvwrlc61XeuZb8ryNFY5Mx2Xwp5zuep5nWzvQ2/q6+SYnrF+mrqe0tdPxvFD
9KmEfqg5+tzTxllem81+nOyzi4w7kq5gVHmK/QuNjd5k6fh4RfpfWauk52t0/jx2rldLzDfh/Dls
es5jQgPruKHHZe0zuR5XT19L2aea6vrNXZ5GOi9juRrYDrmia02SHWYeE9Cn0vbJe9lbrjFBs/XJ
OwMhD2ndkR4fF24PnG4fa3RnHrMDsz3Oc+l43SrHjMBaV/70kWPX9KCe89jQwDZJdX7WvtNE18+5
PA0tR33L08zXbbbyNDC/lO3VuOXLPDagT6V6YiD75C3B/t4U6bJf3xyclvb8G4Kve5Okxc8vC7G0
518fGqRryZ+UyfP/HLo+5zEhx7putr6eZf5Zl6eZylXPeavJyv+jq59muk6W95N5TECfsvczV5+c
GlqTtk9P5lqytPj5k/jJSc836fzr+I1px4Rr+Ctprz+RV+U6JuTsM03sU/vdhxu67mmmemu08jRS
/dW7PE00NmRZnsxjAvqUriXvc3Jt/sfwL60+6TxOF+kTwlOdY4puP//q8Mq064xx4dq0Y8rYvBPT
jglj8/6Y65jQ1G2Ts8800/zxky1PduXK7OvwFaevJvjaVXnPpX0GdmXenoTzTMf5V+T3SeurY/Iv
SOmrSXbcNE3uudl9V+21zaP7Xka4nvATQuee23bCHYQ7qf4de2++vQ507r1l2oPLdi/O0o69Nz3V
3ly22Fh7dKRde2313LNzpWerHZhy7y9bdJ7n7Fc5op4qPVO+2V43+XG57bV9LffZ5tA+23yJ832P
eODL3kq5v7ZE3wW+V+6rrfRWa9ZP0in2f+zbJHzS/nYjdLF/gb+N3F9L/pNzsA72D9Ed+26SmzQn
Xui/z7W/Rh/5rP5s/4dJ99es8wfUY38tRZ3rqdoiW3uuOsNxKfdv95eub7lyteeYn17f6zSR3eVH
zuMa+7qZ2isxPfPaAH3K3td0G5d97njjLK+zT5Jf6CK9p3GHM81CTaR3pf21JMfItUFn1iphzeFc
WxTZ9tccx8nz2zfD/lrTtlHD16MNzCfr5131rYccj2tweZrouKzHnkZun6zHwuzyzzwmtM+wv9Yu
xf6a1Sfb2PbXnMdYebSg/bUkx8k88mz7a448dCuPUGBtqjdF5djF6rG/1li+1Dht1fjHa1n2sXrm
22TlaexyZjg/Y3s10XWbfexJxMxjA/qUq7/Z53t/hv01b/r9NZ+ZYn+NxhZfbYglu3b8/BrH/ppj
XPFVNWB/Lcs6bbK+Xs/zm9yXf6zlqW97NfP193v9pM8345gg+lSy/hjvk/sc+2vOPrknyf6abUzx
7U6xv2adv5PfmCwtfn4lfyXdmOT7vhn315qo7X5se9bN5suN3beaqb2ard1yvI8s6yfzmPB9+v01
33bb/pp7fV/s+5b21xLtded/k35/zfd1+v0131dJ9tdM2/lfNmB/rYl9qMn7VK7laebrZbrPRu7j
mX39S9pfc/hR3Ne+oP21JP4qfe0zx/6a5jh/W/r9Nd/WXPfXnnzSNJPsrz1N911OuInwS8LvCK3v
sO0idOyj6c7vsFU50NoHc+6bOffJcvzOWqr9L9d32RqKZga7M91h13Pdx6rvvpfTv1Ogaz8r03m5
pqc6PsVxGcvTNDq3/bWdmIf2yT22uR70A89euc/2sBd9AR+x1/a06AeiT3hr5H7bRrl3FtUSf1KI
+O5aDOlH+lum+ikgon8aLfznxJ/Dm1rC3pqMq03/3fGxx/rU3WOxf4//vWTP8ePnb/8Rfnct03FZ
2vVmvl6280zKempgvg0uT2OVq4H55FyeJi63ozyZn5Vtz/DdtS/TfHdNpFfQd9ec6warT39ibPQ6
zrWvC/wf2r675kiX579He2tJ8pfnb2zA3lqua8JGOt7lM81Vnux8pul9trHK09Dr5nh+vft6E5Vf
r9/5mceEjbS3liQWkH1yHe2tWR9nn34nzXfXrDzeyvDdtTdoby1JGXQrj9cy7K290oh7aw3smzn7
dGP7mCO/epenicpXT19usnJmXT/NVN6c26t+5co8Nrzi2FtzztcvB/unfU93TXBasv4aXy+syvDd
tZWOvTXbdeT5/0jy3TX7+S82wt5ahjpvtL7VSL7WTL5T//I08fUavW81cX02Wnkap14zjwkv2vbW
7B+rT6+gvbUkc7Xsky9k+O7a8+n31vzPpd9b8y9P8d01K4Z4tgF7a83tuynauMl9uJ6+1uzlytAe
/9+Xp3HaK/OY8CztrSXp83Jt/gztrZnuuVqXPzMnw3fXngqvTLvOWObYW3OuU5Zm+O7akkbcW2vk
ttrvfT2Vz+znebyJ6iezry9x7K3ZPtLXFtu+u5bM155Mv7fmX5Thu2uLMu6tWb9HW5R7uPejwNcF
J2lMWrp5Pwst9n+Y95jWw7sp9Kh/S95S+tmRKmV93gKtyL8+tFyyn3u/xf/W7zak34Gtdwlt1Lvw
cSl+H/fdsg7nxMuQp52tddFP57cFii4fN+GS0WNHinT6bfH0kyyL9NnIc3bKPLc78vzFpeGigVeO
u/iyouFF3Y7pXZef9Tt29ErkV5kyv42u/EJFZ1w09tKi4Ym5qZ/HXuQ7L7TRd17K3KqSlO6sSy67
aKyzdPHfJS5/VqdvZWhjO7FXupK3Ijy3nZbiGtE0NdC9WzdbmdU3FYv9RSp3f5HKHZg69y0p68OR
t9ylLfbfTHnfTHnfnCbvalfe3Kqd7vbf1a5897a4Dwvf7aZVtOjXqoXWI9jOEyiIBC9Evpdql582
8Jxu4iLaBVD6wAkXjR/VvYeW6o+ng/Zzj+npCorug5qHadVhTxyR8gTrj9qlliWJX78oeKl3cf4K
72LBArPzVwRma8XBhwPn9dMEehf3S1UPJ1M9tDAqAsPFR+sSfMWbp/c4pq6Gi0PbVE6hbVnk1IX7
cH53m4cVhzuo88Mdsjk/PECeb7t+3iXq/LxLsjk/bxrOt3t4cf5CdX7+wmzOz39dnl93fTrekx8/
/gM02iF0vH32zdPGo/z9zZWtpJ+Kj3KqLqcfqSW02BytlTjB10u7g3B2SPPckd/L217zeHdo6f8F
qjRvgRmp1kLwYxYztcoaLQBaWmvWaKEa2KKwRSUtAY1FtUCNVm1qZbVaCJ2WgVYqWggardUCoKVV
Jmy1KGjE1MpjWgtQPWZ6K8T/WoU06AWmGYlZkF+reUtMM6p5S82YkqUmrutlpqmkaZbVaD4M1ZqW
H9O8uhmt1nyFZoWSzKyExP+oupi4pbIqTTcjmhaOaZ6SWETTS2JKlEYi4qJKmJUQzCzT8jD7eMxy
KPyvhaF0s2wfrlqhcV3UzF6Ur1LxKHgh8Qh4AfEKcJ14ObinUgsJXrZHAw2ic7IfNM94yQywbpL5
wFqkayIcqnlqJegKmIICBYWoatxbEW62RNFuEdGAkvYDRVtw0OOrsMYjfiK4TrwEvABc1lRZteYp
tEQFRIklUL+e0hgJOIzHRGPnCRGtwb2aEVKxGtE4laTgRWibilrZSIVmWVS0TbmSIFFplMeKJozi
EvCBPNm+ESgT/iYOlRcT/yOxVphr5UWUKkURxUWi0k+Qn5W3kCDWlfPkYZVUrDyZRUR4REwpZC9c
ArcTjmoG3A4iokQp/AWnKoHMtAKzQgnkrxWa5TUaj2p+4X8lZrXkwvtKY4ojU034a0h4cMwj+xto
qakLtxW0xLzVrFC0wFxvllerzofeghZBjxMdp0oL1gj/NGNVoo+iR0QUQU9RpMSsUASlUoSJjsCq
RWtHJHrQFwzM6FEFkxTAYwLCFfahKhudZByEHP/qekViT1G9x9al7D3N1QPtPdPeY6knJ3RxR++3
DwyuISM+mCSOM45ByDlEOQYw9/BmG/xcg6Nr+LQNrXXDbd0QbBuY6wbrugHcNqzXDfW24d+aEnJt
t/3yD6XVSqPC3cQd1BApsUipJLhhTzUR3SLMRQosUkgE4wb8gNWIMXGfxJIYYSQRSysJK1JgeW5Y
YmFFIhZaSNcrsJDKwaIKdSqnjnIH5Phcpvq/8HKBJZUKCzEQqBFDDB3CSaxKaFSSfYPa5rlS1YYe
qzELE1rVqNaqMzeubFPh8QU1cH5FkY+GKSlcg7E8ppWWFYg5p0ZjGCJKyzxyPoIqqdBKy/Evrkow
0leQKheqoJJUmVCMVCkUemokQUVJ4eIVmidBiVJZqtKpSuOqIFFFnApzfz46r6UwCZJk0ZQSBXdI
PZZalmOkw1XrpMcmxW1huDQtWSlcTUpRRlEks0KsPqRCrmalTgozN3pwgV2ZJtWCDlUSVx6lonWq
UKpwNWboCk0MlkqgxjGwViqBkummWIIIwUQxRQvzakzLqHyx3mB7RQeKZjveoDOJ+blKzNrlHiw7
ZF4Y2D0RxZngGGjl1QUXF5TlkqJcXj1m6uDKnzSPUsqDxCjvVhGrfiIl5R6rDjDPC1eMK+mVVFuF
UemVlooIpZPCBCjbz6400+7pcVVuKek/SlmN7pRlzSvNxGJYzlZX5DrlSbi5RGU5YmFlgorYq68g
aq9aOLAYDKJWk2i2RmCySazmwgKvpFy3FNqtpLxANCw5gPRLMfdiCtPKFRWzdBkNeFF4p7AV1KqZ
u1qMjaYWUdRTq2IzMQVi7saKV8yGhTHM50EsS+D1WL6yiJi9Ms3mXCwRsZwQ+QleIHhU8RLBTenO
mJ/E4ki5s8eUQg2QXlLKobH2kUq5MFY5UkWSqQKlonI89hSihuV/UuAQD7ME8vLoJEpwGRnMJAgu
J86oinhsPCwnVhFOwEOkKBORRnOLhBJYwlnO5HcmhawAM1nVJAjUpKeAhBhVPeSZYrEqFrNxP63Q
4q0AP0URCqi9oMTYLZSYLj1quoRD1sSdtLTOSUvsThpVlCU6aYXyzBLLM1ncM0syeqZanESrZFHE
+rdSBUQltThVrHQ9KAqCMbnoBY0oKte6imK1oKEh5KK5WhZGUL1adZ5auUYQBccyPIDhOiLmjliU
VuUxGT3iDgvkmh2Lb11NILSkl1YKaGV8KlZSlhQrfN2SuohQvR4KjUVkJvwgoiJqZoqORqIgVq3a
UYjCqOiOlhCBN6MovFCE5HrMFp/r9sjdQ6IUoaDyO5dA8KLcM60wpUAvFU8LzIgaEJqTJxQih4Kn
vvOECkqouoRKTaxu2RCxJE0Ub7zEdnU0ehKXsDtMojsl8zabMzpc1ebEDte2HN7WDRI7h63LUEeq
61y2Dmd1wv0e7yUfI7wo/V6x4m9sIpZzBWLRpuZCf6GIsmlphyWneIRAc2EZzYVi2PXIYVeFGB6x
9pezlxBMDNUFERqdxYjOojahW9OgHPitEb2cRKr5TfIyBy+tbao5LP2EJkWFTbgnsSxmNPskJp5H
yjVB3SRmTWlMdBHb2lg4dN2U1sBJjFZamLkaOIUdeFhx4GHFgYcVBx5WNPvDigMz8YGZ+MBMfGAm
PjATH5iJD8zEzT0Tsz1qgD2ATYvN/+aC862+2VpRfrl3cX55ACx4gXdx8AL53twFgUO1flpx/nSJ
6d8Wk++RFvRjm/Xux/Spe+MseAEbr7UXb5wpDF5gvK7ylJjhDbSCfsYM5NfDnp9xqMpPYfAC/9Uq
P4kZ8/P30rsd08+en+91lZ9C6PYqP4kZ89O3IL9e9vz0q1V+ClGbb6j8JGbMzzsz2Rt3tuPFG3fj
43U+Xjvq/SsPEm+aXnRl0cTLrhp/2YSLJl4z4TL1np2zla33bwfnz/G+lL/Cu0kbzAt8T/Fjfeu1
waH1/l6hHf7zwJ7wTwu96X8M7Db/mtBS/xaw6/zbQ/cbeWCXGa1C04weYMOM7qHrjMFgvzFOD40x
rgArMS4O/cG4Eay3cW1oiHEf2NHG9NCZxhNgnYw5oQHGCrBC43Ec+zrYwcby0HHGv8FaG+WhnkYF
WL7xTugY41uwoPF+6EhjD5jP2BzqaMTANOOrUBFj2uBg1KgMtWctwCLGvlA79jOwPUYs1JYdDraT
+UMtWSewHSwcKmBdwb5jrUJhhtIH/8vahYKsH9hX7LAQYyeAfc46hHzsFLCt7IiQhw0E28K6Bk12
BtinrFuwlp0Nton1DtawIWAfs+OCVWwE2IfshOA+9juw99nJwT3sIrB/swHB3ewysH+xQcFdbBTY
BnZGsJJdCbaenYWSjQNby84JbmcTwN5lQ1HGa8HeZsOD37BJYG+x81HaqWBvst8Hv2bXg73OLgp+
yW4Ae41dEvyC3QT2Krscd3AL2CtsdPAzNgPsZXYF7mWWZGPB/gK2ho3DXd0OtppNCG5md4GtYhNx
f/eArWTXBj9h90k2CWwO2D/YlOB/2FzJ/gQ2H2wFuz74EXtQsjKwh8D+zm5APTwM9gK7KfgBexTs
eTYNNQJvCj7Hbgm+xx6XbDoYPCK4nM1ELT0J9iybjVpaAvYMuy24kS2V7Hawp8CeZneg5p4Ge4rd
iZp7RrK7wZaDLWP3BNex58CWsvtQmy9Idj/Y38GWsDmo1xWSPQD2IthiNi/4DnsJ7Ek2H3W9UrIF
YKvAFrEHUeurJXsIrBzsCfYw6v9lyR4B+yfY39ijwTfYK2CPs4Vok1clewzsNckeB4OPBx9jT6Cd
3gRbCPYqsUVgb0n2JNjbYI+yxWi7dyRbAvauZMvA1oE9AvZPyR5mT6E910v2NNgGyZ4B2wj2EHs2
WM7+JdlyMPSt4F/Zc2j397QRkj8P/j7Yg+wF+MAHkv0d7EOwBWwFvOEjyV4E+1ieM5/9A/7wH8nn
sZeCL7FNkq0E+0SyVWCfSrYabDPYXLB/EFsDtkWePZeVg6OXBx9gLwdfZFuldQ77J/xom2SvgH0m
2atgn8v0+9lr8K4vJL+PvQ7/+pL4G+BfSfYm2NfSei97C373X8neBvsG7B6w54i9A/Ytjhwh1btQ
34HdzdbCH7dL691sHfj3YHeBPUtsPdgOyTaAVcoj72IbwXeC3Qn2DJjK9072L6hdkv0bbLe03sHe
gy//QPx9cIxtwdvBniL2AdhemX47+xB8H+X3F6hlUIJ9BBaR1tvYx/D0KuL/Aa8mvgm8hvgn4FGw
2WBLwFSOs6AWS/ss9ilYLVk3g8eIbwE36fiZrCL4ZEAjvhXcQ3wbuFceJfQM6EVSC/4ZuC75dPZ5
8ImAj46azr6A8sfVl1CG5Leyr4J/CzBKuZV9DRWQ/BbwxyUfQfq/0MG4+gYqJPk08MfABfsWjNMx
09h3UGGwm8EWgo2QfDt4Xjzfm9n30PmkheUmWB6FRbAdYAW2lEpoMQfdCPYI2AjJd4K3jB91I9sF
3cqmd0O3BrsB7GGwEbar3cB+gK2NTe+BbkuqDOohqQTfC35Q/MhSti/418DPbDoC3c6mq6APTrja
9bA9SDahqqEOsaX/mdUEF2ANaLdEYWmfYKmF5TCb5U8sFpwfODzBYsJSGNdToefFNdkCGmxFDpsH
tp/bLFMC3uDcQHHCUVMCOmwdSE2GesCmfFAdE46fHPDD1slms6dOQuqcQCfJDLDOrnQG6xEuawDW
Lgm26wLB4P2BIx1HXhcIwfqLuL4W+j7SQnGoo5KWbYTtnDCO6mqzXAPLvdIieB740a6zrgnkw36M
5BPB75G8Ln1ioAC2Y13nTQy0gL1bytL8Eel3x9OFbgndPcmREwKtgncFeiRNaY2UnknsbWDvlfSM
tkjpTepqqDtJ1R1zdeAgWPu4zh0P+x0ue13qz5DaN2lKO6T0S3HWwUg7Dmwc2O1g7mPGBQ5Byi9T
XHdc4FCk/ipFWnukHS/5WPC/SJ7p7+DgVTj2NjrvqsBh4CekPPJwpJ6YMrUQqSUpUq8MFAVnB05y
pdTFH+obe7b4I7+176n8niL+yHvQ3ytvtYg/8ob5p+VdJ+KPvA7+NXmniPgjHPVvz2sv4o/wJqNV
uEbEH+Fyo3u4QsQf4UXG6eG3RPwRvte4OPy8iD/CNxnXhh8V8Ud4ojE9fI+IP8KXGXPC00T8ER5h
PB6eLOKP8JnG8vBVIv4I/9ooD18s4o/wccY7OALxR7ib8X74bBF/hI8wNocHivgjXGR8FT5JxB/h
dkZluJ+IP8ItjX3h7iL+CHMjFj5KxB9hP/OHO4n4g5ssHC4U8QevZq3Ch4j4g+9h7cJtRfzBK9lh
4RYi/uDfsg5hLuIP/hU7IsxE/ME/Y13Duog/+BbWDTkh/uCIP7iMP/iH7Di+T8Qf/N/sBL5bxB98
AzsZeSL+4GvZAL5dxB/8bTaIfyPiD/46O4N/KeIP/io7i38u4g/+MjuHbxXxB1/NhvLNIv7gL7Hh
uA7iD/4iO59/LOIP/gL7Pf9AxB/8OXYRf0/EH/xZdgn/l4g/+FPscr5exB98KRuNayP+4IvZFfwd
EX/wRWwsf0vEH/xvbBx/Q8Qf/DE2gb8m4g/+KJvIXxHxB3+YXYvyoN34Q2wSLxfxB3+QTUHJEH/w
+exPfKWIP/g8dj3KiPiDP8DKUEbEH3wOu4GvEPEHv4/dhNIi/uD3sGkoLbyJ381u4ctF/MHvZNP5
MyL+4HewmfxpEX/w29ls3AHiD34buw13gPiDz2a38yUi/uCz2B24F8QffAa7E/eC+INPZ3fzJ0T8
wW9l9+CuEH/wW9h9/HERf/Cb2f18oYg/+E1sDu4PXsdvZA/wRxjiD34Dm4c7RfzBy9h83CniD349
W4A7XSXZg2CIP/if2UN8gYg/+J/Yw7h7xB98KnsEd4/4g09hj/K5Iv7gk9lC1APiDz6JPYZ6QPzB
r2OP8/tF/MGvZU+gRhB18GvA7pVsIluEunlLsifBEH/wCWwxv0vEH2BLwNBX+dVsGeoLUQcfD3aH
ZOPYU6gv9Fo+lj3N/yLiD7BnwBB/8KvYs6hDxB/8SrYcdYi+xa9gz6EOZfzBx7Dn+UwRf/DR7AXU
5weS/R0M8QcfyVagPj+S7EWwj8EuB7tFssvYP/g0FYfwS9lLqOVNkq0EQxzCL2GrUN+IQ/jFbDXq
e7M88iK2BjWOcYRfCFZGrBysQrKXwbaC/QGsVLLfs3+iFbZJ9goY4hH+O/Yq2kPGI/wC9hpa5Auw
88GmEnsdTMYl/P/YG2gdxCV8BHsTrSPjEvC3wBGX8OHsbbQUohE+DOw6Yu+AYdThQ8GulRHKYD6E
vYtW+06ytWAyPuHnsXVot+8lP5et538UcQnYBrBKsHPAJhDbCLZTHjkY/GoRq/CzwcYT+xfYLsn+
DbYb7CywccTeA/sB7LdgY4m9D7ZH5ngm+wDtLeMVfgb7EC1O8Qo/HeoKEa+AfQQWIevH4FVgvwEb
I9lp7D9ofxm3gG8Cl3ELH8Q+4aNktDKYDwQfaUUuUJ9C1YKdCnY5sc1gGJ/5ALDLiG0Bo/iF92cV
/FIVv/BT2FZ+iYpfwLeBy3iF/xr84rpYhp/MPuMXqfgF/HNwH9hJYBfKSEbwL8D9kpeA/wFcsC/B
DLATwX5P7CswimugvoYKgJ0A9juKagbz46EuUPEO+H/BKb7hv2Lf8PNlfKPUt1Bc8l+C/x+4YN+B
yaiGHwc+QsQ6YNvB4vEN78e+58MpvhnM+0INs6kdUAWk+kANhRKsEkxGN7w3+BAR84DtBIvHOdC7
oFuB9QI7jyIeoXZDId7hPcHOTYx3eA/2Az+nLt6B3gNN8Q7vDjVYxTvge8EPkrwb+Nlxvg88HvdA
R6DbgR0LdhZFQEJVQR0MdgzYbxMiIZF+NKxnyvSjWTXYIWTvCnWGVILXgNviIViisLQHOwrs9Hhk
NJj/gtXy39jjIlhisBwe10dCnwYtmAlWmFAicUQX2AdJO3hAAy+ilCOgBtqUB8oWJ8HihaUYrDPY
qbaIaTDvFND5AIqQ6mw+2DrGdUfo/lIL7gfvRCkdoE5JEj2JFAMpnSUvBv+1LXYSFgbLEWA/Bzs5
IYIStgBsXWyWIlhOgkWwIJgjjoI1BGs8juKF0CVWHAXFoY4idTjUiSmjqsH8sECYn2CLp5S1fSCP
H++Oo2DPh/0Ym+VQWH5FFqEKoI6Npx4C/csE3QI6WTw1mB+MtOMS0oStJWzOeGowbwd7P9gFawXW
w5H+M1j7SqvgrcFd8RXsbWDvZbMcBEufuEXottC947otdO+ESEvYDoItWTw1mLdBWi93DMZbw94T
dsF+BpYk3kJKO6T0S7C1gq1H3Cb0wdDH2Y5oCUt3h+UQWFLEXUg9FKm/krwFeDdXDCbs7WFPFnMN
5gVIOzZJ2mCej5RjKEWow6BSxF9IPRypJ9osebAcnRCRCVshbCWkwlBdXVGZsBfBniYeK2snf6sD
03z4W4yo7K38fK3DLvHZpXXI36UV523RF7hsA32nOW3hb31LXLZFvh9ctmv8R7lsv/EPd9k6+0td
Nub/q9PGv/O/5LK953/fZVvt/9ZlW+w3XbYHjJYu2wyj2GWbavRw2a4ySly2C40zXbbzjBEu22nG
pS5biTHOZettTHbZuho3uWwdjNku26HGvS5ba2O+yxY2FrpsfsPVvqGYsdxl22e86LLtNNa4bN8a
r7lsXxjvuGwVxkaXbZPxgcv2gbHJZdtobHXZ3jW+dNneNL5x2V4xdrhsa4zdLttLRsRl+7tR47It
N1y+FnqK6S7bYsZctidYyGVbiMOctoeZy3dDD7K2Lts81s5lm8MOddnuZYe7bHexn7tst7OOLttt
7AiXbQb7hct2K+vqst3MjnXZbmSu/hYqZb1ctj+zvi7bVHacyzaJHe+yXctOcNkmspNctgnsFJdt
POvvso1lA122K5hr7AyNZqe7bCOZa9wIXc5+67Jdyga7bBezc122C9l5Ltvv2VCX7XfMNRaHzmf/
57KNYOe7bMPY71y2oewPLtt57EKX7Vx2scs2mLnGxNDZ7HKX7bdspMt2Jhvlsp3Oxrhsv2FXuGyn
satctoFsrMs2gI132fqzq122U9gEl+3XbKLLdhK7xmUrYde5bCcmsR3PXPNC6FdsShLbn1y249if
XbZ+7HqXrS9zzcmh3qwsie1Gl61nElsP5pq3Qt3ZNJetG7vFZTuW3eqyHcOmu2xHsxkuW1c202U7
is1y2X7BXHNo6Ej2F5etSxLbEex2l60zu8Nl68TudNk6srtctv/H3HlHSVVle5jUtat6FzkJHhAK
UTFgYMwJxohZRkcdB3UMYxjF0XH0GRBQRIIIApJzRnLOGQQRBAFJElRAAUFBySDMqb33qvVe7VPr
3NtV+Oav3/p+a59zL9109Q2fUgM6qi4BnRyd+h2fXx06q64adFHdGdBVdVWhm+qqQHfVGWfXQ3WV
QV1v2E5dY+ZXgt6OTl3/5Vd0dn1VVwH6qa489FddORigurKQfj1UQ82UgUHemdIwWHWlYIjqSsJQ
1ZWAYY7uE9UVd3RxGO49NwR9fZcPIx3dKNXFnN1o1UVhjOoAxnrPLaJmEvl5MM7R6evRYjBBdUWd
3UTVFYFJqiusOn2+hWCyo5uS3sVOOroToK6fbTdNdb9B+n2POo/YcZjhnTmmZhKxozDT0c1S3RFH
dxjUtb7t5njP4xDMdXTzVHdQdXqvAzDfO7MfFqjuV2en7lNs96nqfnF0+2CR9zz2wWLV7VWdXvcz
pN+r65mfYImjU/dYsT3Obqnqdju7Zar7UXX63HY51u2CLxzdctXtdHQ7YIX3mDtA3UvGfnB2K717
fQ+rVLdddenr9D7bYLV3ZiukP89wzah74th3zm6t6r51duu8x/wG1qtui+r8X4MtsEF1m51d+j2+
3msTbPTObIRNAWY2q+5rZ7dFdRtU5/8arHfssx6+Ud06Z5f+nEPvvxa+886sUTPJbmuAddtU95Wz
2+7da3WAmVVqJtmlP9dxrftBdStVp9d9CTsCzOz0zqxQM8lOPXuKLVed7++PPtYXkP680zWz2zuz
TM0kuz2qW6o6vddS+Mk78zmkP3fTM0vUTLLbG/pr9Jl3TSK2GPaF3ncx/KK6RarT6z6F9OeLrpn0
Z+r+81kIBwqw5qDqFqhOr5vvnXGtOeSdmadmkp169hqbqzq911w4Evoc58BR78xsNZPs0p8F+481
G46rbpbq9LqZ3hnXmt+8MzPUTLI7EfpYM0A9A49NV51eNz1aSHXTVOc//rRoYe/M1AAzUwLNFMn6
M3xyNP39gJ6ZpGaSXbHQx5oUzfPOTAwwMyEaCX3sCdH0dx7+NeNDr3HtEVXdONX59xkbjRVgTfo7
Hf+aMWpNskPVjVadf+/R0XjoNaPUmmRX3LtupHcm/PdyZFS9D4uNUJ1/nxHRkqHXDFdrkl0p77pP
As2kv9ML/7UZFi2T9R5Do2Vz/D3TxxjiPUZyppzqBqvOf6zB0fT3ouHPd1C0Qug1A9WaZFcx51/L
gVH1jjc2QHX+fQZEK4Ve0z/0Gr1HP+8eyZnKOTiOeu8d66s6/z59HPv0iZqsz69PtIp3prd3xrVG
vduP9VJdrn/G9Xn0dJxHz+gZoffp4V2TnKmW8/PvEVU+RKy76sLv2z2a7hz513TzrknO+Pfp6p1x
rUl3QLL/2nbJes9ErLPaI9nVzPm5do6e5Z352DvjWqM8mlgn1WV//p2i54Re09G7JjlTK/S+Hbxr
kjPpLlHuP5s+yvkxknum+4/h92jv3SM5k+5V6Zl23hn/ubSLXpDzr9GHas9kVzvrfduqPZJdumuW
+79HbaMXeWc+8M6EP26bU7LnxTnfs7V3z+RMuv+X++9T62gd1bVSXfbHaRlN9xbD7vG//iVR/jcf
Xe52iWIOd/tD7W4Xv02728UrO9ztAw53e63D3Z7lcLeHanc73lm72/H3tLsdf0272/Fntbsdb6jd
7XgD7W7H62t3O369drfjl2t3O15bu9vxs7W7Ha+m3e14Je1ux8tqdzteXLvb8ah2t+NFHe72CYe7
fVi727hfu9v4s3a3cbd2t3GHdrdxm3a30eFu40btbuN67W7jGu1u4yrtbuNy7W7jMu1u4xLtbuMi
7W7jAu1u4zztbuNs7W7jTO1u43TtbuMU7W7jJO1u4wTtbuM47W7jGO1u40jtbuNw7W7jMO1u41Dt
buNg7W7jQO1uY3/tbmM/7W5jH+1uY2/tbmNP7W5jD+1uYzftbmNX7W5jZ+1u48fa3caO2t3GDtrd
xvba3cZ22t3GD7W7jW21u41ttLuNrbW7ja20u40ttbuN72t3G1todxuba3fbdsrdxne0u43NtLuN
TbW7jU20u41va3cbG2t323bK3cY3tbttO+Vu4+va3badcrfxNe1u20652/iqdrfx39rdxleUp62u
BfBl7W3bTnnb+JL2tvGf2tvGF7W3jY20t2075W3jC8rR1uf7D+1s20452/icdrbxWe1s20452/iM
drbxae1s20452/h37WzjU5DuZ+s/15Pa17ad8rXxCe1r4+Pa17ad8rXxb9rXxse0r2075Wvjo9rX
xke0r2075WtjQ+Vm6z//X7WrbTt9ffGwdrVtp1xt/Iv2svEhZ6dcbdspVxsf1K42PqBdbdvp658/
O7t0XzuB9zs75WzjfdrZtp1ytm2nnG38k/azsYGz8zrbeK92tvEe7WzbLt3P1nvdrX1t2ylfG+/y
+tp67zu1q413aFfbdulett7rdu1p287rZONt2uW2nfK0sb5ysvVe9bWjjbdqR9t2+r9NvcXZeT1t
vFl72rZTnjbepJxsvddN2tHGG/2ONt6gHW3b+Xxsvc8fYX6AGeViYz1np+9F6ioXW+9f1+9m4/V+
Dxuv0/627bxutp1RbjZeqzxsve4a5WC7Zrz+NV4daEb52LZT7jVe5ezSfewEXuns0u8R9Xlc6fex
8Qqve53AywPNeH1svMzvY9sZfZ97qbNLd6/1XpcqFzuBf3B2Pvc6gXUCzaS713rmEr+LbWe8Lrad
SXexE3ixs0t3r/VeF4X2rv2fVRcq39o1o59V1HZ2Pgdb711b+dcJvMDZKd8az3d2Pr86/NfoPL97
bWeUe43n+t1rO+N1r+2M8qqxlt/HtjNZe9Z4jva3bed1r/Fsr3vtWuNzrPWas/zOtZ3Rz8tq+j1s
OxPWudZ7nKn2SHY+5zqBNdRMsvM51q59vM61nVHPwjHh9bCTM+nedQKre13s5ExYh1rvUc3vatsZ
n3ftWuP1q/EM7WXbLrRzjVW9zrVrTWjf2q5RvjVWCe9So/E72nbG51u71vhc6wSermaSnc+t1vtU
Du1Vu/bw+dF6TaUCrcnasbZ76Of4p/m9azvjc6wTWFHNJDufQ+0/54rhHWuskL0vjeXDe9p2TVif
2rVHul+dwHJe5zo543OsE1g20ExYn9q1R2i/Gstov9p2Yd3pBJbO2rdO7hHWpXbtoTxpLBXet7Zr
fN50kD18XnUCSwaa8bnVCSwRaOZU+9X+r0nx0B613iOevVdt9wjrVbv28DnVCcTQ3nVyjc+hTmB+
oJlsHensv98xdQ7JLmunGqOh/ekge2btUts9vC41QniX2q753b1pjHiPmZwJ61HrPfLUHsku5x61
3TNbZ1rvWSy0Q+3fs2hoNzrInrl2p/3HLBL6mMk1Yb3pBBb2rknOhPWigxw35440FtIutu3CetPe
4+SfDO1MB9nzVPvS/nM4Efockmuy9aWDHCNrDzr/N79vbWeydaUT+ce9eyRnsnWlXXueck/aHiPd
V07kH8u5w+w/j6NZHzO5R6496SDHDOtIJ/KPFGhNtk50Iv+wd4/kTO486cInTzZbQZ70dGMo126z
Wbxn0fGGc3mS4weLvWg42xB3Kva14TxEfGfeOYbzRuKKeU8azqZJxt15nQznGOLFeXQ8m3Q8HJa3
0XAeJm6Xd5i4XaQc8WuRMoazNvETETqeTToe3hO5xnA+SFw3cpfhfI744sgjhvMN4hqR5w1nS+KK
kTcMZ2fi/Mj7hnMAcaFIB8M5Ksn5ByO9DOdU4t2RwYZzHvG2yBjDuZR4Y2Sq4fyKeHVkruHcRLw0
8pnh3E68MLLCcO4mnh1ZZzj3E0+NbDacR4nHR7YRj4dCxCMju4hHQoR4aGQv8VCIE/ePHCDuD6WJ
e0WOEfeCisTdoJDhNMSdIM9wViduDzHDWZP4AyhhOM8lbgn0/bJJ36/85lDRcNYhbgqVDedlxI2h
quG8ivh1SBjO64hfhZqGsx7xy1DLcN5E/CKcbzhvJX4eLjSctxM/C3UM593Ef4fLDGcD4ifhSsN5
P/FjcLXhfID4EbjecD5M/DDUM5wNiR+CGw3nY8QPwM2G83Hi+6C+4XyKuAHcYTifIb4H6O+rTfr7
mn8n3Gs4XyC+HRoYzkbE9eF+w/kS8S3woOF8hfgmeMhw/pv4BnjYcL5GXA8aGs7Xia+HRw3nm8TX
wuOG823ia+AJw9mE+Cp4ynA2I74Cnjac7xJfDs8azveIL4XnDGcL4jpAP3826ecv/xJoZDhbE18E
9Hljkz5v8mvDS4azLfEF8C/D2Y74fHjFcLYnPhdeNZwdiGvBa4azI/HZ8Lrh/Jj4LKCff5v0859f
E94ynF2Ja0Bjw9mNOAFNDGcP4urQ1HD2JK4GzQxnL+Kq8K7h7ENcBZobzr7EBloYzv7ElYUrC1cC
+jyyOUC4lfAg4orQ2nAOJq4AHxjOocTlhcsLl4O2hnMYcVloZziHE5eB9oZzBHFp+MhwjiQuBfR5
aJM/D0tCR8M5mrgE0Oe9Tfq8zy8OHxvOscRx6Gw4xxEjdDGc44nzoavhnEAcg26Gc6Jwd+FJxAA9
DOdk4Z7CU4jzgD+v82CqcG/hacTFoI/hnE5cFPoazhnERaCf4ZxJXBj6G85ZwgOEZxMXEi7EHDsJ
Aw3nHOITMMhwzhUeLEy/P2LHYYjhnC88VHgB8THhY8JHhY+meJjwQuIj8Inh/JT4MAw3nIuID8EI
w7lYeKTwZ8QHYZThXEJ8QPhAikcLf068X3i/8K9Avw9tLhUeK7yM+BcYZzi/IN4HdP1hc7nwBOEV
xHuF92bgn2Gi4fyS+CeYZDhXOnkPTDacq4h3wxTDuVp4qjD9/o79KPyj8C6YZjjXZODpwnS9E9sp
vFN4B8wwnOuEZwqvJ/4BZhnODU7+HmYbzq+Jtwtvz8hzhDcSbwO6HrFJ1yOxrcJbUzxPeDPxdzDf
cG5x8rewwHB+4+RvYKHh/NbJW4S3pPhT4e+IN8Miw7k1Ay8W3ka8SXiT8Eag6y2b24WXCH/v5K/h
c8P5A/EG4Q0ZeanwDuL1wutTvEx4J/E64XUp/kJ4F/Fa4bUpXi78I/Ea4TUpXiG828lfwZeGc08g
Xg0rDedPxKuEV6V4lfDPGXi18F7ilcIrhb+Erwznvgy8RvgX4hXCK1K8VvhX4uXCywPyF0DX1zb3
Z+D1wgecvAw2GM6DxEuFl2bkr4UPOflzoPshm4edvER4SUbeJHyE+DPhz1K8WZjuH2KLhRdn5C3C
x5y8CL4xnMed/Cl8azh/y8DfCZ8gXii8sIC8ALYazpNOni88P8XbmKOFMvB24cLE84TnZeC58D3x
3GiRDPyDcFEnzxGek+IdwsWIZwvPLiDPgp3Es6J5GXiXMN0/xmYKz8zIPwqDk2cIz0jxbuFoBt4j
HCOeLjw9A0+Dn4inRfNzwlOFp6b4Z2EkniI8JSPvFY4H4smwj3hytLiTJ8EvxJOiJQLyr8IlnTxR
eGIGniA8ISPvFy4ViMcDPW+IjY+WDsgHhcs4eZzwuIx8SLgs8VjhsRn5sHC5QDwGjhCPiZYPxKOF
Rwfmo8IVnDxKeFRGPiZMz3NiI4VHZuTjwqcF4hHwG/GIaKUC8gnhyk4eLjw8xSeFTyf+RPiTU8TD
ovT8y6YJxEOFh6a4sHCVAnIR4arEQ4SHZOSiwmcQDxYeHJiLCVcLxIOEB6U4T7i6kwcKD8wZR4QT
xAOEBwRmEK5RIO4fjRrOMwNxP+F+KY4J1ywg5wufRdxXuG9gRuGzifsI9zlF3Fu4d4rjwucE4l7C
vTJyceFaBeQSwvT8OtZTuGdA7hEtaTjPyxGXEj7fyd2Fu/9O3C1a2nBeUCDuGqX3ATZr54jLCl8Y
iLsId0lxOeGLnNxZuHNgLi98cU7442gFw3lJgbiTcKeccUXhOoG4o3DHjHya8B+c3EG4Q2CuJHxp
Tvgj4Y9SXFn4shzx6cKXO7m9cPvAbISvcHI74Xb/T/yh8IcpriJ8ZYG4rXDbFFcVvipHfIbw1YH4
A+EPAnM14WuI2wi3yRlXF762QNxauHWKE8LX/VdwK+FWgbmG8PVObincssB8pnDdnPD7wu+nuKZw
vQJxC+EWGfks4T+eIj5b+AYnvyf83ini5sLNc8bnCN+YE35X+N2MXEv4pkD8jvA7gflc4Zt/Jz5P
+BbiZsLNThmfL3xrTripcNOMfIFw/QJxE+Em/7VcW/g2J78t/HbO+EJh8nlijYUb/258kfAdOeG3
hN/KyBcL3xmAUz5f3cJ1i8n/9/T/+nzHxOc7xj5f8TfY57NJfk3xC9nns8k+3zHx+Y6Jz7dSfL6V
7PPFx7HPZ5P8jnhX9vls0vHi77DPZ5PeR8Ubsc8Xb8Q+X7wh+3w26X4ufhf7fDb5ePXY57NJPl/8
Uvb5bJIfFT+XfT6b5PPFq7HPZ5N8orj4fHHx+eIl2eezSf5MHNjns0n+SrwQ+3w2yQ/Bo+zz2SQf
A39ln88m+Qu4h30+m/T+H3ewz2eT3pfjVvb5bNL7ZdzEPp9Nev+K69nns0nvF3E1+3w26X0brmCf
D1ewz4dL2efDpezz4WL2+XAx+3y4gH0+XMA+H85lnw/nss+Hs9jns0nPJ3E6+3w26XkaTmGfzyY9
X8IJ7PPZpOcbOI59PpvsX45mn88m3c/hCPb5bNL9DQ5jn88mXU/jEPb5bNL1GA5kn88mXX9gf/b5
bNLvI+zLPp9N+jzF3uzz2aSfR+zJPp9N8vmwG/t8Nsnnw67s89kknw87s89nk3w+7MQ+n03y+bAD
+3w2yefD9uzz2SSfD9uxz2eTfD5syz6fTfL5sA37fDbJ58NW7PPZZP+0Jft8Nsnnw/fZ57NJPh++
xz6fTfL5sDn7fDbJ58N32OezST4fNmOfzyb5fNiEfT6b5PPh2+zz2SSfDxuzz2eTfD58k30+m+Tz
4Rvs89kknw9fZ5/PJvl8+D/s89kknw9fY5/PJvl8+Cr7fDbZp32FfT6b5PPhv9jns0mfN/gy+3w2
yefDl9jns0k+H/6TfT6b5PPhi+zz2SSfDxuxz2eTfD58gX0+m+Tz4fPs89lkn/cf7PPZJJ8Pn2Of
zyb5fPgs+3w2yefDZ9jns0k+Hz7NPp/NXsLvCpPPh0+xz2ezr3ALYfL38EnhJ4WfYJ/PJvvFj7PP
Z3OQcGth8vnwb+zv2SR/Dx8Tfkz4Ufb5bJLPh4+wz2dzuHB7YfL5sCH7fDZHCncQps9D/Cv7fDbJ
58OH2eezyf72X9jns0k+Hz7EPp/NccJdhMnnwwfZ57NJPh8+wD6fzYnC3YXJ58M/s89nk3w+vJ99
PptThHsJ8+f1fezz2Zwm3EeYfD78E/t8NmcI9xMmnw8bsM9nc5bwAGHy9/Be4XuF72Gfz+Yc4UHC
5PPh3ezz/Ye984CPqsr3+J0MZDJz55TQe0JoAQQSSgh16L0ERIiCCFJEBETAtqiJHQurrg3luU/c
ta/6XHXtvmBZdV1dK4srQmTFjkQgySSZzLzfOec/N5Mwo7N5wed+Pg8S/t/v/9575t5zzm35/AFE
c/+YZer5EF8hf4D81bg+k3wm+QxTz4f4GvlD5Lqez55u6vkQXyf/A/kb5I+Q63o+e5qp30PU9Xv2
VPKpjj9G/lZcn2Lq+RDN/XCyqedDfJv8j+TvkD9Brp8/7EmmXg9R1+vZE8knJvSnyHU9nz3B1O8h
vh/Xx5t6PsQPyJ8h/5D8WXJz/x5HPs7x58h3xfWxpn4P0fz9hTHkYxx/gXw3+Yvkup7PDpj6PcR/
xPXRpl4P8ZOkfJSp50PcQ76T3DyPjCQf6fjL5HvJXyHfF9dHmPo9xNIE/hq5rtezh5MPT+DDTD0f
4n7y18n/mcDfINf1e3Y+eT75UFPPh3iA/C/kXyTwt8h1vZ6dR56XwIeY+j3ErxL42+Rfx/XBpn4P
8Zu4PsjU7yF+m8DfJf8urg809XqIB5P098m/j+u5pn4P8VBczzH1e4hlCfwj8h/i+gBTv4d4OIH/
nVzX59n9yfsn7bvJzfN1P/J+jn9MXh7XTzD1eogVSfon5Pr9ye5L3tfxPeTBuN6HvE9C/5S8KoHv
JTfvD73Jeyf0feQ1CbyUXNfv2dnk2Y5/Rq7r9+xe5L0c308ebhLvaer1ECNJeQ9Tv2f3MPV7cfwA
uSsp727q9+zupn4vjn9Jruv17G7k3RL6V+TNGuVZ5FmOf03ePK53NfV6dldTr5eEf0vuScozTf2e
nWnq9+L4QXJvkv49ua6/szPIM5L0LuRdEvohcjtJLyM379udyTsn9B/Idf2e3Ym8k+OHyXmSfoRc
JOUdyTsm6R1MvZ7dwdTrJeHl5OlJegW5rs+z25O3T9oryVsm6UFy8/dH25G3S+hV5K3jelvyto32
avI2SXkb8jaO15C3Tcpbm3o9u7Wp10vCa8nbN9LD5Lpez25F3iqhR8g7xvWW5C2byk19HmKnpLwF
eQvHXeSdk/J08nTHU8i7JOlu8oxGuTT1eYiZjfTm5F0b5YJcJO2p5FlxnZPzhO4h79ZITyPvHtcZ
OUvoXvIeSbmf3O+4j7xnI90m79Uot8ntRrufXNfj2T5yX6OdkfdupHNy8/NrL7k3aRfkfeN6Gnla
0i7JT/hZ3EPuSejp5P0a6S3I+zfKU8lTHW9JPqBR3tzU4yHmNJG3Js9tIm9Druvp7GbkzZrI3eTu
pL0t+aAm8nbkgxvlKeQpjrcnH9Iod5G7EnoH8rwm8o7kQ5vELVMvh5h/PNwXMY7YVN6ZfFgTeRfy
4XE9TB5O2jPIRxwnzyQfmZTXktcm7V3JRzXKQ+Qhx7PIR/9beo2pv0MMHBevNvV3iGOOk/cgH3uc
vCf5uLheRV7VaO9FPj4pD5IHf7GeTT6hSbySvDKh9yafeJy8D/mk4+IV5BWO9yWf/LN4uam3Q5zy
M3k/8qm/CD9KfrTJvD/5tKT8CPmRRvsA8un/R55DPqNRfpj8cNKeSz4zCY/5f8z1L4/+M8f+KPUc
vsO7yhpov516Jn/Qux5L0vDbLLnDu8TK5HekXqipq/0p/uxguf/6V8tlzfE3T33PH/DY1g7rNivV
hebwvcO600qL7Ifsxffd1jbnE5lVYGX7R3lOtDNnLF23PLMwM6f/EKxxB75vV/9u4BYX2p3j34hW
H0nYalWDVvus82fOXrZi6bqG7RW3i0Swqcdqht9Z/s9Sv+vY0ep2QH0fsLp1PJCg/YPHtE+7m1mY
m5Njxewv/X/wbHaSLVfHaZn2vEHL9C8oshdT38vLU9Hj+UteglZfO6ZVL3Vvbl5Mm04VZ1/TJu/7
I20+d0ybaWZP0WS0RTOftjrzymX5UnKsUpnfQloDvfneLVKmf4U2l1srp06em6M+wFoEc0/esHT9
qtxBVqJfrl6u3JSUlFHAFHynqdSLnR/olXCD6C+1F7QnzuebuZzpvci3k7/r26kovRV/N72VleXd
JvfkWyr6duZbCXqiA/WETN2dtkR9W9ne53zrXYOdfsjy7TPt+PYl0U627cLWg+q29vc0W/t7JrO1
fwq2Hli3NVtrtmZrk9ma3YCtc+u25k+arfmTyWzNd2HrHGdrWtvFnbV3Yc3PaW2MgTMuzFqPPV/j
HeeZtObcCzIXrK03QtusFnrU37BupHi9vdhbynr61liulENW3K80XAWKQpFaKw0nlaghCChIrbaq
ldegrSi4o+CJgjgGMghSMiKlQctTY7kC4UoTQxSDJhaVUSxtEEuSi4GGkbbPiEZqX0Qjfa6H9sMd
jZFKvcOuSDF2uBpXjRITA2UmZoSCql9SPJHSqjg9paCo5n/TV3WdFkjUaUVN1GnHdF5pg84ra9B5
9LmC9sMTTrbTwrGdhmMMRA+2SSHRzI79Sg3jBn1Eh8ARyxNWU/ColRZW3V1cThAst7xhyx2IREoq
ohSqsHxqo3DEQndFMUxYG7EwWAo9QByur5ayOGCgOxSpsnwhkyurttJCOldt+dSIIxes0egKRazi
kOWrpmxInZbIldRaPpyfArkQzsegpU/UoM4AKjHrwgQeDRXqOACecnXnMwkNqRVWdE2hILXSUk34
gnpL1brCorDzmSobDmlU2VKzd26VrdGo+qG0xkz0WjoklaPDdNXSoWeonOkO5EwXqVwwqHI4smLT
g0Ll6rq4uDJmCOqGxYxUWbkZw0h0DEudoSt21g5WxDYWRUzqtLDuQJNz0RjSXtEYus0Y6qFT3WNQ
DXKJOVLVJ0GDKltco2a6GuQac3mojZheUs2XmW7MqOtR3bzp8oDpfTWonmMGVYRjx1CBJ0KLXNF1
MsI0J9y1BAENVXqqmcEMmAmkdshD00pdscxU08dgJiAGM6QnpRpBoSYqIGTGtFZnqkynhUz3hM18
DQcbng6xJ4k5dRIPZrC87kSMnpl0otJpm8wZfry/Uo+qwdSdlamnvMYcdS03OFKf0hpHqwlSa9nq
oopetTAKfn3BrVVXTRKMv0tEJQjJiApGylUUFUQ9+KzG8ohIMT45arisYuAiYWPuSBk+P4KG/NVW
akRN3EiZkSL0IvrbSEakGO0VY++qreYiUoIGQprdkVIRCRl2RYLYWs/VZng4iJSYaatPpZDlrbLc
IhLBdUARZmTIEPZMTf+glRKJlJqU+ihnIRE2LTGUoTdQVITTtUbNWXU26DOnGTYI4CQyuxnCoZtd
wyHiwA0XRUpdajcVo1FL7T46LRWbqpMoRN2kZqk6YmXYHCOmOkNZQHWaW/WTsRKMsepCpu/DxZiM
RSEaB3SzHgxnhJyxw9YuT+wQuyL1xz5mSjSYKDHThyYVTbOfnI7H73aKawouN+hJTwUOMmyiGxNK
31NKzL2lqNREdfAqZlAUQRM9IRPd0Rg20RWNkbqoDlnpUTSPLv9XY1q5fgRpAG69Srk53/QeURQU
1YCaC2rYDAAe5KwYDNVhMC6W1WFpHRZTT9ZEzIU1EDK3c4M1//JlJw0vbq4KNSxNDcnvg74olx79
yejXUZ00xVX/L79wUQ9BgUo1IZoaEk2jH3nfVW/H2XHfd2fhPX+ed2dKv4FWg3ddrteYY62iuNRm
3mfsxb72eNfFI0P9Lzw6qzPaDqt3w1qHIyHD/maWucsqYc3VbVVdP6Km7lh1hrtWaT0rq7NAWSAY
YyUiVGdFxe5wjOEDY82KmteyLlErO6b6tcQx9URdGmuinnnK6lkw1tz1zBUyhusBdtIdrmeReoad
IQurZ7eSqF0Cw87EmCiLWpGyYPTzAsXqjcKxEnXXLSbLCKrOL1XmVhZWzw9kIqifDMk8yjKi5lYm
ouZS5o6YgbXya82t21Ol3ltrG06HBl/67RdPJ/+u0TmQunMs+rPETL7bt5PvTm9lZXo3+XZ6N+mf
122St1r5Vha/W8f4P60aS+ej/lmzKJCF7tz+dT+zRBtin9UJbbxgIry3aVPHH28T7fHv0N7A2Pb4
RtOeid5N7EXTno4/2R4rduf0z49tj3lMeyZ6N/nnmPZ0/Mn2/K3Q3uDY9uztpj0T0ZsHTHs6/mR7
vgfQ3jE/84tZf5dlpWx2+ny91fet37eZvObs05euyZy3Yu36FRuWbjp3w4rM7Om9jx3lDuqB17Lo
J/QF7FXfx+xzPLEX+If6D/kXMGEV2C+wi+097C7k0tiH/mx2FDSap/sX81zQKj7ev4UvA13DV/sf
5NeC7uPX+v/MHwK9xO/37+Wvgz7g/+0/wveBDvAPWXOuWinnX7LWwoPPbcarWHfRHpQu0liuyAZ1
Fm3YKJEHyhbd2BQxHjRQDGBzxWzQCDGcLRSngCaICWy5WA6aIWayNWItaJ6YzzaJ80ALxWlssygC
LRUr2aXiKtAqsZZtEVtBa8UmtlXcAtooNrObxXbQBeJStk3sAF0srmZ3iftBl4mt7B7xCOhqcRO7
XzwOuk7czh4WT4NuENvZY+J50M1iB3tC7ATdLu5lT4vXQNvFg+x58Sbot+JR9pJ4B3SPeJy9LN4D
3SueYq+Jj0APiGfZG+Jj0MPiBfaW2AN6VJSwd3ChLmCPi1fZe+Jz0BPiz+wD8QXoT+JNtkt8DXpW
vM0+FgdBz4u/sU/EIdBL4n22VxwGlYiPWKkoB70sdrP9uLpipMU/2OeiGvS6+JR9iZeJAvam2Me+
FhHQW2I/+1amgN4W/2QHpRv0N/EFOyRTQe+Kr1iZTAO9L75hh6UP9KH4jh2VftAu8T2rkBz0d1HG
KqUEfSwOsyrZAvSJOMpqZCvQHlHBQrINaK+oZGHZFrRPVLGIVPPgM1HDXbIjaL+o5SmyM+hzEeHN
ZAbogHTx5rIr6AtQqqavpJunyW6gr2Vz7pU9QN/IVO6TPUHfyjRuSzWvDkovZ7I36Htpcy77gg6B
hKYyybiU/UA/SM7TZX/QYSl5C5kDOiLTeUuJeY9jbclbyUGgCtmKt5GDQZWyNW8rh4CCsg1vJ9Xc
rZJteXs5FFQt2/EOMh9UI9vzjnIYKCQ78k5yhKZOoJGgWtmZd5ajQGHZhXeRo0ERmcEzZMAq4BYo
U5NLduVd5VhQisziWXIcyC278W5yvKbuoAmgZrIH7y4ngprLnryHnARKlb14TzkZ5JHZvJecoqk3
aCooDZStySv78N5yGsgn+/I+crqmE0AzQLbsx/vKmSA/6ASi/qBZICYH8H4S5yr6OIf3lwWackFz
QEIO5APkXJCUg3iOPNEqBKeDc8EF6O/BfKCcp2kI6CRQS5nHB8n5es1WcigfLBeAWst8PkQWahoG
OhnUBpRHNByE6wRGZgQfKheC2smRPF8u0u20l6P4MHmq5g7g4WBFo0GLQR1lgI+Qp+nlneQYPlIu
0TQWtBTUGTSKaBzodFAXOZ6Plsv0NhlyAg/I5Zoz5UQ+Rq7QNAm0Ume7ysl8rDxDcxZ4HHE3OYWP
l6s0TQWdCeoOmkA0DbQa1AM0kWg66Cy9dU85g0+SazT3kjP5ZLmWeBZ4HSgbNIVoNuhsUG/QVKIC
0Hq9TR85h0+T54CV9YVNhymaC9qgsyfIE/kMuZHW6Sfn8ZlyE/FJ4HNB/UGziOaDztPLB4BngxUt
AJ2vszmykBfIC4hPBl8IygXNARVqPgX8K9BA0FxQoeaF4M2gQaATiRaBLqJ9Gwyb59gQeSo/SV5M
vBh8ieY88HywotNARTo7FLwArGgJqJhayZdLeaG81LHTYZeBhoFOBhVqXga+XPNw8ClgRctBV9CW
I+QKvlBeqc34SjjuWZhtK/kiUHTJKPipeskoeQboamfJaLmKL5ZbHDsTdg0oADoNZPIBuRqGuzXm
4Wq+BGTyY+RZsOs0jwUvdXgN+Hpaa5xcy0+XW53PHCfXwX8NGg9aBoouGS/Pht8AmgBaDjL5CXI9
7EayibAVZCYzSZ7DV8qb6mU2IPMbzZPBZzi8EXwzrTUFtkqb4k3gW2LamCrP5Wfi2TU2cx4yt4Gm
gVaDokumyfPht2ueDj5Ls7ELYNucNWfA18AVXQi6I6b9GfJXyNwJmglaCyqMWToLuXVOTvlm+HbH
Z8PP1q74IvB/xGxdgMx6ZBRdDLqrXtsF8hLkfguaAzoHVLdsjixC5j/J5sI2xFgx7O6YtU9EZqPO
KL4UvCPmk1R2nryMb5L3NMhdjtzvNJ8EPldzdOlJ8gpkfu/4fPh5jtdvfYG8kp8v742Tvwr5+0CF
oAtAsUsL5dXI3e/4yfAL6/kW+AP1tjkFuV/pnOJrwA8e86mnyGuRx9Mtzsxr+WZQ/eUL5XXIPqx5
EfgizXXLF8nrkftDTOZUZC52Msq3wh9p0O5iZC/RWcW/Bj8ap69Ow5KiY5ao/A3IP+b4Enix49Hc
jcj9V73cUuQupZyym2CPxx2l0+Vv+GXyj3GX3IwlT5Atg11OVrfOMnkLsk/Wyy1H7gonp/xW+FNx
PmEFllyplyi+DfynuPu4Qt6OZU9rXgm+SnPDtVbKbVjyjONnwK92PP7vAlxptvEttJayO2DPJlj3
THknv0Y+l3Dpdix9XvNq8LWa637HvL099BDe3vDugPe2N/R7WzP7BX93G+8O9p3+jfZz/ptBVf5P
/e39eML357He/vkMT3b+ZWyF/3J2Jegqdqv/PvYU6HfsJf8rbC/oeVbq/4SjZf+7LOwv+59GzgPK
iipbw9WNAt19zzlFUjJNUFsJEgSRJEiQjAQVkJxzloy0JJEMkpEoooIYRyQoYhoUw5jGp+PCZwJ9
yiAjZhTet3edW3S3sNYsF/b3nzq3buh7u/e3N5QtC31hS5pUWw/6j61hClmqOBPYFibTDoIStrup
YvltbIrbEaauXQRVsDPMTRZz5MhC09bugmrb9eZWux9qZB8yvcQNTXP7tBlo34fa2YNmpOURmM72
dTPeitt0t++bqfY01MceNdlWTGWQPW7mOXGR4fZ7TAxPNWPsL2aZE4u4054zq5x4wlSX36x3Uv/f
5Sz+VU1drij+JfX6PFfS7HA8I7PAlTc7HbW0WeKuwrqojM0KV8U85ahzOVdN84yjVjXr3PW4FlWn
ud81NM85akWz2TUxL7i+anU3Y1iD1eraYHXD1epuwerGQDtdF3PETYB2u6541WTocdcTr5oBPeX6
YFPZ0N/cAGxqDvSsG4JDzVe/G45DLVS/G41D8fvUPO/Gm6OO7y/3PhFz4neYedFNwZzWQS+7GeZL
J6/9q26mOeY2q+nNxvQeUNObh+ntUNObb75zD0NvuoXmhJPv0dtuiTnpHlPTW25Oqe2+5+4zP7in
offdanPa7YH+6daZn9w+db4N5mc14I/cRvOre16db4v5zR1S59tmzriX1PkeNH+oFR91O8yf7u/q
fI+Yc+rHn7ldNnBvqP3ttinuLehL94TN595R+3vSXqLOfMw9bS918n457p6x+dWev3bP2gLuf8T+
3D6bph79rdtv092/xP7cczZDjfqEO2gTTt5h/3aHrFG3PulestZ9IR7oXrFOLfuUe9WG7ph4oDts
C7mvxQPda7aw+0Y80B2xRdy34oHuTVvUnYB+cm/bYu6kGCF0mdIv7h17uTslRujes8XVxn9z79sS
Tt7Pv7t/2pLq5Wfch7aU+1k80H1kS2PoXcUE3b9sGXX0s+4TW9adERN0R205sXVeqU9tpjsLpbjP
sIhA6XMoBUp1X2ATGDyv3pcYBAbPq/cV3nCJ0jHoUuhS9zXeUADK777BGrB6Xsf/wxPSlL6DMqCC
7gSegN/z2p7ADoTS3b9xA6N0EsL5eZVP4QU4P6/yf7CCQko/QNg/r/dpfKAIZN2PWEBRpZ+gYpBz
P+MAlyn9AvFZ5nvwK/V/caiQ+42av4TS71BJqLA7Q8VfSukPqDRUxP1JxV8GKurOUu2XVToH8RMB
Rwyo8zOVUqDygThiClV+RKlQhUBsMR81fsVAbPESKvpKSpdCVwRijfmp569UKgBdFYgzFqSaz9Kf
2qXCNGr3q5XSoWsCccYMqvjKerxMmKBur6JkoKqBWKOlWq8WRNboqNCvVQqh6oE4YyGq8xpKhaGa
SkWgWoFYZBFq9IiKQvx84/tfjMq8dhDZ5GXU4nWUK4WXU39fr1QcqhuIO5agCr9Bj18RloT5ucj7
oRR1d32l0lCDQAyyNDV3RGWghoEYZFmq7UZ666ywHCwdiquhVp4yocaBuGQmlXVE5aEmShUg6V9U
htp4qgg1VaoESSejCtTW0xWQ9DSqhldSWbcIItO8CpauRrUwi1q6ZRD55dXUzq3879bq4TVUxq09
V4alp1EjrEJN3DaIvLIqLL2MmlAnT9Ug6WrUCq+lBu6gO2uF1WHpa1wHdfFUA+qoVBPqFERmWYuK
t7N/DHVIt2mXo054HdQliNyyNhXtrUp1oKjPUTe8nkr2ds914cgl61K/RnQD1C2IrLIe1Wl3z/Vh
6XbUh+7w1ACK+h71w4aw9DoaQD20AxJ5ZSPqz16eb4Sj3kejsDFVZx/PTWDpedwI9fZ0E9QviNyy
Kdw/EJtsSlUZUTMo6oM0DpvD0gdpAvX11AKKOiI3hTdTMw6O66Gm5P5koZbQEL/aCpZeSDNogKfW
0DB/u+ZhGyq+4Z7bwlE/pEXYjhpvpN/VImxPkj7IzdBgTx2g0UHkl1IB8hucd7XUdVFPpGXYER4b
RA7ZkZot2R9pFXYijQvEIDtRv0XUGUp2R1qHXUhUAryvu2CSEd0K3el3tA1vwxonxul2UtQXaRd2
xSIn+yPtwm4k6Yy0h0Z56g5N9Ts6hHdgjdPi1IM0PYj8sAd+mOyD3BL2JFGJ8N7viRtGHZGOYS/4
Lr+nY9ibJN2PTtA43xPpFPaBs4PIDvtgh9lKfaFkR6Rz2I8U9UG6wBO0O9Il7A/N9ntuDQdghHPi
NJA016fbwkHYYbL7EbnfINxvntJg6J54fQiJmolPyhD8b34QueBQONn76BYOw/wWxOfqFg4nR32O
7vBUWGgElOx4dA9HkhYHkeGNxPCSPApe4nf1CEfjdkvjNIaU7HH0JM2IexySx5KXB2JzY7G55X69
VziOtCJO40lUeXyixmNwyT5H73ACaaVPfcI7MbdV8bn7hBPJq4PI2SbibEmeBK+J9/ULJ2Nma+M0
hbQuPto/nIqT5e5YDGBtjq4JT4M35Dg2nSz9iIHQXN+rkDSDtDFI2tUM7Gqj0l3Qpvj2g8KZ5GQf
YjDpHpJQNrQl3jc4vJu8NZBP491Y1tYg6VyzSNvifUPC2WTqXT6PszGqB+IjQ8M55O1BZFhzMKzt
uZ7lsHAuaw8qD4cX+u6DpHmkHfHOEeE9dlHcVYhW5rPysE8jSYtJQvdCj+TYOTJcwMpO5VHwEt9L
kLSQtCveOSpcRH4UGg0tzdErGB0uJu+O8xjyMrLQEih3J+AWPr9L7HK/Kmkp6fEcx8fh+yty9ABk
ZTkrT8Z5PPk+stAK6Kkce8fj9vfFpj+BtFKT8Eo4t99PwNpXYu238ElfZVfFZi95NXlPjr0TsfXV
uWxd1taytjfOk8hr8ni6rK5jFUvhJ8A6uzaHk8vKelb251iZwso6VoQ2QAdyHbuflefiPJW8XrPw
Rvj5XPc8NdzE2kHlafAG5a4+bya/kOexTg+32PvDQ3nWtrL2YpxnkDdqFt4Gv+SPxX0B+bdhD3yI
LaxP/9jsl75AxgcZX2T8mMAHMromdmZMThyBDpiyGZ+YRtA5MyZRzizD7WuaJxKdDL6V6G6+TEy1
eENimjWJDZYaNbHGVk88a6lzEo/b9ol/WH5XJl6xwxJf6dz3Q3t34mfL5zJx3K42+e0enfE+YopZ
sbtUe8BUsJ9A1h4x1azYUwn7sbnB8vhMRYy+qRp9VfuDaedkVljHnjW3ubLSK3AFTS+dCjd3hc1A
R+1r2rrSZoSTiVlnd4UZ75pLr8BVxfnbSa/A1TbZjmqK3Q3NXDX14a6pWej6S68AP1+mfn6n64jf
j4WmuNvx+0naK+hpNqmVz3L9sPpZ2isYYnaoiy9wI3H5xdorGGcecyug5W6SedKt0V7BdPOM42eg
WeuyzV63JZAJ8By8fXsgE+D55qDa9la3CFvnE222u2XmFfcE9BCOfVgde6dbY47obHk3Zv2WmvXj
bpP5hzsYyCx4m3lXffpv+PQH6tN73ENY+GHtFezCvd/QXsFjuPfb2it4AuN+R3sFT2Pc72uvYA+e
/aH2Cvbh2R9rr+AAdv2J9goO4tSfaq/gEE79mfYKXsakv9RewauY9DHtFRzGn7/WXsHrWLN0bN51
b2LNJ7RX8DaufFJ7Be9gyKe0V/AehvyD9go+wIt/1F7Bh3jxz9or+Agb/lV7BR9jw79pr+ATXPiM
9gqOYsB/aq/gfzHgc9or+NymiPPyHL6w+XRq/RWme4mYLs/muL1Up9bHMd38YrrmG/y2oPgtz+s7
myZ+a77FatN1fv0dVpshVssz/N4mQqe9glPW6CT7JC5rdZL9PQbrdJJ9CoMNxWDNDxhsYZ1pn8Zg
i+hM+zQGW0QM1vyItxYVb+WVOIN/ltJewZ9YZxntFZzFOstqr+Acrin9q98w0xI63f4dKql0Bkct
JY5q/sBMS4uZmj8x0zI68T6LmZbVifdZzLSsmKk5h5mWk9m3DbDRTLXRFGy0vEy8bSpUwVMCEivN
h5VWVCu9BCutJFNwXkWHGV6rVAgSE82PiV6pJloA/7xK/bMg/pml/lkQ/8ySeTivcTEcUCgdD71G
JuPQ5ZBYaAYWWlktNIGFVpHJOFQSEgc1OGhVdVCLeVbDPOUnn8M9r1X3DHHP6jIlh8pB4puFoBpK
hfHNmuqbhfHNmuqbRbDMWmqZRbDMWmqZRaHrPFWCxDKLYZm11TIvwzLr6OT8Mhyzjjrm5Tjm9d4x
i+OYddUxpSNwDVYmM/OSUD1PlSExzVKYZn2dnpfCLuurXZaGGniqBolnlsEzG+r0vAxu2VDdsizU
yFMNSCyzHJZ5o87Ry2GVN6pVZkKN/UQ9E8NsrHP08lATT7UhMc0KmOZN3jQrYppNdaJeEbtsqnZZ
CWrm6QZIJupXQM091YNktn4ljtkCx+yq3ADuEUh/oCH2FM3Ws+CWnq/GMVvpdP1qDLOVN8xrMMzW
3jAr45Vt1Csr45VtvFdWwSbb+rl6FXyyLT4p1t8MD4qoOSQ2WQ1q76kFFHnltXhkB++VYv8tsZ7I
JWtgkB0xyIhbwzJPrwl18tQGikyyFibZ2ZtkLUyyMyYptt8On4moPTRKj9fGI2/1Hlk7FKsRj6wT
itFE1BGKLPJ6+PbYIuvijl39bL0u9tgVexTb74ytRNQFiibs9XDH7rE71scd7/Cz9fqY4x3eHBtg
jj38RL0BtthDbbEh1NNP1Btijj39HL0R3tgr9sYbccXesSs2JvXxFtkYW+zjbbEJttg3tsUmOGJf
tcWboH6e+kCRKzaF+6srNsUV+6srCveDxQ6bQQO8MzbDFAf42XlzeKDOzptjjAPVGIUHwnMD8fmB
mMRcXW2BJQ5SbxSPH4Q5nJ+gt8Qbh8Te2BJbHKLe2Aoa6r2xFd44VL1RrH0YXpCck7fGE4epJ7aB
hnt7bIMzDldnFGsfgQssUhoJLfa3bIsxjtBZeTtopLqj8Gh4qXJ7eFTMY+Blyh3g0TkMsgPeOFoN
8hZojBqk8Dg4mo13hMfCQuOh++LbdsQfx+KP4u8TqPFX6monPHKceqQ4+53U86uUJkLnJ+NdsMgJ
8TS8Cw45QR1S3t+Tqd2TPAVe53fdhjdOzOGSYupTqc3Xx2kaaYNPXfHHyfGsW/IMsjhjN2hK7JLd
MMgpapBi6HdJxa00E9oc37o7/jgVfxRbz6by3uLX78Aep6k9iqvfLZW251nwNr+rJ4k6W2k2dN4i
e2KOMzBHsfQ5WHpuh+zN2kw92huDnBnPryXPI8vcug+UncMm+2CT2d4mxdbvwdYfUpoPPRzv64dL
zsrlkv3wx1neJfvDs2NeCJ83yQHkOWShRdCjOY4sJkfz5YHwXG+VkpaQks44iDQvl1fK2lLWHg/E
zZfi5ufnzIPxyXvi+fEQ0nxNwsvh8145BJucj02Kna/Azp+KjwzFI+/1HjkMXhAb5jCsckGOCfFw
8kLNwqvgZ3I8yuFY5UKsUhx9NY6+Jz4yArtc5O1SvHwNXv6s57VwTqcUG1+Lje/NtbKOlX0+jSYt
1SS8Ht6f6/ZjMMtluWa6snY/a5FLjoWXe8+UtJH0fI6941hZwYrQJuhgrjONwyxXYJZi45ux8Rdy
HBuPX94X+6UY+BYM/JDnrfCLuc41Ab9ciV+KkW/DyF/KcTS5ZyJHVvsjkh4gvZxrx6RwOwb+Sp7b
TQofZBV34ZP9IBb+ao5jk8MdrPw9zlPI63yW9BDpcJ7zTQ0fxrZf+8vqI6y+7tM00gaforyTfCTX
Laazdj9rQrugN/KccXr4KKtv+jSDtNGnvK/MXRzbpMeEd8NvKc+EN8NJX9/Cf+f/JnZ0tYy16b/w
mdvHka159+nMPzP98/Rj+i77yw5v/5npJdhxb54d/los6QXS361SRb/++YF8LUMONH8dVLnYlWrS
drvMxPFCTwc10x50xRMnCx1IXqlGj3xaaFfA/12WUvm0Z/h/nr9hnnbUZadf7vZf5O+9Hw4ucL2a
9GJhakbmILlwRZ7ryyT//kN6G84696JnfS3Iey2VdH86uehLfLZk1yR9H2c7fdGzHbjo2TJzXJsl
z/czo7FrwZ8TFznnyr+cs2DmoKETel/o2WZmbOdc2y96rm15zzUgOteFnmtmoqBrwZ+LnWv+X85V
IDpXzuva+HMlr/IzxmXL1W34uueIfF1IDjRvCC52tZu1ee/n7vy1qtWR65Rc/N89fEcoE/+7h7pB
VmJ8oZr6773+q+vjpM5PXZtvcr4gz5GCyfd66rLULfnGpP4e70y9wGPYS6gdP4ZDQRicCobon6x8
LVPXpvS9wGPJe52erJTM9OIpy/7yOKqnVU/JSg9TFsd7Vl3kEdTzj0DufYz+yUr7JiUzpd9/ce91
0/amZ6VnXuDeG6cdSudec+y58L1fl+Pe/XNP+zVtb0r/C34fzv0/GQmYGzBUHPDpogAAXwxf+c44
7s9rvMULMdwmoLwDAaIe0gTlRrek/kd1wWluxgIAAAAAAAAAAAAmAgAAygIAACiVagAYXYoAp6IA
AAD+eJzs3HuQVNWdwPHT08P08Jqenp5BRNamTEBUTBmjgM/eP5KAb2t3k4CiwpYaQQV03awK0q2m
tioJKj4q6xoRVKxKVRLEZ+WPJLSKmtqqJCC+/thNGnzvP7ag0DNzp+/+fuf3vd13ZnpwYjBmq1Dg
c353Zvr0Pfec3zn3noaXljv5r+W/Wma4TEs4wYU1if7efruSKx/W2dWp3+Eedpe7K8+a9w8nuIRE
iyQac+6Sm1b86w0nu1H8BhZhCW7CMjyMZ/EGCr42raNqe+yFQ3AsTseFuBI34m48hGfwOj7EV6Z1
VG2HuTgYx+A0XIArcAPuwoN4Gq/hA3xpWkfVttgTB+FonIrzcTmux53osQKv4n18YVpH1TbYAwfi
KJyC83AZrsMdeABP4RW8h89N66jaGrvjACzAyViIS3Etbsf9eBIvYyU+M62jaivshv1xJE7CubgE
1+A23Icn8BLexSrTOqp+pKNZc62jWXM/7/fRfp/saKMW1lH1OF7EO/gUa03rqNoZ83AETsTZuBhX
41bci8fwAt7GJ1hjWkfVTtgXh+MEnIXFuAq34B48iufxFj7GtGkdVTtiHxyG43EmLsJS3IzleATP
4U18hNWmdVTtgL1xKI7DGViEJbgJy/AwnsUbKPjatI6q7bEXDsGxOB0X4krciLvxEJ7B6/gQX5nW
UbUd5uJgHIPTcAGuwA24Cw/iabyGD/ClaR1V22JPHISjcSrOx+W4Hneixwq8ivfxhWkdVdtgDxyI
o3AKzsNluA534AE8hVfwHj43raNqa+yOA7AAJ2MhLsW1uB3340m8jJX4zLSOqq2wG/bHkTgJ5+IS
XIPbcB+ewEt4F6tM66j6kY42amodbdT0Bzrai47mNurromTep38nbeRpqaelnpZ6WuppqaelnpZ6
WuppqaelnpZ6WuppqafXIr/b5Xfi13+36d8/9bs3urX+95FS17j6uzix84TkCZPeT9/f5L0k512/
ZOVVJ1721RHfQJu7suV/Ens/83uRd1KvPyU/3+6mdX5/THvPT8f4Use2np92bHNTFrvFLgzlO1rk
/6M67x2Tb3PeC3EJXo+34334GD6LL+Ob+AH2mW3jcSoej2fiBbgYr8Pb8F7chM/gS/gGvo+9Zmoc
HoGz8Aw8Hy/DlXgr3oOP4tP4Ir6O72HVbB+LU/A4PB3Pw0txBRbxbnwEn8Jt+Bq+i/vNse14OB6L
p+G5eAkuxwKuw4fxSXwBX8V3cJ85LoWT8Rg8Fc/BRXgtrsG7cCM+gc/jTnwbPzHHt+FhOBNPwbPx
YrwGb8E7cQNuwefwFXwLPzYnjMFJeDTOxbPwIrwaV+Md+BA+jiXcgbtxrzmxFXtwBs7B+bgQl+Eq
XIvrcTNuxe24C/eYHUnsxuk4G+fhAlyKN4tTyFGWj47qXNexdq5+dd2Y9rmasX/s2jRBJrT8gGsP
d/tsqTntfjfLjXXJtnlXLL/ie0ucS8r/E92F7iuu1bnQuc62X064Sn+7mZ1Ptp7U+tWvzD1Bf+4/
5fd/DM1ymdcty4kX4hK8Hm/H+/AxfBZfxjfxA+wzLcuJU/F4PBMvwMV4Hd6G9+ImfAZfwjfwfew1
LcuJR+AsPAPPx8twJd6K9+Cj+DS+iK/je1g1LcuJU/A4PB3Pw0txBRbxbnwEn8Jt+Bq+i/tNy3Li
4Xgsnobn4iW4HAu4Dh/GJ/EFfBXfwX2mZTlxMh6Dp+I5uAivxTV4F27EJ/B53Ilv4yemZTnxMJyJ
p+DZeDFeg7fgnbgBt+Bz+Aq+hR+bluXESXg0zsWz8CK8GlfjHfgQPo4l3IG7ca9pWU7swRk4B+fj
QlyGq3AtrsfNuBW34y7cY1qWE7txOs7GebgAl2KTLJfZaVkus3MUWW5m5hOfveacPGL2yh5u2Uu8
EJfg9Xg73oeP4bP4Mr6JH2CfadlLnIrH45l4AS7G6/A2vBc34TP4Er6B72OvadlLPAJn4Rl4Pl6G
K/FWvAcfxafxRXwd38OqadlLnILH4el4Hl6KK7CId+Mj+BRuw9fwXdxvWvYSD8dj8TQ8Fy/B5VjA
dfgwPokv4Kv4Du4zLXuJk/EYPBXPwUV4La7Bu3AjPoHP4058Gz8xLXuJh+FMPAXPxovxGrwF78QN
uAWfw1fwLfzYtOwlTsKjcS6ehRfh1bga78CH8HEs4Q7cjXtNy15iD87AOTgfF+IyXIVrcT1uxq24
HXfhHtOyl9iN03E2zsMFuBSbZK/sJMte2UmjyV7ZuZa9Rl57dS+y7CVeiEvwerwd78PH8Fl8Gd/E
D7DPtOwlTsXj8Uy8ABfjdXgb3oub8Bl8Cd/A97HXtOwlHoGz8Aw8Hy/DlXgr3oOP4tP4Ir6O72HV
tOwlTsHj8HQ8Dy/FFVjEu/ERfAq34Wv4Lu43LXuJh+OxeBqei5fgcizgOnwYn8QX8FV8B/eZlr3E
yXgMnorn4CK8FtfgXbgRn8DncSe+jZ+Ylr3Ew3AmnoJn48V4Dd6Cd+IG3ILP4Sv4Fn5sWvYSJ+HR
OBfPwovwalyNd+BD+DiWcAfuxr2mZS+xB2fgHJyPC3EZrsK1uB4341bcjrtwj2nZS+zG6Tgb5+EC
XIpNslf3Qste3QtHk726V/nsNXvktVfPBste4oW4BK/H2/E+fAyfxZfxTfwA+0zLXuJUPB7PxAtw
MV6Ht+G9uAmfwZfwDXwfe03LXuIROAvPwPPxMlyJt+I9+Cg+jS/i6/geVk3LXuIUPA5Px/PwUlyB
RbwbH8GncBu+hu/iftOyl3g4Houn4bl4CS7HAq7Dh/FJfAFfxXdwn2nZS5yMx+CpeA4uwmtxDd6F
G/EJfB534tv4iWnZSzwMZ+IpeDZejNfgLXgnbsAt+By+gm/hx6ZlL3ESHo1z8Sy8CK/G1XgHPoSP
Ywl34G7ca1r2EntwBs7B+bgQl+EqXIvrcTNuxe24C/eYlr3EbpyOs3EeLsCl2CR79Txo2avnwdFk
r57fWPaKrb34iURH/Sf+27mW3/ITulcR/TdR0tzM7DcTs478xyuW/8vSG5Z+b+kNN01bsvzyafOu
WfHPV0y74YprV06bec4xbtC+wv3O77WMudvdGNm5MPnLnv9tPcElWj5yI/1q73Mt+bDU79r7nUvX
Ql8YCF0lcOMCOX0p1qyYD0JXGnDtgeuXLw+4cQPOJaUYyDEppvtCO5bvk++ruQ45XAjDksuHYbkm
L+2SiTCs1FxLGFbly1JIhrUB15IKg5qbKGE6lErle+yLubAYuFb50+kXE/mg37Um5eXcBInCSp9L
hhX5Uqs0Q1iSKF+VLyXlLYW9LpkOLEjVJEjVLEhXe/U9ODdeglylKu+kaOWylAuUi1LOFd24Finv
lzdlxSOlmLLiVCkmrThZiomiGyvFzn1OSk2buG2fvMcBT9JIGWkjN+BfLNErbTfg30Si2OdcgbKc
nJOm1TNIlPtdIhEFFQlSUSDNk0hHQU2CXBTIJU3kpaGtqaRRE4Ugikra4NUB1+GjslwNadoolONy
ieSgtn8Y+EslHUDbvyCvJzUEPshLTVJDwEUs6tcDi1J66eWVfJTyVyyhV1kjOaxXqywvIu0QamfT
96NBXq5YWt/q+AE3RrtATk5Cy2ntTzUry2u7sGpleWV53X7tp61hVV7UioVaSru2FvOhvGC/Gxu4
ZC7cEPb5Ulo6m5WSYRhYSTpgtU8HgfTTshUK2sG0kA/lwqR84/Z6tX+pycBMSBdrk+tVMRb3una9
slVpoYNVOMBYHvKr0S1jfXVID471a3p7fBAMGxwMmkGjadg4q4/AIYNz0LgdNKSHj/chySCWKYYl
ksF5JpaBBmWlKFPVs1cjo8XyXD33NbJhlB9H3+6f3y99M76fj9U2DbXFxvXreA9d2YopKQZWzNUs
dfdrWgldccAXCwOWxfudnHzZTj4R+CaZELg2aWgZeVULdIQ5HfgSSKbxl8yCdK2mfxDIVZCRYEFO
LkwiGcYCzVfjNZDaHF/Iy1tIFCRTfEpQ1MxyMAL/BooDlmG1LNX4DDuknNY3uSZW5rRS/kw4+6Se
cJIgEejZS4uNl9b1zVLx5TEyZpyejZbz0uVDuwKt6VB6VqC5xuV6w0TloJdG25n6/ZX3fcHlokJB
C239Mkr8YNFxM6SQigrpoQUdw5IHtUmrVW++gmUsDbE4OnORpcGmy4NNUV+S+hMB1qo+PxeKlqfz
ZTMneWt0p5/69NN3OS34txdW/yaaIUX9yagZQmuGMGqGSqwZohM4WIXR9MFUn2aOPp/PJL/M9emq
VVNNPvADJ63FIoNIywyogpYZaCFlTVl+xshXo2TmX6iezOKBkxWIje02mapk2EZBVQLSVFuuEg/K
GhSGBBMDl8qXNNA00yQq/nWiwqDaSaBtudKw99zs1NIaJMJYCyRpjlQQayjfarkgatxSoz0TOh9H
04Zeg7QuIxuTTGPiiU1Hfo4dCBsTV60xncmKUfuETOwysem0J0u1fpfqdX76O0CP0gV1YSDiQKne
l/NMVKXYpHFwgsKIQVgPmB3rQTIe6AJ+nFyjhKxmak2LQaNYbVosN4o651sxsGP9fp3TLJt8Fr+o
FdGhBHIogRzEBDLqBbZfNERVN95O44aCNbUWk4EflE2W16XG8lr7qczDBEFseZ2rNltR+6AcC/Ll
WGr5lCX1QVlfN11SN1lep0vDl9Tj/SJFyvEVdWJUK+ryiCtqvUVO9+o1sYK/39NidP/85xd0GsmP
+p673nu0kAvt7rHRdZLWLcfZrSW3m8N6UbObNAaFy4X127SKPaCxQNulGrtNywWxfpSK36Ylo8D3
o9rgO7NhZa7iX+smbXjQtNJhE3mTtz/oHIeffbxd4i02qC0Ht3K9/UeRlOrXNN1ISlz9eo+I95GW
T1vVaOf6y3ry8MIoO/XEAZc80s5EWkKjNfWoo+ZaEzULAwtTg8M0Yc3C3OAw3wgnROFAaEEhCuQb
2/WRUbrsr6wPSxZKB+ic4J9qEkvv6PTPPGsy88cP1IYcSAYcyI94oBodKI1wIBUdyEUHKp/3Af+s
rdJnK8RRBPkoqPYxqvyJjBgEfYy3eOCfQtdiT6Fr8afQYRTUeLqcrBHow+UUQaEcMMj0KVJVh3OV
QGZTP8gmsuZtSfpH0P4ZYNn+tNA//tOHsdYJZHFWlhGpk0B9Zds+oI/3dMQN+Ht5n28H/P2939GQ
YkrnaP+dOkf7h8OuoN3Zijq/226IjE5pmy9qYfv5jXs/Y8oyrGYL5HxZr9vgCdbPwtHM6+fnaEr2
CTP++Kv+YGzo9O6n/dqn3IIVG7dgn8PMMYppJD51VBpTh19zRSsrP1vUp45aY+qQFVzR1dez/mlp
oT6PsNCLrQX/3NVsEJstGuvR0U4Xo3q6l/hsT/d4nJQb+ljrL3y89Zc+7UsOedoXNnva90U85opt
/eXtQqSiK5If/RXxBe1P6cAeA1CsRLddicAvie3uTALt6nYTJ5N0uhwFenfGz/hbv0Q1FrAi1yBs
BNJz/Bq+aVBkCDcLcvUg7wN/h6lTqMtF95uDI/mucj3KDYsq9btWOY90I5IJUm4761FFGqZ+DytF
WZWE9SGbCm+3IZ+UQJZl9ZWf3u5Hi71iwgf+8YCWg3qGDMMqtyBFVwi5NZH3lg+5NUkWZehL06eq
2hWDL2zmaJP+0bnfc+T+wQOLAVQfyGGVEV7upVC1QioMe6Nt0fomaMUKab952u+/VrR1bCG6+0mH
gd1EJy1p9frtVCvkdD9YC/LiUtAtRW0uLeS1bbWQ1sYfW7XXlsl+v3/tqCAJWb5Jb8trblzVZ8sW
WRJqMSdFycPy5YGwReLxvbrvHFZ0f1nLaalL15laLsiSPq07mHI+uu3rdPWvQSr0O18W6BJD+nJJ
A3mnugaROXNivz833YbMWaSvbNEEv2esuUG65UT2lDWq+EhfXXczLbIVjEYTfMMHQSyoxIOSBX6u
koVLvVyNlcuxctHKmiam9vkiPaJJdjr0yPRv7JHp+DG6trYp5vMuj5g9Jlv2yO0f/OaZbnO1amNd
YIWKFWT017NGMfoMBR+myOkHLbQgo6fP54rQf/zI3w5XrSC35JY9NOtYrsjrWNBCWkfI2F57bUsW
BR1PljUCKyR19KX26wcIzBymhpiPfZ/+YCoq5KKCH8haX9JPAlpK+wGspYJ/D7zTwJZp8hKV+oKt
FHCKekL9/otVK+VCPnWlNQz9EEraf/ZkLOmhj9YNhjRzY0FWG3Jl5Epx4biMf8s97VAuOpSLRt9D
5JcurNIV2+qZqnfvdie7WqbsaP2b0IcKIevfpIwjP2TZkNARGg+q9W2cdMjz+MFBLpB1Bc/jdeMj
V43uAHV5Wok2PmRJmq8HsqiVZcKgoDAQrXFlNVHfb2kSxXZmdEHdiMIDRS4WJUaOSkOi2E5QrpQk
snNLxvZ+KqmgHqSr6VgQSPPUN4J0GRU1gTZtfe9HF0tDgvrej6y2UkG0F1dyqWiBLSeYihbY8lZS
0QJbl3xybdv2643Uobvg/yd3wYf2ag9WdGivllmgwL1lko8YJxL2xFhevEOf00nkH5v5J8Z+v1Rr
KdnD5ryENf+WdS+iULY3Y8+eW/UGMNnY5dAwZdsa6fH+s9L+48r6Oeh67LchLfbbSJKydJmZ1mfp
Nd38CHyzp9ltaNUPxUpc333wcXz3oVBpbFj4zYZCeciBMLZh4TcKdGekvj8x6MAEPcBeSa7pgZQd
SPr9sAMdSA07UBtyID3sQHCgA5rQ/SPX+IG8HsiPeEAnIH327E9fD9SGHNBpzn/8vFA/IBNhiQNp
vaillI+10W2XyX/8WC9SR83vCrQW9fR9d9GQXfkO61V6jiFhzj8Y8J+S1zDtP5pcD1P+QYF90t4+
vuyr1TSmq8tQV5VlC9LVAXser5ObdGOlMmyOa/y9ko3uDv9vTE3r2TKmvWdLxzY3rXP1mPbO1cP/
Ramef+t4yvWJV+K38Ov4NTwKM+jM7g/xj/g7/BX+DB/AH+CN+F38Nn4DT8IvYRcmzGwF/4S/x1/j
z/En+EO8Ca/C7+A38WT8Mmaxxez6CMv4B/wN/gIfxB/hzbgUF+A8nI3TsRuTZmYP7sLtuBU343pc
i6twGS7E+TgHZ2APtpqde3E37sCSd+i/GLS6Y4ubK73jRm/zvxG1jL/fpP8+0MxJMzvObj3xpBOa
/o30hPx/VM99E/e6XvH7eANejv+EX8eT8MvYja1m98f4Nr6K2/Bp3ITU30393dTfTf3d1N9N/d3U
30393dTfTf1Z6s9Sf5b6s9Sfpf4s9WepP0v9WerPUn+W+rPUn6X+LPVnqT9L/V3U30X9XdTfRf1d
1N9F/V3U30X9XdTfRf1d1N9F/V3U30X9XdTfRf0Z6s9Qf4b6M9Sfof4M9WeoP0P9GerPUH+G+jPU
n6H+DPVnqD9D/Z3U30n9ndTfSf2d1N9p9Q/r4RM/dFN9r1SHZdOJX7Vsit/Cr+PX8CjMoDO7P8Q/
4u/wV/gzfAB/gDfid/Hb+A08Cb+EXZgwsxX8E/4ef40/x5/gD/EmvAq/g9/Ek/HLmMUWs+sjLOMf
8Df4C3wQf4Q341JcgPNwNk7HbkyamT24C7fjVtyM63EtrsJluBDn4xycgT3Yanbuxd24A0ve4X3t
K5ZNvQfOppJJJ/y29cSvHTCTTrjOMin+H3vnAeBGcf3/lVbSSFqd71QMBEjuOBdMIMTdhpQjP9yA
NCeugRQSwIUafgRcAncpFBdKQiDGhRIcArgAgSQEXI6SBAJuQCAEsM+miEDAJ1ddk/5vZr6rW+2s
tNL5zpDf34D4vPd2dt7s7Ozbebtj72XgOeAEcBQ4FOwLJkCfZGIP+Bb4Evg0+Ai4HIT/BPwn4D8B
/wn4T8B/Av4T8J+A/wT8x+E/Dv9x+I/Dfxz+4/Afh/84/MfhPw7/cfiPw38c/uPwH4f/OPzH4D8G
/zH4j8F/DP5j8B+D/xj8x+A/Bv8x+I/Bfwz+Y/Afg/8Y/EfhPwr/UfiPwn8U/qPwH4X/KPxH4T8K
/1H4j8J/FP6j8B+F/yj8V8F/FfxXwX8V/FfBf5X0r4zuyIUykgoqkdR4QEZScCI4ChwC1oJRUJNM
7AS3ghvANeAKcDE4D5wFTgMngaPBoWAfMAZ6JOPN4DZwI7gWXAkuAeeDs8Hp4GRwDDgM7AvGQa9k
LAU2gZvAdeAqcCm4AJwDzgCngGPB4WA/MAHqktFd4HZwM7geXA0uAxeCc8GZ4FRwHDgC7A/2Bn2S
VbvBHeAWsFFQGWvGShlJBV0jqTHGN3hw0Uga3ikjKXgZeA44ARwFDgX7ggnQJ5nYA74FvgQ+DT4C
LgfhPwH/CfhPwH8C/hPwn4D/BPwn4D8B/3H4j8N/HP7j8B+H/zj8x+E/Dv9x+I/Dfxz+4/Afh/84
/MfhPw7/MfiPwX8M/mPwH4P/GPzH4D8G/zH4j8F/DP5j8B+D/xj8x+A/Bv9R+I/CfxT+o/Afhf8o
/EfhPwr/UfiPwn8U/qPwH4X/KPxH4T8K/1XwXwX/VfBfBf9V8F8l/SujO/y+jKSCSiQNf0ZGUnAi
OAocAtaCUVCTTOwEt4IbwDXgCnAxOA+cBU4DJ4GjwaFgHzAGeiTjzeA2cCO4FlwJLgHng7PB6eBk
cAw4DOwLxkGvZCwFNoGbwHXgKnApuACcA84Ap4BjweFgPzAB6pLRXeB2cDO4HlwNLgMXgnPBmeBU
cBw4AuwP9gZ9klW7wR3gFrBRUB1rn5aRVNA1koae9g0eVDSShi6UkRS8DDwHnACOAoeCfcEE6JNM
7AHfAl8CnwYfAZeD8J+A/wT8J+A/Af8J+E/AfwL+E/CfgP84/MfhPw7/cfiPw38c/uPwH4f/OPzH
4T8O/3H4j8N/HP7j8B+H/xj8x+A/Bv8x+I/Bfwz+Y/Afg/8Y/MfgPwb/MfiPwX8M/mPwH4P/KPxH
4T8K/1H4j8J/FP6j8B+F/yj8R+E/Cv9R+I/CfxT+o/Afhf8q+K+C/yr4r4L/Kvivkv6V0R2aISOp
oBJJg/fLSApOBEeBQ8BaMApqkomd4FZwA7gGXAEuBueBs8Bp4CRwNDgU7APGQI9kvBncBm4E14Ir
wSXgfHA2OB2cDI4Bh4F9wTjolYylwCZwE7gOXAUuBReAc8AZ4BRwLDgc7AcmQF0yugvcDm4G14Or
wWXgQnAuOBOcCo4DR4D9wd6gT7JqN7gD3AI2CipjLfg7GUkFXSNp8Es+mpIWi6TsPRlJwcvAc8AJ
4ChwKNgXTIA+ycQe8C3wJfBp8BFwOQj/CfhPwH8C/hPwn4D/BPwn4D8B/wn4j8N/HP7j8B+H/zj8
x+E/Dv9x+I/Dfxz+4/Afh/84/MfhPw7/cfiPwX8M/mPwH4P/GPzH4D8G/zH4j8F/DP5j8B+D/xj8
x+A/Bv8x+I/CfxT+o/Afhf8o/EfhPwr/UfiPwn8U/qPwH4X/KPxH4T8K/1H4r4L/Kvivgv8q+K+C
/yrpXxnd7B0ZSQWVSMoGyEgKTgRHgUPAWjAKapKJneBWcAO4BlwBLgbngbPAaeAkcDQ4FOwDxkCP
ZLwZ3AZuBNeCK8El4HxwNjgdnAyOAYeBfcE46JWMpcAmcBO4DlwFLgUXgHPAGeAUcCw4HOwHJkBd
MroL3A5uBteDq8Fl4EJwLjgTnAqOA0eA/cHeoE+yaje4A9wCNgqqY62fjKSCrpE0sN436KSikTQw
XUZS8DLwHHACOAocCvYFE6BPMrEHfAt8CXwafARcDsJ/Av4T8J+A/wT8J+A/Af8J+E/AfwL+4/Af
h/84/MfhPw7/cfiPw38c/uPwH4f/OPzH4T8O/3H4j8N/HP5j8B+D/xj8x+A/Bv8x+I/Bfwz+Y/Af
g/8Y/MfgPwb/MfiPwX8M/qPwH4X/KPxH4T8K/1H4j8J/FP6j8B+F/yj8R+E/Cv9R+I/CfxT+q+C/
Cv6r4L8K/qvgv0r6V0Z34BwZSQWVSOq/R0ZScCI4ChwC1oJRUJNM7AS3ghvANeAKcDE4D5wFTgMn
gaPBoWAfMAZ6JOPN4DZwI7gWXAkuAeeDs8Hp4GRwDDgM7AvGQa9kLAU2gZvAdeAqcCm4AJwDzgCn
gGPB4WA/MAHqktFd4HZwM7geXA0uAxeCc8GZ4FRwHDgC7A/2Bn2SVbvBHeAWsFFQGWv+u2UkFXSN
pP4v+AaNHKj+jaaWPV4m5YrcG/9LaK/nQ//rm3ru2Zeq61XupH+PpLHN/6ntvdS416dpffhPB/N+
rUW28V9LkW3Yv9h2HXUU3GZrR8G2trhsL+VYurM9tnYV9dnq0p5yjrGc43Q4joL7lXIcRersqXq7
PC7Veu+ka4lfG8Xql2U6ryOmVdG/NVUL/dW9F/k/laujliynazrtU0u/KP0Oo19v+iWoTvr5IvSr
pF+cfhX0C0jqIWzz0K+Kfj76hdEWU/fSL0g/hv3IpuvYJ4hfln5++dP5Pjp+ZhkN+1M5HeV8HajP
LMvr9WIfc1/zx9tj1qNhvwzqpHr0gKUNHWh3u6U97Z0+xK8Nx+XFsXixvTXft44y1nbktlnk3DFm
Hc4jjtvcJvqAof3mPmb7yabb9NyxZnGcHTZ7BsfZYTn+jEW2bst02nwWm+ijDhy7uS/6TLfqZjn0
qW7p57w+tm6zUu/0o5vl7dvMcwI5t92Lc22Ol7b8fcR+su7Oa8vc31tgf6+ljDkG7XZT1i3bHPbX
vWVuw7jTbboYg57Ossq+ns7tYpvVl6dT1+31WerQLXUoPr24R1j38aCMWa8n35fpW7fXZSmXdy3Z
yunW+jyWMua+Huc6hU9bWWvcyPlszbfnfLbm23L7OZT3Wcrr9ja2WvrAaZunzG2248gdi73N9m0t
DttknZ3XhNP+BdqUF+ec+tHe7pYC26z7aw7bbPsr28zY21Zkm32saGo5XXPoW6f22PvAXl9bkX01
Sx2a5dw4tEs35wMO9xjdoS5ljGm2/cxr1OHYc/VazoGor9A9zXouvQ59YD9Oh/qUY2m17Wtvq1Od
pt1bYp2QdYd9bPXmz8Fs7Xes377NoX7H47Hs73it2ut1nv8d+fzzmuful8UMsIZmgNW5I+CWY6Jr
/X21Y2IT/cfS3qfSrx/9jtbkjLAK3s3Zl3Wmxb1ZZxEBy5Gbd1easehpSTH6zX18aHkWdn9nL5sz
G928WsxobO7bDn/mrKzFUsYj99ctZXMzHnNmYs7krHdV8+xbe99sC2Zcujkb81ns9plSR6ef3IzH
a5m1mH59Wm7WqFsjoG5pT4vtroljKzhizJmiOWJsujgH5raMpbxVDmCb9djNmWUG28xZpNkfZh9k
8vXc/jjfun0Wac4QzdmrORs0t5v1tmvKzNTs59wM1LqPbvFp1XUtb9aZG0P5ZTqvbqfZqGVGq1vP
s55fLpfNmLY2Sx06fFtnqdZZrHUf60zVaT9vZ9259nhtfr0YY2Y7zXqtPs3rwGyjddZn8ZE7Jq9l
P91i1zvbpNtnrtZZcZulj9ry98vNFgvMmnWb7tgeM2pbrrXcnabA/rq9jebMw6vlz5id2mqd+drr
tM/A0UZllmmv1+I/L9P0WPZtt9Rr9qs1hrRa9jXv4g6z89wMwdovnTPKvMwob9btdfBtn+14LMdr
7SdLHXmzQfsxtWpqRm25NzjWa7bHWo/1PHks48Hqz4ytutqGvFlNgewgr4+t25yO07wfWmdKticJ
eW3y2LbZj0V3aJO5zX6M5janzMmcTdvbYe8Dq91r2+Y0Q3Xyaesjx1l6q4NPpz7wOtvzznWhbfbx
at+m9mvnNeGxnLtCM3Jb3+Xq1xzrzh8Ptvpy+xXqR3MeU2C7bjnHvrA6W+RP3WnGmPuymTFUedZo
f8bp9HzUoYzyrLPVVq/TM22nZ/Mttv264K+oT01zft7t9Mza6Xl3oWflpfRBgTYVq1cv0G9KWwu1
t0DdZfssdL4KnbNifVCsrYXOZbG+K3YsxcZB536Oz97L2L+sbWXW63AV33+/eJvHn/3XUtZ3r5gf
NiMf26fJud8e/Npx5tLwyLkf5HPzvbK8vhdl+a8Nv1ZJccWYccWsQ5P1iPn9fq0zZ+AycgPdzM3M
nMCcx7dhTmv1p+f7zs3LzLmIyRZbTLa2y2PrPdOuybYpV37WcixZy2gyc5uWzuPKy52s+Y+5zZpT
WSjm9WaeZR6/dZs17zK3o6/yck+rT/Npudmnvvz+1a15mNmvZp26lpeD5c4B9snlKGa+a5F1a05l
y4fz6rXnTNZ8x77NXpdbPmUpp1tzE8m8HE/ca+25UaH92/KZ8+uUP5n72uu05kftRbbZn1GYfWjP
Raxj3/50355zFdgnLwe07VM05zLr9Ni2O9Vr3c+c0xbKx8x5SqEc0Jp7OL01sV77tvxLd2hHLr+2
z4ct5XLzeq+lvmLtMetxapOlbN42W+6m28rmzQ/tx2Bu07X8NzFO7bW/bWm1vf0y+98hF8ubT9v7
q01T59qWnCyvXdZjtp4b+1zZ+sbGoc7cubEcv2OeZ58P23Npp9ygq/sVmn/b+6dUn+Z4KLJv0TzG
HJOaWmfevg77O+Y25jan/KTdoc5CbTXt1nY55T5m/S45ovI2wcmnVuAYzW2dx5qX4+X1hfV4Idvy
WnUVBvKpyA9Lmsva530HknscSC7U1fxLK54jdKkPzG0FjlGp01Zvsb4ru/8KHUeh/il0jMX6r/Q+
sI62zpV8/J+BVX8K7kosizyrDa56IPhe4reRLRiLcsstkSe0msQtwVYhHVO1nv5vrrzDyqFobegI
+v3RYU3fTo1/kVyu6TP9ir/NJ/r10EuemiKrAV8jJWZZDXjckVS8SPl/85WAKH+CFtIOD3xz9oXf
v/gCTdO1w7Xj+nlGFdt7R97eQbbF/6VLZ5x9gaazLdpxozwTiu37NinH5Vr6Ve34Ucd7B89y2+N4
c21k9LDwB/q5553n0rq7LH1x/KSTWU3NlJqBJw7rXJluvsWLvhk6in6vFKin0nY2BsQqQumiZ8K6
13HVpZ8F0e/VH99+f9Go6lK/U8cPGt7Z78ika2J3ho6iX+n9/vePSb8fhL6O3dSVvg5QV+f/ieBc
3OHxqSY+OnQU/bY51PYqySPsPR4/P5SO1Iy94OLvn4uLJ79muoJq4k9SnU8WrPMIW52fvjJsVug0
JhJ1oaPoV2oLP32lkavNetwycpu/hVRJWGvUmg6vilVpg71TvP8Mvlt5CtV7jnbeaWO/MZA70c4i
TR976dmXTB+oFf7nDO1Mzyc975LkpV+QN3DtJ5dfU2QP+Y+ctYiW5PzXeFf65rJ7fXO51OsCdm+v
C+x/BsG71ff7gCb4FPgS+Da4T9LPwCPA48CTwTPAs8ALwavAG8E7wYfAJ8EXwbfAvZKBAHg4OAA8
CTwdPBO8ALwSvAG8A3wQfAJ8AXwT3CPJ/OBh4LHgSPA08Fvg+eCPwevB28EHwEZwC7gD3C0Z9IG9
wf7gCHAcOBWcCc4FF4LLwNXgenAzuB3cJRnSwQTYDxwOjgWngDPAOeACcCm4ClwHbgKbwJRk2AvG
wb7gMHAMOBmcDs4G54NLwJXgWnAjuA1sljQ8YAzsAw4FR4OTwGngLHAeuBhcAa4BN4BbwZ2SEQ2M
grXgEHAUOBE8D7wCvA68DbwffBx8HnwD/BDMSlZUgceAg8FTwQngueDl4LXgIvA+8DHwOfB18AMw
I9mrEqwBB1GAs/0ZFu9rvYaO5Ftf880dqRW4J30pd1fVxcy1KnBTZDr/aQO8Hfob+hDrHCw/2ukL
ZbQjPgW+BL4N7pOU0Y54BHgceDJ4BngWeCF4FXgjeCf4EPgk+CL4FrhXUkY74uHgAPAk8HTwTPAC
8ErwBvAO8EHwCfAF8E1wj6SMdsTDwGPBkeBp4LfA88Efg9eDt4MPgI3gFnAHuFtSRjtib7A/OAIc
B04FZ4JzwYXgMnA1uB7cDG4Hd0nKaEdMgP3A4eBYcAo4A5wDLgCXgqvAdeAmsAlMScpoR4yDfcFh
4BhwMjgdnA3OB5eAK8G14EZwG9gsKaMdMQb2AYeCo8FJ4DRwFjgPXAyuANeAG8Ct4E5JGe2IUbAW
HAKOAieC54FXgNeBt4H3g4+Dz4NvgB+CWUkZ7YjHgIPBU8EJ4Lng5eC14CLwPvAx8DnwdfADMCMp
ox2xBnSIdvo8Ge30eSVEu0+vpsDm+OeeRWTznSwjG/Ep8CXwbXCfpIxsxCPA48CTwTPAs8ALwavA
G8E7wYfAJ8EXwbfAvZIyshEPBweAJ4Gng2eCF4BXgjeAd4APgk+AL4BvgnskZWQjHgYeC44ETwO/
BZ4P/hi8HrwdfABsBLeAO8DdkjKyEXuD/cER4DhwKjgTnAsuBJeBq8H14GZwO7hLUkY2YgLsBw4H
x4JTwBngHHABuBRcBa4DN4FNYEpSRjZiHOwLDgPHgJPB6eBscD64BFwJrgU3gtvAZkkZ2YgxsA84
FBwNTgKngbPAeeBicAW4BtwAbgV3SsrIRoyCteAQcBQ4ETwPvAK8DrwNvB98HHwefAP8EMxKyshG
PAYcDJ4KTgDPBS8HrwUXgfeBj4HPga+DH4AZSRnZiDWgQ2TzjZCRzTeitMg2OC/zt0W2JCJbEpEt
iciWRGRLIrIlEdmSiGxJRLYkIlsSkS2JyJZEZEsisiUR2ZKIbElEtiQiWxKRLYnIlkRkSyKyJRHZ
kohsSUS2JCJbEpEticiWRGRLIrIlEdmSiGxJRLYkIlsSkS2JyJZEZEsisiUR2ZKIbElEtiQiWxKR
LYnIlkRkSyKyJRHZkohsSUS2JCJbEpEticiWRGRLIrIlEdmSiGxJRLYkIlsSkS2JyJZEZEsisiUR
2ZKIbElEtiQiWxKRLYnIlkRkSyKyJRHZkohsSUS2JCJbEpEticiWRGRLIrIlEdmSiGxJRLYkIlsS
kS2JyJZEZEsisiUR2ZKIbElEtiQiWxKRLYnIlkRkSyKyJRHZkohsSUS2JCJbEpEticiWRGRLIrIl
EdmSiGxJRLYkIlsSkS2JyJZEZEsisiUR2ZKIbElEtiQiWxKRLYnIlkRkSyKyJRHZkohsSUS2JCJb
EpEticiWRGRLIrIlEdmSiGxJRLYkIlsSkS2JyJZEZEsisiUR2ZKIbElEtiQiWxKRLYnIlkRkSyKy
JRHZkohsScfI9hYi21ulRLZVFNkKz9n8t8jIRnwKfAl8G9wnKSMb8QjwOPBk8AzwLPBC8CrwRvBO
8CHwSfBF8C1wr6SMbMTDwQHgSeDp4JngBeCV4A3gHeCD4BPgC+Cb4B5JGdmIh4HHgiPB08BvgeeD
PwavB28HHwAbwS3gDnC3pIxsxN5gf3AEOA6cCs4E54ILwWXganA9uBncDu6SlJGNmAD7gcPBseAU
cAY4B1wALgVXgevATWATmJKUkY0YB/uCw8Ax4GRwOjgbnA8uAVeCa8GN4DawWVJGNmIM7AMOBUeD
k8Bp4CxwHrgYXAGuATeAW8GdkjKyEaNgLTgEHAVOBM8DrwCvA28D7wcfB58H3wA/BLOSMrIRjwEH
g6eCE8BzwcvBa8FF4H3gY+Bz4OvgB2BGUkY2Yg3oENn8v5SRzf/L0uZsg4rM2QKnyshGfAp8CXwb
3CcpIxvxCPA48GTwDPAs8ELwKvBG8E7wIfBJ8EXwLXCvpIxsxMPBAeBJ4OngmeAF4JXgDeAd4IPg
E+AL4JvgHkkZ2YiHgceCI8HTwG+B54M/Bq8HbwcfABvBLeAOcLekjGzE3mB/cAQ4DpwKzgTnggvB
ZeBqcD24GdwO7pKUkY2YAPuBw8Gx4BRwBjgHXAAuBVeB68BNYBOYkpSRjRgH+4LDwDHgZHA6OBuc
Dy4BV4JrwY3gNrBZUkY2YgzsAw4FR4OTwGngLHAeuBhcAa4BN4BbwZ2SMrIRo2AtOAQcBU4EzwOv
AK8DbwPvBx8HnwffAD8Es5IyshGPAQeDp4ITwHPBy8FrwUXgfeBj4HPg6+AHYEZSRjZiDegQ2QKn
yMgWOKXUyFZ4zhZIIbKlENlSiGwpRLYUIlsKkS2FyJZCZEshsqUQ2VKIbClEthQiWwqRLYXIlkJk
SyGypRDZUohsKUS2FCJbCpEthciWQmRLIbKlENlSiGwpRLYUIlsKkS2FyJZCZEshsqUQ2VKIbClE
thQiWwqRLYXIlkJkSyGypRDZUohsKUS2FCJbCpEthciWQmRLIbKlENlSiGwpRLYUIlsKkS2FyJZC
ZEshsqUQ2VKIbClEthQiWwqRLYXIlkJkSyGypRDZUohsKUS2FCJbCpEthciWQmRLIbKlENlSiGwp
RLYUIlsKkS2FyJZCZEshsqUQ2VKIbClEthQiWwqRLYXIlkJkSyGypRDZUohsKUS2FCJbCpEthciW
QmRLIbKlENlSiGwpRLYUIlsKkS2FyJZCZEshsqUQ2VKIbClEthQiWwqRLYXIlkJkSyGypRDZUohs
KUS2FCJbCpEthciWQmRLIbKlENlSiGwpRLYUIlsKkS2FyJZCZEshsqUQ2VKIbClEthQiWwqRLYXI
lkJkSyGypRDZUohsKUS2FCJbCpEthciWcoxsHyKyfVhaZBtYZM7G7pCRjfgU+BL4NrhPUkY24hHg
ceDJ4BngWeCF4FXgjeCd4EPgk+CL4FvgXkkZ2YiHgwPAk8DTwTPBC8ArwRvAO8AHwSfAF8A3wT2S
MrIRDwOPBUeCp4HfAs8HfwxeD94OPgA2glvAHeBuSRnZiL3B/uAIcBw4FZwJzgUXgsvA1eB6cDO4
HdwlKSMbMQH2A4eDY8Ep4AxwDrgAXAquAteBm8AmMCUpIxsxDvYFh4FjwMngdHA2OB9cAq4E14Ib
wW1gs6SMbMQY2AccCo4GJ4HTwFngPHAxuAJcA24At4I7JWVkI0bBWnAIOAqcCJ4HXgFeB94G3g8+
Dj4PvgF+CGYlZWQjHgMOBk8FJ4DngpeD14KLwPvAx8DnwNfBD8CMpIxsxBrQIbKxpTKysaWlRjb1
bzL19LL+Tab6EJTma/XMf8Tfaup/Rjv1qAnnXnhJzYAzjqs5+6JzasZcfOkPZlw0rWbA5As/M/i4
vDV1i8QaaC0wTbsJXOidqQ8MbtHXaB7vTq3If/zD1pXZdKsWbpUfn25u41/H5h/XbpOf0W7P8m8D
i69st4svagfbtFbxue0w/4h9q/iaNRerW8Wnq/nn2utbsmTroK5JZzX+MeUO8aFrb5P43HWTMOD7
xUCvDs1bl822a956/s1jrtZn+TeJGf/kOlez2YY2zZfl35ruleFf425v1XzV/OPUXGXZ5lb+nfdm
jX9HmQ6poUXTs2lNi/CvNWfSml6XkUp9Os2dSiXbnOZfTm7QKnz8m8yNaf7h5EYt4hOf195PXps0
g3/mOrOP2tcs5XaSqyGnSa6E3ESyDrmRZE+zFuZyw16NxBANKLZH81wipABJA4XkI6mq2Ckq9B9V
wT/tDRj8w9+NbfIL7B28Q9KdSjX/1jlXKjrkt8rbzU38dEiFf41afJu8U9Xld9NNVXybvFOtlB9Y
FxVl8OF1rlRmNH91trGef2A6p2e0av5JdFOva9cY/xp1Tk/LT1XndDqPVl18lDxt0Rs18al4q16d
segNmvhOulXn30kX30LPaAH+CW6df5LbahAf7oZBo1HnzRkqJTz8U99WnX8L3KrX2XT+vXGrzj9I
nqdn8nX+0XOrrufrfvEd9Ty90dTF97zFJ+Sh13Odf93dquNz8EJv5HomX6/O5vQ6Oj0+uo5yOp0O
usCacjqdDp9OFxz0ajodPg81WOo05sihTterHC78kuwQHzi3qnWmyoRabaq6UJmpioPjw5HGufh0
ebuWkaOZDqtdRA6pVXOt0tQY1zxcY3QJ1hFLv7oYH5GNrYcIlthtdD/R6tupp/lNpLINQh0XAq10
3+jgtw/NYwq6KTBTqFSEagg0oprSGmvj8Xy/ZDuYlqxvBptsbCyNdXZi/2qTqL/SJPwytEM3md0v
GkwDlRrcKm8snHXNktXtad4vNOqbWhx6StyA2w6krzo7ra5Qp9V3U6cpnddk67xmW+fBbyXawTKl
dlrG2ml8PmIebLcKJd16KWwO3C1Qt5vCFB+Ce7Rghnc33e2lkN6rhTLidkuTAUg0dQhnRNjTqLtM
MQOxg27GaSEyEulw+RRKWOmAeQBsz7aIqRa30XyHT7XI1ipmZ9VkS8s5m4cmahT6+JROWNv5ZUk2
ivDhFnGn5hO1QFoTF2paWEjYj/DMBRF6g/sQWnn4zMIghMA+zSxZyYXAfo1XEU5jliDF+kzOJ5OT
BS7WyzkHbx2fYGTahMj7oalNDvQOHBK34TA9HTj0am6T3UE22UXcRrM6stGRNcge5LOTdGcX01yu
8xR0nhZ5ppr3ynOYNc9hU+7UNeRKp/dZKzNFGtRBOfmRNg/OIVqFc6jLcyhOHe8eKfKT3CiPlPdJ
Worc2iAm4R252XilmI23yuqbZTdWd/aoqF52eZ3sfX5SmXJSKzPWc8gFlsUmj1lG3IL57noHhDoh
tIihJk9mnRxAImXAsJIpAx9qZtLQIDKFdjEo+Rms5AOVhHZ5TjuEpUV2Wrvsnowcr5m0/XKwXiTy
0il8MtN7Oy9E88rEhYrLtpQrvHNmnj9blzN4y7TeOttXsgBrdmDNGpBN5KUZtgzEmpwoaUsuocnP
dWyJkD1NsiVRaoplScCUBE1J4SzpXWfK15kGWpLDzoSxM4m0pJad6aYlBTXT0i7kRQf/v7C8d2iU
T5hiBmIL77GcmO4U6eSFuJjOejqlhpzUmJOaclKz1otCRGW2kc+6qXeEWsdjCk+82oXKEyXGryOp
yrSmgU/Ie9E91sOTBjr5ulR1ypD8dU1UQqiMTpu/mmcMQq2kCb6/slOlM+lnPKo39BJzIlL1dkWt
E2pdI89ObCq/CBvz1OrGijY5hffla9nu03q1ydyGkiU3VbauXhxKTq0TaiZ3KKIbOtU0VHQD78LK
zl7hHVzdbnZhNe/+Op6o04RPXLiUmtJ51IVuVPKrlJ9bqo/rjCfUlaRXS50nUxS5mzxkj/DbfFvW
18gVunBIbPBQVZFWMf/28eihVbSKKOrnsaRJaHQj8YsJvdDoDuFvFuOjQt5b/I28bVpFixaq40FB
46eQaxQiaCB4+OBK8xtl1/IB1qVZrjrdtWQEzXJyW53dnz/JTZeYGXT3ZLfUTKHkSS8yhcqPftJr
/c+g+0J1Wu57MOVSm0c9p/NnN3R74XIll9ulXCee6bTzK4VOJx6cRFrl0x8Pf0hV0YZHPx7+iIpr
utSapcaklnbSKqVGYSCC61/8Tyhp/kjCVJo7ZPyNIMSI2JynGGKcyWdqVjkixiGPIhQ+Ioh19L+D
rOS1wFTs7XQ+sgjiKA1/p67JU9rFYzKpVIpnbO1mTzfwaZHUGH8wlTsLTEfkNDWKd1muhWXU5JPl
II+Zualru5ifiNDULgOqzJKkyDCzxQS8SeRTfCbapoVa+BSNP2stHBg/0gCULh6APDxw8sGP+FPf
hPiTizuNH4O4Y/ZtZ2/nTgAJPI1CPon0KP+ciZyiPf/sdp5xOQr4OJH3VlzzjD/K1KpNjd+W+b3Z
OQKIkZjGIBXXPAJApRi+7a4BwHoxuEeDwtfff28EsHZHXkfldWGuc/P7XTkn+efLdi47z7NrEMDQ
sQ0oDLPc0CsrGtiHtnjUvseVIu1rEs/xWw4pH3OFPxKq288DXXcLH3mu6zLd99Itch9vcHcLNHXz
V/L8R07jRFZVnRHTuEC9yJvMaVwDpnERJLwi6nBF55GEBxquMB5jKs2YzaMPa7couhmzRcQy41Ij
lEJTMyE32OT6jp4KvsUjsVCaLIoafUuYjFnnXzx/FdPZzvlXXS4WN1mir8hcWWcsPsD5l557iN2F
2dehnPT/fE7Kl0DociVEvTyHHvNkVued1TJeQfKhWkkjNCPFajlq6SoIVGe0+oZKGqV8bFc3kyJS
SK7VNWn1jVp9Y06ra9SqMesgkf6rxIykroFrDFo9aU2ans7TkNnUk/MmzZOnaZlOrdmu1ee0ynwt
bdfqOvhjqaCpNWRMlbUXVKnhNlU+G3NWG/mzLa2+U/VYVH5YfH2BqTaLB1Nc5W3kTeLzNNliseKh
Wc92Znv17ZVWLZvNmNGGuj2neaTW3qlVCw23Df5sWyrU40zEKK5Qy3QxQeQK483kZ5jfdvgjsHo6
92wfv4DaP/o7bokB79Air4/3Ii8euzwd1kjGJColqjvE268aedVycaC8nLk4Uq7qMUj8fAvSRZK/
2CJv6lyua5GPT0RPNbTKe7mcs/LIbirN/BFABkq6VT7JqhD3eXFHSEPLiIdizdCycgIg1+pUZ+Ua
nEZznQ/NR+RioAp5CvnEhUdPcX7TfH5C402u8iFnXjHD46t3+CXMnUitPisWtdHdv5dY0NZg1s1V
8dRNeq4QxZrRrApRRZqPiIzUqHrxgK5Ni7RrAfGMm88fuFKf5ZOWZqlU87cm2SapUP18/VobX2Xn
5+OPTzW4zEdffUbK/Ek8H69hPoIznqx8n+urz+p82HKxLntttkmKldlNWbz75RcknRFxL8pkW/jr
Hhqf2YxYGUJXRFoKdKVIoQ6LRvBsRqyIoAuB35l5czg9dC0EaJbTLjFLgkbMxycxOfSC9dALVrf/
ijz2M5/FNnY+nGnOyxuKPu2z5CH5CYqcTvAVMZ2pjOXBsuWhc+7xfp1jpmTNofKf7jk+6hOvLJtE
eHLP6XrmkZ41X83ltPVqflttlfna4YxDppyXQ4tUO6fwbmLIu/kDP1E2P1c3X8bwibSYqDVr8jWN
SPzF4p52PBBo0vjtQuQM++na7XahC1OtQ+sfD61/tHbe/8H1j51phVgbHG7hc5tGT5O8Kj18nUJa
yozLeExXLdYvNCDfEkqjuKYzWb3RfNfKV6JxTQZjfi9UtVxoTtc1eszcjmZDPMXOaSLbRhZY3S6y
bVNLc02HRtMEkZdaNc3UmvK0RlMTebHUzGTWrjYcXDWb3wwzie5scqfmyTu4fM1MsKub87S0tfsq
261dS4k5f8iRew2rWU4CE6fE8kqmrlE3NTpvdY3iFS0GgMi3zZs1ngvWdT4XrLY+F8zkPRe0LYwU
q07lQ8Jq8yGhnntIWF38IaF43dK45/88ey4R+KiP7GDR9vfuL9Rq2IO+uezBXhdoNd7lvrne5erf
bM+u6HWm1ko8D5wIjgKHgLVgFNQkAzvBreAGcA24AlwMzgNngdPASeBocCjYB4yBHkl/M7gN3Aiu
BVeCS8D54GxwOjgZHAMOA/uCcdAr6UuBTeAmcB24ClwKLgDngDPAKeBYcDjYD0yAuqS+C9wObgbX
g6vBZeBCcC44E5wKjgNHgP3B3qBP0rsb3CFo/5vIl/eaoo2k0TBL0PnPn87UzK9jfF0bEBxQscs3
eOjAwn93CLsiskWOSHAiOAocAtaCUVCTDOwEt4IbwDXgCnAxOA+cBU4DJ4GjwaFgHzAGeiT9zeA2
cCO4FlwJLgHng7PB6eBkcAw4DOwLxkGvpC8FNoGbwHXgKnApuACcA84Ap4BjweFgPzAB6pL6LnA7
uBlcD64Gl4ELwbngTHAqOA4cAfYHe4M+Se9ucIegMiIjG+WIFCw+Imk0Rqb7Bg8pOhqNMXI0ghPB
UeAQsBaMgppkYCe4FdwArgFXgIvBeeAscBo4CRwNDgX7gDHQI+lvBreBG8G14EpwCTgfnA1OByeD
Y8BhYF8wDnolfSmwCdwErgNXgUvBBeAccAY4BRwLDgf7gQlQl9R3gdvBzeB6cDW4DFwIzgVnglPB
ceAIsD/YG/RJeneDOwSV0WicKkejoOtoDL/hGzy46GgMrZGjEZwIjgKHgLVgFNQkAzvBreAGcA24
AlwMzgNngdPASeBocCjYB4yBHkl/M7gN3AiuBVeCS8D54GxwOjgZHAMOA/uCcdAr6UuBTeAmcB24
ClwKLgDngDPAKeBYcDjYD0yAuqS+C9wObgbXg6vBZeBCcC44E5wKjgNHgP3B3qBP0rsb3CGojMbQ
n+VoFHQdjaFv+gYPKjoag4PkaAQngqPAIWAtGAU1ycBOcCu4AVwDrgAXg/PAWeA0cBI4GhwK9gFj
oEfS3wxuAzeCa8GV4BJwPjgbnA5OBseAw8C+YBz0SvpSYBO4CVwHrgKXggvAOeAMcAo4FhwO9gMT
oC6p7wK3g5vB9eBqcBm4EJwLzgSnguPAEWB/sDfok/TuBncIKqMxeKIcjYKuo5E946PQWGw0Bn4n
RyM4ERwFDgFrwSioSQZ2glvBDeAacAW4GJwHzgKngZPA0eBQsA8YAz2S/mZwG7gRXAuuBJeA88HZ
4HRwMjgGHAb2BeOgV9KXApvATeA6cBW4FFwAzgFngFPAseBwsB+YAHVJfRe4HdwMrgdXg8vAheBc
cCY4FRwHjgD7g71Bn6R3N7hDUBmNgeVyNAq6jsbAF32DTio6Gv1Hy9EITgRHgUPAWjAKapKBneBW
cAO4BlwBLgbngbPAaeAkcDQ4FOwDxkCPpL8Z3AZuBNeCK8El4HxwNjgdnAyOAYeBfcE46JX0pcAm
cBO4DlwFLgUXgHPAGeAUcCw4HOwHJkBdUt8Fbgc3g+vB1eAycCE4F5wJTgXHgSPA/mBv0Cfp3Q3u
EFRGo/8TcjQKuo5G38O+QSMHqn+3k2WPl0m5IpeJX0J7PR/SfFPPPftS9bkR/66z7Vu5bBFd/8/7
btT6+P5Ov230e5d+H9AvRb899NtLv31aHz2Nr/u2Wn78G9Lttl+Hwy/TST0D3frL2uSszZ5Vf7qT
XXMuq2yzyLp9H61MQtbt25zKl2DT7Ta7XOI2vYv7FazLpUwpdr3Usi7lHL9uXWifItscjqvzG+rl
+ih2fGX2l+PxldiGsttT6rEdYFu61KYivor2URnt1Ess53pc3VBHj9Rz4PXlroluGwMHeM66NAaK
1H9A9fRAn3f7mOxiv3RbX7vV01NjqJR6uta/Be8TH/sxWex48uaJjf5TPHKG6H1EzBAP1hk5VM9/
VT0fxzb1YD3FZ4j//cf3kdd1qJ7/rnp8bjPE/wPHeKie/742fcT19MwM8aOrR5khavrzz2uYIfpX
iRniVvq9r3U+O9xHP/7cEM8Ldc5izwrNZ4BW2eHZoO70nLCU537d/exPs9TjtK1MuWg9TnqBMiXl
oeU+hyr1GV2BbSU/1yjlOdSBPGcrtz0u9Tr0dddniE7nrgttcmxXF/uru56zfWRtKlLvf8UzjY/q
2UhXx6Lz78BmiN0xvru7rw7keXRPnzvtAJ6z91B7SqqrxDZ/7Pq6zPbj9981Q3Q/NnWG6LnOQ3PE
Wj5D9D1KZRrp9y/6vUW/9+i3U8t7z6yb80X7u+Y2y88+f+Q054z46fY5ZKFftgizuIbc5pclzD31
QvPRcmTN4R1zuTTb42BzKue2veD8sNhcscC2st97F7A5xr0S5roF21NOW5zao9oLzw9LmFMXvKbL
nFd36V1VoftwqXGvnPlhObG0nHtxGfWWdWxF/JQch3sqZ7H5+FjMn/OP4cCfIHbnfKwr587l1yPz
sQOos8fnhz2dtxSp/yDPe7rvuApcEz16fN1wjF18gniXtlzzeLTcmkTrtynNL2He6bvZd5/WR+M1
PA6+Ar4J/hv8EGwGd4N7JPnsUuj7wbSNLWCrjW0F2O7CjgI6qJt6xra9kF6IZrmsS7lC22HX7dsL
6Xa6be/ifnxUdalek277F9pewK6Xu1+Z9RfY/07tbrpSHtH8muatqZE2/k3WVb6fiz8DLq4Rz7vE
7/pu9VBWpWVI/pTvNi/ZAm/47tD4qtv3SF7qu8/bgusjS/qZvrWejJbLuHS+XvxI3/u6mUlZntBz
mzcr1pGf4Mlqjk/ndb79n/4L87KdbGc5utJr/c/4V3s023boYv+1/p26zW7KYv9HA700La8/ZFT5
Q15EsUaSgv2rjK9CernntYv1FmxPd7XTrVwBe9nt6qKfUo9D72k/ZW537Z+e7qfi/eMaP/g1lXcd
arZr7sHA17wWm7WcuGbvC9zkOIOR7an1Lw9s8Tptp5+Xb7+DxRz317D/EvZNr5Zfb97+i9h1ZceE
A+zjAy1X8pgpt1wXx1rBa6qn/B/s9nTTfq7tOsDzUC6VOUlpdI8JdE0VvSZvYc8qMUGzXJO/CIY9
0HXb9lxcuDF4hjXW6PY6FgYXeuz7orxutmNecINSP34idl0X0suODQd4TgrtX/LY6SH/ZbfnQNvR
1fYcZL8HrT0HWF/B89W97XOPDXRNFXpiIK7Ja0KjvAW2i+v656Gri+7/k9BfvQ7bcvs3hFnR/a8K
j9M15ydlYv8rw1eVHRPK7OuDdq2XWH/J7TlI7erifavH2v+x65+D5KfE43GPCXRNWa8z5ZqcG15f
9JqebWhO23L7zzK+5Lh/FvtfYfy0aEz4kfFUUf+XGS3lxoSyx0wPj6mPfAwf6LznIPVbt7Wnm/qv
y+3podhQYnvcYwJdU7rmfM2Jufn/Rk42r0l7OZ1vvzQy1x5TdOv+P4ysKTrPuDjSUTSmXFTxxaIx
4aKK/y03JvT0uSl7zByk+8d/bXtKa5f7WKexYh+reWPtwopHij4Du6Bib95+Wdv+5/caXnSszux1
VsGx6vDGTdPEOzfr2JXv2pbguFeDm8DXQfs7tw/AnWAK/W979+bbZ6P93ZvbO7hS38WZuu3dm17o
3Vyp7K53dNCVd21dfGenbC9Vt7Hgu79Sad/Pfl2VSb3Qdrd6S/XrXK68d23vivdsi/CebangUt9v
PDSWvc3i/dpKfRfJ+8R7tTXeVs38m3Rq/a/6XuNj0rq6kfRa/zJ/Qrxfc/6bc2ge7J+o2967CTmL
e+L3/Lcq79fwE8/qv+5/xfH9mrn/6C68XyvQ53qhc1GqvVzdpVzB97cfld7VdpVrL7M+vat+esiu
jCN7ue7263a+8re7zw3omrJea7pFFtfc5wNf89qvSYwLnW8fErjJvs2kxrefgPdrDmXE3KA/i+XN
OexzixrL+zVbObH/0Qfh/VrPnqMDn48eYD0lP+/qaj+UWe6A29ND5UqOPd18fkqOhaXV7x4TjnZ5
v3ZEgfdr5jWZsLxfs5cx66jC+zWHcqKOCsv7NVsdullHOLih0EpREbtYF96vdddY6p5z1f3ltRKv
sS7W22Pt6e52uuzver56yO9Bjz35dI8NdE0p15v1fu93eb/mLf5+zZct8H4NscXXEWZOvnP7t9ne
r9niiq/lAN6vldinPXatd3H/Hh/LH9f2dPV8HWT/H3n/FK/XNSbwa8rpesxdk/tt79fs1+Reh/dr
lpji213g/Zq5f8r4qdO23P7NxlPFYpLvw4P4fq2Hzt3H7Z31QRvL3X1tHaTzddDOW5nHUWL/uMeE
D4u/X/N9YHm/ps7va33v4/1avr1z//eKv1/zvVv8/Zov6fB+LWvZ/50DeL/Ww2Oox6+pcttzkP25
HWc3X+PuY/0dvF+zjaPcWHsb79ccxqsYa2/a3q9ptv13FH+/5tte7vu1++/PZh3erz2I424EXwPf
Af8Dmn+GbRdoe4+m2/8MW4uN5nsw+3sz+3uyMv/MWqH3X8qfZTtQZl3s9u02u17ue6yuvveyj+8C
VN5nue1X7vZC5QuUc21Pz+jlvV9L0X1ov3jHtthD14Fnn3jPdpeXrgX68XdtD/LrgF8T3jbxvm2L
eHfWruX/TSH8z65laPtx/mihvwWEX5+BKv83cs/hs1reuzWRV2f9N+dij/nrPMZa/17/S07P8XP7
f/Ax/LNrbuVKtOsH2V+p95mC/XSA9R5we7qrXQdYT9nt6eF229rj/qzsA5c/u/ZOkT+7xrc34c+u
2ecN5jX9emCL17avdV7gf8XyZ9ds28X+L+HdmkP9Yv8tB/Burdw5YTeVV8bMwWpPaWOm58dsd7Xn
QP2WuX+Xr/Uear/etf3dY8IWvFtzyAXENbkR79bMn/2afq7In10z63jW5c+u/Q3v1hzaoJt1/MXl
3dpT3fhu7QCvzbLHdHePMVt9XW5PD7Wvi2O5x9pZcv8cpPaWfb661i732PCU7d2a/X79RGhU0XW6
60NXO12vufnCWpc/u7bG9m7N4kfs/5jDn12z7v/nbni35tLn3XZtddNYO0hjp+vt6WF/3X5t9XB/
dlt7uqdf3WPCny3v1qw/85p+FO/WHO7V4pr8o8ufXftD8Xdr/keKv1vzP1zgz66ZOcTvD+Dd2sEe
uwXOcY+P4S6OtYPeLpfz8f99e7rnfLnHhN/j3ZrDNS/m5g/h3VpWvVfr4u/Mcfmzaw9E1hSdZ6y2
vVuzz1NWufzZtZXd+G6tm8/VR36tFxozH/F9vIf6x32sr7S9W7P8xFhbYfmza05j7f7i79b897n8
2bX7XN+tmd/R5u2e4v1n8N3KUzQmLAO9b4ZX+F+p+K022Pta+G7/topV+Lsj5ZZNFcu0Gv+m8MNC
Osb7Pv3f/LYhvoGtDwhv0QcYFxf4HvfNog8X5dpQoX1dG6CfYVwfrDnv4kt/MOOiaXw7vhaPv8my
Rl9IdS4sWOcHtjo/fU6kZuwFF3//3JopNQNPHNZZn/mNHb2Z6msuWN8Wpb5wzZfPvuicmin5tcm/
j73GNyG8xTehYG0tDq372g/OPfsie+ty3xIXf1enb014yxH8XekaIwZ+8witgI/2Ij0waOBAS5vl
n1Ss9dfI2v01snZi4dq3FewPW93iLW2t/+eo++eo++dF6m5V6jbM3hlk/Va7HLvX58Ywj7WNWtPh
VbEqbXDoCE+wMh36HtV7jnbeaWO/MZA70c4iTR976dmXTB80WCv0j6ePdown6zmBRLp8qOfJtPaT
y68puIP5j3xLLVqS818TOse7otej3hVcCi7s9WhwoVYbuis4YaTG6V0xslA/fAn9UBVoCk7hP21A
6ClvhT74xM4erg3vkDWFd5RQ0wDDR/sPsoyw2kgfuX+kTyn7R0aL/S3+K34g96/4QSn7V1xN+1tH
eG2v5XL/XstL2b/XX8X+nf5R3tMrV/5lOmlHorz17luhXULtH5VdExPjlP/koBpwxnFa3hlbpMX4
Dr6h2k3gwrDmuanXUO/Rmse7Uyv+X7BF81Zm061amMYxy2S15jYtSGJ9R7ZNC7eRrZ1s7UKsIzHT
rgXbtNas1tChhemiZSQ2S7GaxPYOLUhifUuWbB3U0HRWa8xoVSTqmay3if9faxIGvTKbTWdM9OrQ
vHXZbLvmrc9mpFqfJb9els1KNZttaNN8FKo1rVdG8+rZ9lbNV51tkirLNpNK/6euy/BDamjR9Gxa
0yIZzVOXSWt6XUYq9ek0dyqVbDMpLNugVdDdx5NtJI3+r0VI07MN+8lrk2bovGf2UfuapdxOcjXk
NMmVkJtI1iE3kuxp1sJcbtirkRiii5Pt0TyXCClA0kAh+UiqKnaKqKjm6RDQJZhEpUQ1dTUdWw0d
bJ0UB6b5CRTiSBLpXBgkfr6F5niQv0iyDrmO5EqSRU81tGqealNpIqXOVKh/PfUZKDRgPFk62RVc
aW+jY82moWXa+MlphkajiM5NU4c4SdXZhnZ+bhqlSkK7MIqy/BS2kwsaAxXi/KZJy9J440WFM/5/
2tjBzR3CidTqqYncSbsYJ1SfWTdXSTA9V4hizWhWhagizUdERmpUPR8SdDiRdi1Aw46UtFTqabzQ
rlKhyrTKbJNUqH6tOtvYphntmp+Pv7psq5D56KvPSJkq1fh4DfMRnPGI643E+qzOhy0X67LXZpuk
WJndlG1slRcfXS10RuiK4xdOixZq4+Mzm2nh1yhdEWkp0JUihbpskxSoVVJg/EJgrfxspwU9dC0E
6I7eLjFLgkZMkA+F/dSV3S64BiHbf51XRf6VIq8eyyVlvdKUK9B6ZVqvWFzJeZe47eq3BgYlZOSC
SX6csQUhe4iyBTA1vFmCnxIclfBpCa2d4bYzBFsCc2ew7gzglrDeGeot4d+8JZR73j6S/6i1Wn07
H278CNog1JlCvRDogD2tEHRTYIpQaQrVEChu0DhgbTwm7hesy4DpfNY3g00F2Fge60w25bPaJPxV
mkQ7WLukjnbq1O6giM8N8vrno5yzrlmymgKBjBg8dPBBYnZCtwqln1DLfa5enkOPeTKr885qoFVr
dT+54pzyEV/ZRoNfilSPRrekSBvF8oxW31DJ7zltGqMQUd/gEfcj0uqatPpG+i+n1VGkb4LWyLXK
ZmgNXGPQ6kmjKzWdp7VDI+dNmidP460ytWa7Vp/TKvO1tF2je38vunhNjW6CUFl7QZUablP1TGG1
kSIdee1UPRaVHxaFy6ypNvOhJlTeRt6kbBOffQiNas0269Dozk1XcKVVy2bRCzppdTnNI7X2Tq1a
aJFWukM3aTxYSoV6nAJrs1SoZXqWT0G4wngz+Rk2Wum2TJ3P5xtsH7+A2kuNN3Qx8ftzC79rN3po
2iHqosDuSUuZcZkCrfDOZe5QtEsojcJ7JquTLMeT5pGaHEE8yqta2uyfdF2jx+wDus/zoZjTxKhE
b1W3i1Fpammu6dDoBijOn1XTstaRntMaTU2MH6mZJ92uNhxcNZvfDHOwdTa5U/PkHVy+Zg7E6uY8
LW3tvsp2a9fSAObBoN08JZrlJDBxSszTRRO8ukbd1Oi81TVW8hOLASDGJb/30i1Ma5Qiv0s3IOC1
0+jktsoOeedu5bExq6Wl6OmQuRm/BdK9m2a8/G5YnaH7eYimJTTqafrK0vzu5XY3N/gUkaYTvD4u
V3K5Xcp1XM6K4Uz3Jz45ksPZkxWKDJBeaHJA09xHaHII0yxHaGknrVJq7SIee6qph8X/hEJFPMxU
qC6PDqWO3IhkJk8xxI2zXWY8Fjkibqw8naARIpQGnmkcbCWvBaZib6fzkQlFdEDWqWvyFOpJTyUU
HlU9GJl8ssons7lx2qTlzgKNU2pCJc4XaTx2c43fLj3ydkkDsi03SOs7B2mddZC2S5HlD9ImOTLr
zJHJciOzznVkyslJe4toCp//NsuEqK6DduUzXQ81hZIxMeklMS1FMdeVIs0WNDoRYtLcKhrDRb1V
XjwdYo7AG07T8CCF6zS/d2TaMSvPiOyRjrBSzNlp8q3LGwim9MKKhFbkp3wmZap8hq+bqs4zVK8H
qTHPzPg4SMuMmmX5hQalMtMqzyNXqtv55WgqPPFmyMKreUquZyz5uW7N3D1Q6ikVlONOUSh5kcOz
qJIVCl2l/GlBNi0DwsGU8xpRRsMLH3leB+V1XV6n5ne3OBEZh1OUO3n559V20h2GhHXA5A8np9Fm
GYy2oWoZxLahbQ54y2WQf3FYLhlcSJ0Xl+WCMy/Cjzzfc44RXmr9Pj7j726BT+cq+aRN3gv91TzL
xtSOppz8EQLuhQ24F/Kw6xFhV6YYHj73F3cvrjAeqivTiM48orN2i6Kbt0ER+M2I3gil0P1NyA02
ub6jp+5hxW9oQmmyKOpNrIQ7mvUmxp9HijlB503MvKUxfolY5sZ8QHfe0g7wJoaZFt25DvAWduhh
xaGHFYceVhx6WHHQH1YcuhMfuhMfuhMfuhMfuhMfuhMfuhMf7Dsx2ysD7CH2LA/+ygX7qr6FWk2v
Ru+KXo1BkkJneVeEzhLr5s4KHqWN1Gp7XSdYfLWYWEdaOZJt1QedOLxzxVnoLHaJdjRfcSYZOivw
V1mnoMsKtMqRgXlU32BrfYGjZH2SobP8P5T1CbrW5x+qDzxxpLU+319lfZKkHy3rE3StT99G9Q21
1qf/UNYnSb35N1mfoGt93vlOK+4s5fmKu0tyfX6Jdvw/LjiMrzQ9+4Kay8698JJzLz37sh9deq5c
Z2c/y+b62/G9Fnkf7/Wo9zVtvFHpe8D4rG+TNj68yT80vNM/gaR7/VeHn/H/lqTr/evDq/zbSLrC
/0H414EKks4NxMJXBwaTNDkwKHxFYDxJpwfOCM8MnE9SXeD74e8GfkrSsMDl4YmBW0n6TOC68FcC
95LUL7AoPDrwKEnVgXuo7F9J+kTg4fBJgRdJigcaw0MCTST1CjwXPjHwPkmhwD/CxwX2kuQLbA33
DWRI0gLJcA1j2vhQe6A5fDSrIikd2B8+gh1O0t5AJtybfYqkFPOHo6wfSTtZJFzJTiDpPywWjjBq
fejf7IhwiI0kKck+GWbsCyS9xfqEfexUkrazY8MeNpakbeyEUJZ9maQ32MBQB/s6Sa+xYaE2NpGk
V9lJoRY2laRX2BdC+9m3SfoH+1JoLzubpBfZ6NBudi5JL7BxoV1sOkmb2ZdDzewCkjaxr1HLLiZp
A/tG6AN2KUnPs0nUxstJ+jubEnqPzSLpWXYmtXYuSc+w74TeZVeR9Fd2dugd9hOS/sJ+EHqb/Yyk
p9l5dATXkPQUmxF6k80j6Ql2Ph3LAiFdRNINJK1nF9NR3UjSOnZpaCv7JUlr2WV0fL8iaQ27PPQ6
u1VIs0haRNJjbE7oX2yxkH5M0lKSHmVXhf7JbhdSA0l3kvQn9hPqh7tI+iP7WehldjdJf2BXU4/Q
aAo9wq4JvcTuEdJ1JNGICD3M5lMv3U/S79lC6qWVJD3Erg9tYauEdCNJD5D0ILuJeu5Bkh5gv6Ce
e0hIN5P0MEmr2a9CG9kjJK1it1Jv/lFIvybpTyStZIuoXx8V0m0k/ZmkFWxJ6Dn2OEn3s6XU12uE
tIyktSTdx26nXl8npDtJaiTpXnYX9f8TQvoNSU+S9Dt2d+hv7CmS7mHL6Zw8LaTfkvQXId1DEo3x
0G/ZvXSeniFpOUlPQ7qPpGeFdD9JfyfpbraCzt1zQlpJ0vNCWk3SRpJ+Q9KTQrqLPUDnc5OQHiRp
s5AeImkLSXey34ca2QtCepgkurZCd7BH6Ly/pE0V8h9I/gdJt7M/0hh4WUh/IukVkpaxR2k0/FNI
fybpVbHPUvYYjYd/CXkJezz0OHtNSGtIel1Ia0l6Q0jrSNpK0mKSHoO0nqRtYu/FrJFkuspDt7En
Qn9m24V1EXuSxtEOIT1F0ptCepqkt8T2X7O/0Oh6W8i3sr/S+HoH8t9ITgrpGZLeFdZb2LM07v4t
pL+T9B5JvyLpEUjPkfQ+lZwqtOdJ+w9JN7MNNB4/ENab2UaSPyTplyT9HtImknYKaTNJzaLkL9kW
klMk/YKkh0iS9f6CvUDaLiG9SNJuYb2JvURjeQ/kf5BMsS10I0kPQHqZpH1i+43sFZL3o74bSFtN
Gpf+SVJaWK9nr9JIb4H8L5JbIb9Gchvk10luJ2khSStJkjUuIG2FsC9gb5DUAetWkjOQt5GcRfn5
rCl0f1CDvJ1kD+QdJHtFKa7PI/0+oXP5TZJ1IV/H3grdG/Sh1HXsbdL8Oe0d0gJCvpYlQ78LMmy5
lr1LWlDI15B8j5CnQv836aGc9h5pYSFfTfJvSebS+yQZKHM1+w9pEZJ+TtJykqYK+QOSK3L1/px9
SHov6NzyM7LcTRYu7SSp0rKlmXR+D/opSb8haaqQUyRHc6V+ynaRHrPou0mPk/QTku4iaarF20/Y
HrIlLPpe0ntDayDtTqFxeR/Jh+VK1rP9oTuCh1v0NOlHWPQW0j+R5+0qst0OG9daSTvSsv1K1hZa
RnNAq6WdLEfnWTrI8kmL5ccsE1oa/FSeJUuW6pw+l/QlOR22oEa2GpvNQ7ZjLJY5QW9ocbA2r9Sc
oE62PtBmk3abRfOR1jev/Oygn2z9LDbr1lm0dVGwn5ACJPVXtjOyHqtYg2QdkGe7IhgK/Tp4nK3k
FcEwWT+d0y8n/VboXDNIO96xbVMt+0So1AkWy4/IcouwcLmC5M8oe/0o2IvsJwr5MpJ/JeTO7ZcF
K8n2WWW/y4JVZB9YsDX/S9tvzm3nepT0QQ4lLw3GQr8MDnbcEqctQxzsCbIPddyjN20ZBu2HpP0C
WmeZHwYPI+twZd9LyH6TYu/cejhtHeG45QjaMrLAXp+gbSeRdDFJN5Kklrk4eCRtObmA34uDR9HW
zxXYdjRt+7yQLyL5BiG7/Ts+dCGVvR77XRj8JMlfKFjyU7T1iwW3VtPWugJbLwjWhBYGT1G2dOYf
8k/sWfKPXnHfA72G8Pyj4nb/0Ip1PP+omOy/uuIKnn9U9PGvrziV5x+Rdv8HFUfz/CPyWiAWaeP5
R6QxMCjSxPOPyH2BMyLP8vwjckvg+5E/8Pwj8rPA5ZG7ef4RuSxwXeRXPP+InBtYFLma5x+RqYF7
IrN5/hH5SuDhyIU8/4j8T6Ax8n2ef0ROCjxHJSj/iAwM/CPydZ5/RI4NbI2M5flHpCaQjJzC84/I
EYHmyEief0Sigf2RQTz/iBiBTOR4nn9E/Mwf6cfzDyPLIpFqnn8YrSwWOZLnH8ZedkSkN88/jGb2
yUgVzz+M91mfiMHzDyPJjo0wnn8Yb7ITIjrPP4xtbCDVRPmHQfmHIfIP4xV2krGf5x/Gi+wLxm6e
fxib2ZeoTso/jA1stPEBzz+Mv7Nxxns8/zD+yr5svMPzD+Np9jXjLZ5/GE+wbxjbef5hrGOTjK08
/zAeZ1PID+Ufxp/ZmcarPP8w/si+Y7zM8w/jEXa28RLPP4zfsx8YL/D8w3iAnWds4vmHsYrNIN+U
fxgr2PnGczz/MO5jFxnP8vzD+B272Pgbzz+M37JLjb/w/MO4m11mPMXzD+Mudjm1h86bcSebZTTy
/MO4nc2hllH+YSxlPzbW8PzDWMKuojZS/mHcxhqojZR/GIvYT4xHef5h3Mp+Rq2l/MP4FbuaWkuj
ybiZXWM8zPMP4xfsOuMhnn8YN7H5xoM8/zBuZAvpCCj/MK5n19MRUP5hLGQ3Git5/mEsYDfRsVD+
Ycxjv6BjofzDuI7dbNzL8w/jWvYrOirKP4xr2K3GPTz/MH7Ofm0s5/mH8TO2iI6PRp3xU3ab8RtG
+YfxE7aEjpTyD6OBLaUjpfzDuIotoyNdK6TbSaL8w7iS3Wks4/mH8WN2Fx095R/GXPYbOnrKP4w5
7G5jMc8/jNlsOfUD5R/GLPZb6gfKP4wr2D3Gr3n+YVzO7qUeoazD+BFJtwjpMnYf9c2zQrqfJMo/
jEvZCuOXPP8gaSVJdK0aP2Srqb8o6zAuIekmIV3MHqD+oqvWuIg9aNzA8w+SHiKJ8g/jQvZ76kPK
P4wL2MPUh3RtGeezR6gPRf5hzGR/MObz/MOYwf5I/fmykP5EEuUfxjT2KPXnP4X0Z5JeJek8kq4R
0rnsMeNqmYcY57DHqZdfE9IakigPMX7A1lJ/Ux5ifJ+to/7eKkqezdZTj1McMb5HUgOkRpKahPQE
SdtJ+i5J9UL6DnuSzsIOIT1FEuUjxrfZ03Q+RD5inMX+QmfkbZLOJGkupL+SJPIS41vsb3R2KC8x
prJn6OyIvITkZ0mmvMSYwv5OZ4qyEWMySVdAeo4kijrGJJIuFxnKeGMie57O2n+EtIEkkZ8YE9hG
Om8fCvmbbJPxvzwvIWkzSc0kfYOkSyFtISklSo4n+Yc8VzG+TtIlkF4gaZeQXiRpN0lfI+liSC+R
tIekr5J0EaR/kLRX1PgV9jKdb5GvGF9mr9AZR75inEHa+TxfIemfJKVhfZXkFpJOJ2mmkE5j/6Lz
L/IWkl8jWeQtxjj2ujFdZCvjjbEkTzMzF9LeIK2DpDEknQdpK0kUn43RJJ0LaRtJyF+MUazJOEfm
L8apbLvxA5m/kLyDZJGvGP9D8vc7cxnjS+xN42yZv5D8Fsk+kk4h6Xsik+Hy2yT7hVxH8ndJ5tI7
JAVI+iJJ34GUJAl5DWnvkhYk6QskfRtZzXjj86SdJfMdkv9NMvIb43PsPeNMkd9I7X3SDCGfTPK3
SObSf0gSWY1xEslTea5D0gck5fIbYyT70JiC/Ga8MYK0yRZtJ2mV0IaTNok0LjWTJLIbYxjJE3nO
Q1KKpFyeQ/ou0mMkDSVpAjIeru0mjfIdYwhJ38zPd4zBbI/xjc58h/S9pCPfMQaRNl7mOyTvI/kw
IQ8k+es5eT/JubyH9DTpR5D0WZK+hgyIay2kfYKkE0n6al4mxLd/hqxfEds/w1pJOhL2E0j7stC4
3EayJR8iSztZjibpeJLOyGVG441Psw7jdGteRJYMWT6V048j/TTSuZQlqTqvRbzEALKPE3aSgxrJ
NdhyLGljLZqHNEueRBYvWWpJ6k/SGEvGNN7oF9SN0ciQOm0+svXN6X1JHyV0LvtJ7octfUg71SF7
4lsCtKW/kGtJ/h9L7sQtjCzHknQMSV/Ky6C4LUi2ARZLDVlOIQuXQiTZ8iiyhsmay6OMatLrzDyK
NIO046F9irQvFsyqxhufDEaML1jyKWk9OlhhfF7No8jei+wnWixHkeVzsHCtkrTP5rYeSfrJeXoV
6U751HjjE7TtpLxt3BYlmz2fGm8cQfaRZOdSjKTBtu2Hk3WEsHI5TrKSX5E9QfahFsthZBmes3C9
N+nDcnpv0oflZVrcdhjZnPKp8UaCtg1VczAjTvYhZOfS4SQ55Fu05QjaMjLPFiPb4JyN658g/SRL
iShZBtksR5KlQN5FW4+irZ8TchXJA5UcjNuPJrtTzjXeqKRtn3XYNt7oRVtOxBaufZK0AvkXbf0U
bf2ixVJBls/kZWTcVk22OmgR0k5QsjJuryF7kXys4QjxVQem+ejfWsrKnu3VS+uzi/92aX167dJq
K7bpyxTbWN9pdlvkfd9KxXafb49i+5H/eMV2un+KYuvvr1dszH+H3Wb8x/+4YnvJ/w/Fts7/vmJb
4c8qttsCUcU2L1Cr2OYGBiu2CwN1iu17ga8otgmBqYrttMA5iq0ucLFiGxaYrdhOCPxMsfUJLFRs
RwVuUWzxwFLFFgksV2z+gHJ+w5nAw4ptf+DPii0VWK/Y3g/8RbG9HXhOsTUFtii21wIvK7aXA68p
ti2B7Yrt+cA7iu2ZwHuK7anATsW2PrBbsT0eSCu2PwXaFNvDAWWshR9gumJbwZhiu5eFFdtyKma3
3cWUsRu+nfVWbEvYEYptETtKsd3CPqXYfsmOUWw3sr6K7Xp2rGKbxz6t2K5lJyi2n7PPKrafMuV6
C9ezoYrtSjZCsc1lJym2Wezziu1y9gXFdhk7RbFdyk5VbJewUYrtIjZWsZ3PlNgZnsHOUGzTmBI3
wuexryq2c9h4xfZ99k3F9j02QbF9h01SbN9mSiwOn8m+pdimsjMV22T2bcU2iX1XsU1g31Ns32Tf
V2zjmRITw19n5ym2r7Jpiu0rbLpiO4PNVGyns/MV22nsQsU2ll2k2EazSxTbKPZDxXYqu1Sx/Q+7
TLGdwn6k2OrYFYrtiw62zzPlvhD+HJvjYPuxYjuJXanYRrKrFNsIptyTw8NYg4Ptp4ptiINtMFPu
W+FB7GrFNpBdo9g+y65VbCey6xTbZ9g8xXYCm6/YjmcLFNunmXIPDR/HblBsAxxsx7IbFVt/dpNi
68d+odj6sl8qtj7sZsVWy37lYFPu8eFj2K2KrYb9WrFVs0WK7VPsNsX2SbZYsR3taFui2I5kynyD
bMocM/wJdruDTZn/hQ93tN2p2A5jdym23uw3ii3B7lZscWafD/VRysTYb13LRNk9iq2K/U6xVbJ7
FVsvdp+D7X7FVuFgi7AVrm0zmDq/C7NVDrbVii3kaHtAsQXZg4qNsYdc2xZQytSG/ez3DjZ1Pupj
jyg23dH2B8XmZX9UbB7FprZXY39ysD1qt4WyDrYMU+bPZHtMsXUwe96jtCPUzta4lmlTytSGWtla
B9s6xdbiYEszZa5PtkbXduxnTzjYnlRs+xSbWtde9pRrmT3sacW229Gm5Clk+6ti2+VgS7G/ubYj
xZ5RbM2KTd1vJ7Pn6mqZD9nfHWxKjhX6wNH2vGL7j6Ntg2J7X7GpbXvPYb/32EYH2ybF9m8H27ts
s6vPd5mSS4aSjrYXXOt6h72o2N5WbPb91HreYi+5lnmT2Z9nOJVRcuLQDkfbK4ptu6Ptn64+m9ir
im2bYnPvg23sX4ptq6PNnuOrdb3BXnct8zp7o4QyWxXba462bYrtX4rNvQ9edajnVdak2P7paLM/
51Drf4XtcC3zslKG294sYb+3FNs/HG1vu9b1UgllXlTKcJv9uY7TfknF9oJiU/fbwt4tocy/Xcts
Vspwm/LsKbRJsbmNH9XXRmZ/3ulU5j+uZTYoZbjtA8X2vGJT63qefeha5jlmf+6mlvm7Uobbmsvu
o2dd96kNPcNSZdf7DNul2P6m2NT9/srszxedytifqbu35y9sbxf22afYnlZs6n5PuZZx2me/a5kn
lTLcpjx7DT2h2NS6nmAtZbexkbW6llmvlOE2+7Ngd1/rWbtiW6fY1P3WupZx2qfDtcwapQy3Zcr2
tYYpz8BDjys2db/Hg5pie0yxuft/LOhxLfPnEso8WlIZ7wHH8D8F7e8H1DJ/VMpwm69sX38M+l3L
/KGEMo8EA2X7fiRof+fhvs/DZe/jVEdQsf1esbnX81Aw1IV97O903Pd5UNmH2wzF9oBic6/7gWCk
7H1WK/twW4Xrfqtcy5R/LlcFlfdhoZWKzb2elcHKsvdZoezDbVWu+91fUhn7O73y++a+YOyA67g3
GO/mc6b6+J2rD14modjuUWzuvu4J2t+Llt/e3wYPK3uf5co+3HZ4t/fl8qDyjjd0t2Jzr+fu4CfK
3uc3Ze+j1nGXax28zJHd4Ed57x26U7G513OHQz13BI8+4PbdEfyka5nbXcs47aO82w8tU2zdfY2r
7Vjq0I6lweqy61niug8vU9Pt7V8SVNZDhBYrtvLrXRy0rzly3+c21314Gfd6FrmWcdrHvgbkwPv2
1wdcZ23oVqUObuvX7W29NdjftcwtrmWc9lHW0YR+pdgOvP2/Cg4oe5+bXffhZY4ru95fuu7Dy9jX
EnV/bPpFt/vgddrXP5Zfx02udfAy9nVVapkbXcu4t+XG4Ge6vY9uUOrkthMPuN7rlTq4zb7WrPvH
0fXBga5lFrqWKd/vgh6pc1C31znftU5exr7+r/vP0/zgEMU2T7EduJ/rgvZ1i+XWYfmSqPzmo9Pa
7V4+h7XbN6hrtytOV9duVxzpsHZ7r8Pa7Vcc1m6vc1i7fa+6djtyq7p2O3K1unY7coW6djsyQ127
Hfm2unY78g117XbkNHXtdqROXbsdGaGu3Y6cqK7djhyrrt2O1KhrtyOfUNduR+Lq2u1Ihbp2OxJU
125HdIe12xmHtdtpde22sUddu23sVNduG/9R124b76prt4231LXbhsPabeN1de228aq6dtt4WV27
bbyort02Nqlrt40N6tpt4+/q2m3jb+rabeNpde228aS6dttYr67dNtaqa7eNx9W128aj6tpt44/q
2m3jEXXttvF7de228aC6dttYpa7dNlaoa7eN+9S128a96tpt4x517baxXF27bfxGXbtt3KWu3Tbu
UNduG7era7eNperabWOJunbbuE1du20sUtduG7eqa7eNW9S128bN6tpt45fq2m3jJnXttnGjunbb
uEFdu21cr67dNhaoa7eN+erabWOeunbbuE5du21cq67dNq5R124bP1fXbpNNWbtt/FRdu238RF27
bTSoa7eNenXttnGVunbbuFJdu002Ze22MVddu002Ze22MVtdu002Ze22cYW6dptsytpt43J17bbx
I3XttnGZsk5bmQsYl6rrtsmmrNs2fqiu2zYuUddtGxer67aNi9R122RT1m0bFyprtNX2nq+u2Sab
smbbmKmu2TZmqGu2yaas2Tamq2u2jWnqmm2yKWu2jfPUNdvGucy+Pls9rnPU9dpkU9ZrGz9Q12sb
31fXa5NNWa9tnK2u1za+p67XJpuyXtv4rrpe2/iOul6bbMp6bePbytps9fjPUtdqk02dX5yprtUm
m7JW2/iWui7bmOpoU9Zqk01Zq21MUddqG5PVtdpkU+c/kxxt9vXatcZER5uyZtuYoK7ZJpuyZpts
yppt45vq+mzjG4421zXbxnh1zbbxdXXNNtns67PVur6mrtcmm7Je2/iq63ptte6vqGu1jS+ra7XJ
Zl+XrdZ1hrpOm2yua7KN09W13GRT1mkbpylrstW6TlPXaBvj1DXaZFP/bOpYR5vrOm1jjLpOm2zK
Om1jtLImW61rtLpG2xjlvkbbOFVdo002t/XYaj3/w54qoYyyFtv4kqNNzUVOUdZiq/Wf4r4226hz
X4dtfFFdv00217XZVEZZm218QVmHre73eWUNtlMZ1/XXxudKKqOsxyabsvbaONnRZl+PXWuc5Giz
54hqO05yX49tjHRde11rjCipjOt6bGO4+3psKqPmucMcbfa112pdw5S12LXGUEeb29rrWmNISWXs
a6/VMoPd12JTGde12FTGvha71hjkaLOvvVbrGlj2umv3WPVZZb21Uxn1WcWJjja3Ndhq3Scq669r
jc842pT11sYJjja39dXl99Hx7muvqYyy9tr4tPvaayrjuvaayijrqo3j3NdjU5kDXmdtDFDXb5PN
de21cazr2munfdzWWKv79Hdfc01l1Odl/dzXYVOZctdcq3X0Vergtv9H3Z0ANlWmaxw/bWm+JF+6
sZXlA0qQfSsgiAgWVERU3Ga86jg6qDijDuI6Ojoq4IK4MCAigoKyiIKCKIuyCwKKCIqICLLKoiAg
yFpaaO+b9316dOg5NydpynjR+uRXc05iaNPtr0ZrrsO6XqnrRF4XrbF2Ok/U5pquU+p74ToctcOO
XOfU7jqs60ZtsSPXibWhLn2OnOitNl0nWnftdEzUvlrXKd1l0+tibq517ajNtdMxMffWdEyp3lrX
ir2l1iZ6o03XidZbOx0TrbUO65qlrhN5XbS2uvR5asTcVTudI1ofXfqY6nEdU+bGms5R+vv41aJ3
13SdaI11WGeXuk7kddEa6uj3OTv2xlpXLXsvravE3mnTMbH21E7nOLWvDuvKUZvryHWiNdZhXcnT
dWLtqZ3OEXNfrSuW7qvpdbG202GdVebeOnKOWFtqp3OU6qR1Zuy9NR0TrZv2co5oXXVYZ3i6TrS2
OqzTPV2nvPvq6I9JWswddelzhMreVdM5Yu2qnc4RrakOax1zdx05JlpDHdZBT9cpayNd9t/vQKn7
EHldmZtq7Y+5n/ZyzjK31HSOqC21VrG31HTMae+mtS/qbUauE2tHXfocqaXOEXldwjtqOmdZm+nS
56wQc0Md/ZwpMbfRXs6Z6HY6+m0mx3ybkWNi7abDOinqMZHrxNpFe7ndhDfS2irdYtPrYu2mo95O
sDjmZtrLOcu7l45+H4pivg+RY8raS3u5jTJ30MGT0Xtruk5ZW+lw8ETUc0SuU9ZW2umc5d5J022c
2iuHg4UJb5ij34+CMt9m5ByJ7qS93GasjXQ4eDyuY8raRIeD+VHPEblO4jrppOLi/qu4k55rDO+3
O2jTRqVMN7JfRhw6WuEuI/sce1iFDUb2GLtHaiMjewE7O7WXke0Xsd6bOszIvsdelsq3R8u3pyel
bjSy+ezBqfnswb7K7Ad9FY1sC/YtPr49Wr49fYWvo5G9lt3Zd5mRvYPdynejkX2YXc/X28gOZGf7
Hjayw9lB39NGdjzb8g01su9GHDzqG21kZ7P3+t40sh+zd/jeM7Ir2Bt9s43sN+w1vkVGdhN7he8z
I7uTvdS3ysjuZX/kW2dkD7Nn+zYb2QL2dN8O9nRlsaf4fmJPUT72RN8B9kQVYo/zHWGPU1ns0b5C
9miVzR6pLCNr2MNUqpGtyx6iAka2Pvt5lW5km7AHKv79ouXfr+CTKtvItmH3UzWMbDv2o6q2ke3A
fkiFjey57AdUfSPbhX2vamxku7LvUs2M7EXs3qqlkb2EfbtqY2QvZ/9VtTOyV7F7qbON7NXsnuoc
I3sN+0aVZ2SvZ1+vuhjZG9jXqQuMbE/2NepCI3sz+4+qu5G9lX2VutTI3sa+QvHbKy2/vQZ7qCuN
7J3sS9RVRrYPu7u62sjew+6mrjWy97O7quuM7D/Y56vrjeyD7C7qBiP7EDtP/cXI/ovdSd1sZB9j
d1S3GNm+7A7qViPbn91e/c3IPsE+S91uZJ9it1V3GNkB7DaK3/9o+f0v2Fr1MbLPsnMVP9/Q8vNN
sIW6x8gOYjdX9xnZwexm6n4jO4TdRD1gZIeyG6sHjeyL7IbqISP7EruB4vd/Wn7/D9ZXjxjZEex6
6lEjO5IdVn2N7KvsuqqfkR3FzlH9jexodm31hJF9nV1LPWlkx7CNGmBkx7FrwDXg6oqfj2jHw8/A
E9jZ6lkj+ya7qnreyE5kV4GrwJXVICM7iV1JDTay77ArqiFGdjI7S71gZKewMxU/H9LK82GGetHI
TmWnK36+p+Xn+2CaesnIvs8OqeFGdhpbq5eN7HR2UI0wsjPYATXSyM6EX4E/YCv1qpH9EB4Fz2Kn
Knm+TlWz4dfgOewK6nUjO5edosYY2XnsZDXWyM5nJ6lxRnYBPB7+iG3BljhQrN4wsgvZRWqCkV0E
vwnzx4/ACfWWkV0MT4SXsAvhQrgALrA9CV7KPq7eNrKfsPPVO0b2U/YxNdnILoOnwJ+xj6p3jexy
9hH4iO2p8Ofsw/Bh+JDij4e0K+D34ZXsg2qakf2C/Yvizz9ov4RnwKvYB+ADLt6vZhrZr9g/qw+M
7GpH71MfGtmv2XvVLCO7Bp4N88fvwB54D/yTmmNk17p4Lsyf7wR2w7vhXWqekV0Hz4fXs39UC4zs
d47+QX1kZDewd8I7Xb0Q3sjeofjzEVr+fCSwHd5u+2N4M3ubWmxktzj6e7XEyG519Fa11Mh+7+gt
8Bbbn8Db2JvVp0Z2u4uXwTvYm+BN8EbFn2/R7oSXwz84eoP63Mj+yP4O/s7VK+Bd7PXwetsr4d3s
dfA621/AP7G/hb+1/SW8h70WXmt7FbzX0d+or4zsPk9eo1Yb2Z/ZX8Nf2/4a3u/iNfAB9mp4NfyV
+sbI/uLitfBB9ip4le1v4UPsL+EvPfoLxZ9f0x528Xr4iKNXqu+M7FH2CniFqzfAxxz9ueKvh2jz
Hb0cXu7qTfBx9mfwZ7Y3w/z1Q2AZvMzVW+BCR3+qthrZE47+RH1vZE+6eBtcxF4KL43TS9R2I1vs
6MXwYts7xH7LxTvhJPbH8McuXqR+YC/yJ7v4RzjF0QvhhbZ3wRXYH8EfxekFajd7gT/VxT/B/PVj
YD4839V7YOXoefA823thv4v3wQH2XHiui+eon9lz/MGEeDY82/Z+WLNnwbNcfQAOefKH6hf2h/40
R3+gDrI/8Kd79CE4w9Ez4ZkungHPcPVhONOTpyv+fkNguj/Lo4/CFR09DZ7m6mNwJfb78Puuzocr
e/J76jj7PX8VT54KT/XsAriqo9+F33V1IczfzwlMgae4+gRczZMnq5Psyf7qcboIruHod+B3bBfD
Ndlvw2+Xkyf5+ftftMaTJ8ITbSfBteJ0Mlyb/Rb8lqtT4DrsN+E3PbsCnOPJE+AJtlPhuo5+A34j
YfbBYfZ4eLxnK7heXB7n9xvZMzx5LDzWdgCuH6eDcAP2GHiMZ2u4Ift1+PVy8mvwa7ZDcCNPHg2P
dnUa3DhOp8P8/evAKHiUR7/qzzCyTRPkTLiZo1+BXzlNHunPMrLN4/IIP/88gLZFglwJbunJL8Mv
264M5zp6ODzcs6vArRLil/xVjWzruDwMHpYwZ8NtPPlF+EVXV4PPdPRQeKhnV4fbJsQvwC/YrgG3
S5Brwmc5egg8xLMN3N7Rg+HB/yX/G/637Vrw2XF5EDzIdm24Q4JcBz7Hk5+Hn/fsHLgj+zn4uYS5
LtwpLj8LP2s7DJ/7u/Az8DOeXQ/Oc/RAeGDcPgPunBA/DT9tuz7cJS4PgAe4ugF8Xjm5IXy+o5+C
nyonPwk/mTA3gi9IiJ+An3B1Y7irJz8OP+7ZTeALT5Obwt3Y/eH+5eZm8EUJcT+4n6ubw93jcl+4
7+/WLeCLHf0Y/FjC3BLmnifwKPzoaXMufGlC/Aj8iKtbwT082O75Oid1roD/7ul/9nyF6PkKpedL
e1h6Plrua9JaSs9HKz1fIXq+QvR8q9HzrZaeLzRNej5a7jtCI6Tno+XbCz0uPR8t/zwq1Ed6vlAf
6flCN0jPR8tfz4Uuk56PVm6vi/R8tNzzhdpKz0fLfVSoifR8tNzzhXKk56PlniiEni+Eni+UIT0f
LfczISU9Hy33KyFLej5a7kN0gfR8tNxj6EPS89Fyv6D3Sc9Hyz//17uk56Pln5fr7dLz0fLPl/Um
6flo+eever30fLT880W9Rno+Wv55m14lPZ9eJT2fXiE9n14hPZ9eJj2fXiY9n14iPZ9eIj2fXiQ9
n14kPZ9eID0fLX9/Us+Vno+Wv5+mZ0nPR8vfX9IzpOej5e9v6GnS89FKfzlVej5a/npOT5aej5a/
vtGTpOej5c+n9VvS89Hy52P6Den5aPnzDz1Oej5a/nikx0jPR8vPp/o16flo+f1Rj5Kej5Z7Pj1S
ej5a7vn0COn5aLnn08Ol56Plnk8Pk56Plns+PVR6Plru+fQQ6flouefTg6Xno+WeTw+Sno+Wez79
nPR8tNzz6Wek56OV/nSg9Hy03PPpp6Xno+WeTz8lPR8t93z6Sen5aLnn049Lz0fLPZ/uLz0fLfd8
uq/0fLTc8+nHpOej5Z5PPyo9Hy33fPpf0vPRcs+nH5aej5Z7Pv2Q9Hy03PPpf0rPR8s9n35Qej5a
7vn0A9Lz0UpPe7/0fLTc8+n7pOej5ecbfa/0fLTc8+l7pOej5Z5P3y09Hy33fPou6flouefTfaTn
o+WeT98pPR8t93y6t/R8tNLz/l16Plru+fQd0vPRcs+nb5eej5Z7Pn2b9Hy03PPpv0nPRzsafgLm
nk/fKj0f7Rh4AMz9nu4F94JvkZ6PVvrim6Xno50APwtzz6dvkn6Plvs93RPuCf9Fej5a7vn0jdLz
0b4DD4G559M3SM9HOwUeCvPzof6z9Hy03PPp66Xno5V++0/S89Fyz6evk56Pdhr8Msw9n75Wej5a
7vn0NdLz0c6EX4G559P/Iz0fLfd8+mrp+WhnwaNheb7+o/R8tHPg12Hu+fQfpOejnQePhbnn01dJ
z0e7AB4Pc7+nr4SvhK+Qno92ITwB5p5PXy49H618/LhMej7axfBEeImje8A94Eul56NdCr8Nc8+n
L5Gej/ZTeDK8DJ4Cc8+nL5Z+j5b7Pd0d7m57Kvy5oy+Sno9WPh52k56PdiU8Df4Cng7z5x/6Qun1
aLnX013hrq6eCXPPpy+Qfo92taPPl56P9mt4FrwGng3Lx+/z4PNsz4HXOrqL9Hu08u8vdIY7254H
r4Pnw9zz6Tzp92i/c/S50uvRbvDkTtLz0W6EF8Hy+UhHuKPtj+HN8GJ4i6PPkX6PdquLl8Lc6+kO
cAcXny09H+02+FN4u4uXwdzv6fZwe/gs6flod8LL4R9c/DnMvZ5uB7dzcVvp92h3uXglvNvRZ0q/
R/uTo9tIv0e7x8Wr4L2Obi29Hu0+j14N/+zoVtLv0e53dK70e7QHXPwN/IujW0q/R3vQxd/C3Ofp
FnALz14Hy+fXzeHmttfDRxzdTHo92qMevQHmr590U7ip7Y1wvqObwE1cvQk+7uLNsHz90Bhu7Oot
cKGLt8Lc7+lGcCPb38Pc7+mGcEPb2+CihLiB9Hq0xZ5cX/o9XV/6PQfvhJM8+Qzp9/QZ0u85+EeY
ez1dD67n6l1whbgchsO2d8Opjq4rvZ6uK72eB++BlSfnSL+nc6Tfc/A+OODRP8Pc3+k6cB2Prg3X
dvV+WHv0AVi+3q4F13L1LzD3e9rAxvZBON2jD8EZnlwTrunRNaTX0zWk1/PgI3CWRx+Fuc/T1eHq
nn0MruTR+bD8+6PV4GquPg5XcXQ2nB23C+CqnlwVrmq7EM725CrS6+kq0ut58Em4epwugrnX05Xh
yq4uhms6uhJcKVGWPo/WeHJFuKLtJLiWJ2fBWbaT4doenQLXicuZ0ufR5sTpVLhuXM6AMzzbB4cd
nQ6nu1rB9eK0Hz7D0WlwmqsDcH1PDsEh20G4QZzWcMO4rGEdt0Mw93g6CAfjdhrcOE6nw/L96wAc
8OwMuKmj/bDfszPhZqfFClauzoKbx+mKcIu47IN9tivBLeNyqvR4tLkJchW4VYJcFeaeTleAKyTI
KXCKZ2fDbRLkavCZcTkZTrZdHW4bl5PgJFfXgNslyDXhsxJiS3o52vbl4WCxmDZRrgWfnSDXhjs4
uggu8uw68Dnl5By4oyefhE96dl24U1w+AZ+wHYbP/X/pQunvaPPKxQXS39F2LifXh7uUkxvA5zn6
OHw8bjeEz/fkfDj/d+tG8AUJ8TH4mKsbw13LyU3gC8vFR+GjtpvC3U6Lj0hvR3vRaXJzuPvvwofh
wwlzC/hiTz4EH4rbLeFL/kvOhS+Nywfhg57dCu7hwb/5/5jzL8V/zdXf+O5JHxu4zWqtV/puT58U
uJv+jp/+kL8zMtDTykkf6XuIL9XVm+ivNayUFSusJOvKUKrvq1Ce0tZYa7jlS6LT0ctY6xXLX7yN
sJlexlgj7FtMs66wGoU6qT/onEtv6tMr59qc3BZt6Roj6eXlyH83cGASnffK0H101imuZz1+ylmb
9AnlXH7LrTf1OfV8/aoVF9OhyqpAf4RD3/v21qxp1dsZedlp1au50+X8+0qdH3c359pWubnWb+4v
/n/waZd7PHOBw5lxz085M/4LimnzfV+1axdZpZa3cznr0lJnDeDhbdXuN+e0K86mcs70pv/HOeeU
Oqdf7imdsuSM8vY0yH67SrKC1kJra3ZmxUyrdaB9YGBmZtYuOmcv66/du12VG7kB68+klG733nT3
ba3aWG6/khomtUpOTu5EF5PpxR951fxabwxwPaDkV+Re4J7Yty9vyzmBR4KL0lcFF0UuZVVOX5VV
2QoHRmRubG9FNrioveXySNTAI5HpW+fvGXmxGgXmBO9OOtN+HMLBLXKe4BYP52mkk+joNr8eHWog
R4caeDk6dBEd3frXo9PulKPT7vRydNpgOrrVr0enz5Cj02d4OTp9LR2dax+Nayel29deS9fcgWtH
3hpKfqVZd9M97x04T13Y+x//zLnmzv/4HRphVeTf9WXWEOzz+sbA1rQGwd5WUvJ+y/FPPz0L9D1R
fNLy0ztVRiEu5EUu+AqsgogL6VwlF1JKLqiSCxmlLtTBheQ6xVvzLVVoJeUVHZM9gc2X7XsAu/WU
Xeht805dHF+nZHH+jJLF7Srcj5SSLT7GdzipuB/d4QJ61lgom3dAts6J/MjjkqyKtx53eKQiF/oW
luWx+vVBy3N70Pom6EEr9eBtPeXBO3DKg4fbzcD9UEVeH7Si3z5o9M+YV/IPm9ALbm/Zv/3TV0Qf
oA/x5B2yVFHkTfCw5S+KPNz9juBC/hErUGSl5BUXLzxacunEUSsYOaio2KKHq+RiES6eLLb+t53z
gK6qSvf4ublA2t0lNOm5VEPvvQQIvSbU0AkhIaFDQhcSOtJ7FQREUBj7iCKK0dGxjY5tfJZRMyro
KGIGKYGU+/7fd/Y9uQlB56313lrvrfWWwvn9v3PuvvfUu397k+BkEQYDsbthBaaKHQa68323rLB8
u5Zz2wrJ59ptK4zOOGq5eYyufJ+VmW+F3TbVfLotUcsqsMJwfyrU8nE/5lp8o+ZyBXATV12hgWCG
G7QfgODr9M1nFxjK3bD8WyqCcjctaiIsl19JrRNmFDrvSdXCfEaqZtufzk3VPEY6Dtl59oVeYHaJ
amY3XQVm1yOpZh8O1OxDRLXcXKphzzLtI6ioVnSIM28GnIKi02KfqZzr9jn0+c9htnPqMp2tc28E
NuZHXNQhhXwA7ZrLnEPzqcw5dNvnkE8dHR4b6SRn2XtKxyTXRqpm5tGVTic5z348FPjso0TN59iH
MbLoiHLz9iGPto8+ndTgO06qKgw8hwTBPrPK5d8mstBcE+4CA9EMt/hSs09mtH0B0QcKNpcVPbHs
S433wb4AcTLz+aKkM6joQgXk2+e0gCu37IOWbx+eQvt6LcwteTsE3iT2rXP3k5l7vehG9N+Z5kY1
t+2/c4f/T/9f7hqdTD5YXr7kGVvQs9zGLnxLM3ajC6TACqeHKo6qhbPg4QduAT01TcD5dyl/yEWI
9AecKVeGP2DJJ1/kWcHKl4l39ic8VnHifIV2cvty8P4+NOS5bZXz0YXry7FDBo4ijrcdIn2ZaC8T
n+62VVb5stBAPrPbl618+Ta7fLl4NV+rZdA58GXZly3fSvlW6C3LrXw+PAeIcEXm24RPRpd/rhXk
82XbJXorZ6UhvDTLpkh+AVEGbtc8umbpbuA7pwxeEI2byP6Y+dh1+6NhF7HjNmf4sl30MYnRqEUf
HwetHF5KN1G+OUx0ldIeU8LLccboYFCKpoPmpuNkpyycYzqEgr+HM3ExZuSb84DDzCfDOUPOucOr
XcGBp9jlK37uAy6JEhdKwOVjLipzmf3u5fg/93WKZwoeNziSwTewk4X20o0Lir9Tsuzvloxse0k7
T8tIs1S59jI43166/ctCe+nyL31FS9plitfQPA75f3UZcp27ICXAzZtct+83/kRmqcySTqj9QC20
TwA6clYA5hdhbqmYU4TZRZhpjmSez36wRufbX+c25v2XHzshEDfXDTot/93w738GfihnX/vdpYeX
dNNk3vr/8L88UCco+iZdEP/dcLfL6Dd8l+w4qlTfHQLPHxH6SlDTVlYJ15W8RZyVYpYJ4SL0+fCJ
YVXhuugyFP8fXWe6o8MLyQ0LHPbl2+wpY9nfshREWfpapeeHP9E3VlHCt1Z2sZRTlKJzonMDUpbK
L0oZme7CgIQ3DEyWP4Va1gra2El0XLOcRD3q7MCkiqXgnGIpNzC5iyVXvp3wPMCHdBcWS75iCR/G
pELqu2X50wokfJiApHL8KYNSrv/9ojPJKJyURd+6mSZF5tLBz6bkplRI/QeTVC73DE0KphTpT25K
yp9clNw++8RaHQrsr+7gW+StBSUvhxL/s/2id/J/densSNE95h9L9MpPw16Rn0ZUtLyh6WGvhKbz
eF263mN1sOrIo7wsfbSqh7kfeaxZxep4d8tmRWOWaEN9bdVAGy/aS+SGdpu8/O020Z68jPZaBbYn
0+z27GVounjJbo+Xv9ueyHS3aNYhsD0RbLdnL0PTPXF2e7z83fY8FdFem8D2wg/Z7dlLHM2Ldnu8
/N32wh5Be3eM+QVs/4llBS1zjvlcq/E7Jyr3nTlnSsJM74ikWXOT5iekL5if5I0a2PDOs1yNOryW
ZUboY8VrYZ+J79Bjj/W09/ziGS2UFRv+olge/ndxGLUQ8bEnSlwDdZMRnomyJShFxng2yETQ/XK6
51G5EXRSbvT8WZ4GXZCnPF/JN0AfyZc9v8qvQRflx6KspFauy+9FJRWM9y0jb4l6qiooQoWIlioK
VFNVFl1VO1CUqiv6qRhQK9VcDFNDQZ1VJzFOjQX1Ur3EVDUVNEgNFjPVLNAINUqkq4WgcWqSWKYy
QAkqWaxU60ApapbYoLaAZql0sUXtBqWpZWKXOgRarFaK/eoYaLlaLw6rU6BVaos4rh4DrVc7xCn1
FGiT2ifOqOdA29Qh8YQ6D9qljoln1Cugfeph8Zx6HXRIPSrOq7dAR9Tj4oJ6D3RcPSVeVR+AHlbP
itfV30CPqHPiTfUZ6Ix6Ubyj/g56XGWJ9/CgjhVPqdfEB+o70DPqz+IjdQl0Vr0lPlH/BJ1T74rP
1M+g8+qv4gv1C+iC+lB8pa6CstTfRLa6DnpVfSq+wdMVZ1p9Lr5Tt0FvqC/F95CJWPGW+lr8U/lA
76hvxE86CPSu+lb8rN2gv6pL4hddDvS++kHk6BDQh+pHcVWHgT5Wl8U17QF9oq6IG1qC/kPliJta
gz5TV8UtXR70hbom8nRF0N/VDZGvK4O+UjdFob4H9LW6JXyaroN/qDzp0tVB36gCGaRrgr5TPllG
R4Iuapcsq2uDLoHKMf2g3TJE1wX9U5eVobo+6EddTobpBqCfdIgM13Rd/axDpdANQVd0uJS6MegX
kGLK0UJq3RT0Ly1lhG4Guqq1LK9bgH7VEbKCxnWPfa0gK+rWoBu6oqys24Bu6kryHt0WlKsryyqa
rt1b+h5ZVbcH3dZVZDXdAZSnq8rquiMoX1eXNXRnphqgLqACXVPW1F1BhbqWrKW7gXw6UkbqaCtW
WiAvk0vXlrV1D1CQriPr6J4gt64r6+oYpnqgXqAyur6sp3uDyuoGsr7uAyqn75UNdF9QsI6S9+p+
TA1B/UEhoCimUN1INtQDQGG6sWykBzI1AQ0CheumsrEeDPKAmhhqBhoCErq5bKpxr+IYt5DNdCxT
S1AcSOlWsrkeBtK6tWyhh1vx4AhwS3Asjncb2UqPYGoLGgmqoNvJ1noUb1lRt5dt9GhQJd1BttXx
TB1BY0CVQe0MdQLhOYEz01m21+NAVXQX2UGP53aq6q6yo57AXA3cCUzUDTQRVF1Hy856Eq+vobvL
LnoyUw9QAqgmqKuhnqApoFo6RnbTifyaSN1LRuupzF7dW3bXSUx9QMlcra37yh56GnMdcE/DdXU/
GaNTmPqDUkH1QL0MDQBNB9UH9TY0EDSDX91AD5J99Ezme/Vg2VfPMjwEPBsUBepnaChoDqghqL+h
WNBcfk0jHScH6HlgSo2RBiIRDQPN52oTPVwO0mlmm6Z6hBys0w2PBC8ANQMNMTQKtJDXNwcPBRON
Bi3iagsdL2P1YsNjwEtALUFxoHjmseCloFagYaB45nHgZaDWoOGGxoPuM5+tDdIIJ7XVE+RIvdzw
RPAK5nbgUWCiSaAMrrYHjwYTTQZlmlY66AQZr1c6aQrSKlBH0BhQPHMieDVzJ/BYMNFU0Brzys46
SY7TaznZORkZ31m42pLleJB/TVfkCbymq54GWu+s6aZT5ES9wUmpSPeDokGTQHY9Wk9Hwrc1rsPp
cjLIrnfXM5A2MfcAJzg8E7zZbNVTz5JT9BbnPXvq2chbQTGgRJB/TYyeg7wN1As0FWTXe+m5SNtN
6o2UZJJd6aPnyWS9o1hlPio7mfuCpzmcBt5ltuqHlMKJOB28O6CN/nqBTEXfNbCyEJW9oAGg6SD/
mgF6EfI+5oHgGcx2Woy039lyEPJMZKIloAMB7Q/SS1E5CBoMmgWKD1g7BLXZTo3yMuRDTh6KPIcz
8X3gBwJeHYvKXFSIloMOF2s7Vq9A7QgoDjQPVLQuTmeg8qBJw5DmB6RMpKMBWw9HJY0rxCvBxwLe
iaoj9CqZro+XqK1G7SHmkeAFzP61I/UaVE44eRTyQicXb320XisX6YdLqa9D/SQoHrQYFLg2Xq9H
7ZSTxyAvKZY3ID9S7DVjUVvKNeL7wY/e8a5j9UbU0bvFnblRLgMVXz9Ob0L1DPN48H3MRevH682o
/SGgMgGV5U6F8hbkx0q0OxHVFVwl3gp+vJRjNQlrMu5YQ/VtqD/h5MnImU7217aj9mSxWgJqK02N
0g6kp0o9S1P0TrlKP13qml1Y84xJiUirTSraJlHvRvWPxWpTUVvj1CjvQX62lHdIwpq1vIZ4L/hs
qZ8xSe/DuueYk8HrmEtulaz3Y83zTp6GvN7Jpf8XiyfNfrnBbEXpANK5u2ybqg/K+/ULd117CGvP
M08Hb2Qu+i/A3k6fhr3BHeBtb7K3lQl/0VMvHO4QftCTFv6CZxfoludLT1UPeviedqKhZ5RAz86T
KJI8q8Va0Dqxx3NSPAt6SFzw/El8BTovsj1fSLTseV8UenJkLdA3spoIkp1A/5ItRYREL05Yso/w
ymSQR44VTSS+jUUVOVN0kJtBdeRy0VPCHLFmkxgkz4DayoNipHwB1E2eEhPJDUVv+YxIkh+BBssL
YpbEJxDD5VsiTZLbjJUfiaXyV9Bk+aXIlGQqyfKSWKfIRWbIX2Bi8FQxV94U2xVZxALpE3sUecJS
VU4cVNT/X6Ek/KsZu1xF+Bf119epauKkwh6Jjaq2OK3QlxZb1b2wLvSMxU7VRDyt0M9FW63Eswp9
VXFAtYdrodcpHlBdxYsKfUXxoOohXlYJbHV9YVjT2OoGwupmsNXFwurmgk6rEeJtlQ56TMXDqxaD
nlAT4FXLQU+rybCpTNAf1VTY1BrQcyoFDrWB/W4GHGoT+90cOBS+T8VLKk18qXB+8e4LYU74DhOv
qCUwpwOgP6nl4ltFx/51lSEuqgfZ9FbD9B5i01sH0zvJprdB/KQeAf1FbRKXFZ2j99RWcUU9zqa3
Q+Sw7X6odomr6hnQR2qv+FWdBf1NHRDX1Tl2vkPiBhvwp+qwyFUvsfMdFbdUFjvfcZGnXmXne1jk
sxV/qU6KAvVndr5HhY/9OFudkZZ6h+3vMelS74K+VU9Kt3qf7e8pWYad+aJ6RpZVdL1cUs/KcmzP
36vnZLD6D7I/dU6Gskf/qF6QYepzsj/1ogxno76sLkiPoivsZ5UlBbv1FfWqlOob8kD1mlRs2Tnq
danVRfJA9YaMUN+TB6o3ZXn1A3mgeltWUD+SB6q/yIrqMui6ek9WUlfICEGVmW6q9+U9KoeMUH0o
q7CN31IfyaqKrufb6m+yGnt5nvpEVlc3yAPVp7IGDD2eTFB9LmuyoxeqL2QtlUcmqL6UkWTrOFJf
Sa8qBLlUNizCYvoHyAUKUt/AJmDwOHrfwiBg8Dh638EbyjBdBJUFlVXfwxuCQeXUD7AGWD2O4z/h
CaFMP4HCQSHqMjwBfo9jexl2QBSmfoYbCKYrIDg/jnIOvADOj6P8L1hBBNNVEOwfx/tX+EAFkFTX
YAEVma6DKoGUugEHqMx0E4R7GecgF/3/KqAIdQt9/qpMt0HVQOVVHnr81ZnyQTVAFVQBevw1QRVV
IXr7tZh8IDwR4IgW+vleJheotkWO6EIv36YgUB2LbNGNPn5di2yxDHr09ZjKgupbZI3l0J9vwBQM
utciZwxBbz6Kn9rVdSj67g2ZwkCNLHLGcPTiG/P6mtqDfnsTJgFqapE1SvTWm1m2NSr00JszaVAL
i5wxAr3zlkzlQa2YKoBaW2SRFdBHt6kiCM83nP9K6Jm3tWybrIy+eDvmevoe9L/bM1UBdbDIHaui
F96R19fX1cB4LuJ6qI5+d2emGqAuFhlkDfS5baoJ6mqRQdZCb7sbvzpKR4JphKIhqL8hL6i7RS7p
Rc/aptqgHkx1QDR+0Rg00FBdUAxTPRCNZDQBDTJUH0RjGk11A/Ss+1i2ad4LplGNZjoKfel+lu2X
DdF37m++W1voRugZDzDcGExjGi11E/SJB1m2VzYF01hGK9AwQ81ANKrRWjdHH3gob9latwDTuEYb
0AhDLUFxTK1AwyzbLFujxzvcfIZ2SKN4lKOdbgMaYdlu2RY92pFM7UD2OEcH3R492dGGO4Btl+yA
/qtNHUFjLNsqO6F3OtZwZzCNdnQGjTPUBWSPe3TWXcE01tEFNJ5HQGyv7Ib+50TD0WB77KOb7o5e
52TDPcA05hENmmSoJ2iKZbtlDDjRIpuMQa/Spl4gexyku+4NpnGQHqAEQ31A9ohIT90XfcZpTn8o
BjkRmagfKMVU+4NpLKQXaKqhAaDp5nW99UD0+GYYHgS2x0P66MHo480yW/XRQ5BoHKQvaJqhoaA5
lu2X1APENziuaurX2WMi/XQceJ5lO2Qc+mz+8ZH+ehjSfIsMchj6bzYNB/lHRwboEUjoCeC6HgGT
tGkkaIHZYpAeBWtc6KTRSPa4yGAdD4tcbNYM1mOQaGRkCGi2obGgpWaLoXocrHGZk8Yj3WfZfjge
fugfB4nVE5DQE8G1PwFuaI+IxOmJ4BVmmzg9CYlGP4aB5psxkWF6MjjTsu1wMuwwkykB5B8RGa6n
INnjICPA6Tw6MkInglabbUbqqTDCNU5KQlpr0iidDDv0j37Y7pcM91vHNA203qmnIKHPhDslBf63
wbJdMBXsH/sYo6fD/DY6bY3RM5DtcY6x4KVgopkg/4jHWD0LaYtlG94sGJ6fZ4O3mq3G6zlwu21O
movkH+OYgLTcGeOgPA95h0U2Nw82t8PUJ+r5SDudlIaEXh7uqDQYnH+cY5JOR9pt0mS9AOa2x2l7
sl6IvNeynW0hnM3Pi8D7nO2m6MUws/1OWoJ0wFmbqJfCyYqPWExFbQ3XiJeBDwWsuw+ZxiOSQGvN
WAWl5UiHLb9dLYddHWZaATrivD5ZZyD7xyGmIa1HIsoEHXW2m6ZXIh+z6G5cCcs6ZvmdaxXScWe7
FL0aGf1d3I+rYVQPOWtS9RrkE5ZtWGtgWCeK7eV0vRa1h5lngDeZ0QdK65BOOlvO1OvlZmdUwa5s
QOURk2YhbUEiuh/0aMCWs/RGVE4zzwZvNWMJlDYhnXG2nK03I/8BNAe0LWCsYI7egvyYk+cib0cm
2goqPhIQi/t3q9xhqpS2IT0RsH4+fH9nwBgAVXag8pST05B3IRPtBD0dsG0a3H6XY/rpSLs5Ee8G
F/f7dFj7blh7LO70PXKPY/aU9yKfDdh2IWx9bzFbp9p+1J538iLkfSU8naoHUIWl4AlwQO4PcHKq
HETlhYDKElQOoEJ0CHS+2LoHUHnRyUuRD3ImPgx+qdg7L9VHULvAvAx8iDne5AeRXy7xWe/TR+UD
OqtE7Rhqrzh5OfJhzsTHwa+adc64AP1s2EOfwBYOhn0mXqBxgfCPw78Jv+aBD4THe06HL/a8DTov
aoV/IbqBfGKuJ1Jsh9u3Ek96hgn4lmes+NazVMIbPMuk8ByS6KN69skWnuck+jmeJ+QQz18lvis9
r8npnu943vcTudJzQ+K+9FySe0U5eZbneB8VlSTZXZA8L+rIL0BSvi2aSbKnqvIz0VHi84m6MPoY
Nvqm8qoYrGiusJ0sFKNULRorUCFiIs8K91blRZJC31cMUjXETEUzZsNVfZGmetNYgWoK5x9MYwWq
rchU6E1h665iLZv6DBUjNqlEGiuAn29nP1+g4uD380BL1Gj4/SIeK5ggjrCVr1JTYPWreKwgRZxk
F9+oZsHlt/BYwXzxuNoJ2qEWiafUPh4ruE88q/AMFPtVpnheHbVoBngNvP2ERTPAG8QFtu1jajNs
HXe0OKG2i9fUk6BTcOw32LFPq33ibZ5bfgxm/S6b9RPqiPirumDRXPBx8QH79B/h0x+zT59Vp2Dh
b/BYwRm49zs8VvA43Ps9Hit4Esb9Po8VPAPj/ojHCs7Csz/hsYJz8OzPeKzgPOz6Cx4ruACn/orH
CrLg1Nk8VvAnmPS3PFbwOkz6Io8VvAF//p7HCt6CNdOIzQfqL7DmyzxW8B5c+QqPFbwPQ87hsYIP
YchXeazgY3jxNR4r+ARefIPHCj6FDefyWMFnsOFbPFbwBVw4j8cKvoQBF/BYwdcwYB+PFfxDush5
sQ/fSDfPWn8H0y1Dpou9uSTL8qz1JZhuOTJd8QP8NoT8Fvv1kwwlvxU/wmrDeP76J1htOFkt9vAX
6dGKxwpypOCZ7CtwWckz2b/AYBXPZOfAYDUZrLgKgy3Pc9q/wmAr8Jz2rzDYCmSw4hq8tSJ5K45E
HvyzOo8VFMA6a/JYQSGssxaPFfjgmjR+dQtmWpVnt2+DqjHlwVGrk6OKfJhpDTJTUQAzrckz3oUw
01o8410IM61FZip8MNNImvuWFmzUyzbqgo3WphlvGQSqY8gDIit1w0rrspWWgZXWo1lwHEUFM2zO
FAEiEy0HE23AJhoM/7yX/TME/hnF/hkC/4yi+XAc40pwQKIweGgjmhkH3QMiCw2HhTZmC/XAQpvQ
zDioGogcVMBBm7KDSphnM5gnPfkU3LM5u6eGe7agWXJQJIh8MwLUkqk8fLMV+2Z5+GYr9s0KsMzW
bJkVYJmt2TIrgtoYqgciy6wEy2zLllkZltmOZ84rwzHbsWPeA8dsbxyzChyzAzsmjQg0gpXRnHk1
UCdDjUFkmtVhmp159rw67LIz22UNUBdDzUDkmTXhmV159rwm3LIru2UtUDdDLUFkmZGwzGieR4+E
VUazVXpB3c2MuheG2Z3n0WuDehhqCyLTrAPT7GlMsy5MM4Zn1OvCLmPYLuuBehnqCKIZ9fqg3oY6
gWhuvQEcsw8cM565C3i8ReMDXWFP9tx6FLif4YZwzP48u94QhtnfGGYjGOYAY5iN4ZUD2SsbwysH
Gq9sApscZObVm8AnB8Enyfp7wYNs6g0im2wGGmKoD8j2yubwyKHGK8n++8F6bJdsCYOMg0HaPABM
8+mtQMMMDQTZJtkaJjncmGRrmORwmCTZ/mD4jE1DQLN5fVt45EjjkW01WQ15ZDtNRmNTHMi2yPbg
0Y5FdoA7xpu59Q6wx3jYI9n+cNiKTSNA9gx7J7jjWMcdO8Mdx5m59c4wx3HGHLvAHMebGfUusMXx
bItdQRPMjHpXmOMEM4/eDd440fHGaLjiJMcVuyNNNhbZHbY42dhiD9higmOLPeCICWyLPUFTDE0G
2a4YA05kV4yBKyayKxJPAZMd9gJNNc7YC6Y41cyd9wYn8dx5bxhjEhsjcRJ4rUU+nwSTWMvVPrDE
ZPZG8vhkmEPRDHo/eGOK4439YIsp7I39QanGG/vDG1PZG8nap8ML/PPkA+CJ09kTB4JmGHscCGec
wc5I1j4TLrCZaRZoi3nlIBjjTJ4rHwyaxe5IPAe8jXkIeLbDc8HbmYeC5wQY5FB44xw2yFjQXDZI
4vlge248DjwPTJQG2uW8Ng7+OA/+SP6ejj7+bq4Og0fOZ48kZ1+A/vwepoWgopnxEbDIdGc2fAQc
Mp0dkq7vxei7+3kJ+IDZahS8cWGAS5KpL0Xf/KCTliEdMike/rjYmeumvByZnHEMaInjkmNgkEvY
IMnQV1CPmykD9KDz6rHwx6XwR7L1TPS8j5r6ONjjMrZHcvWV1NM2vAp83Gw1AQn9bKbVoCKLnABz
XA5zJEtfA0sv7pCTUMvgtZNgkBnO/DXldcg0bz0ZlBlgk5Nhk5nGJsnW18PWTzFtAD3ibDcFLrmq
mEtOgT+uMi6ZCF7t8CZwkUlORV6DTLQZ9IeANVuQ7fnlJPBaY5WUtiL5nTEZaV0xr6TaNtSesMjN
t8HNi+aZp8En1zvzxylIGzgR7wAXeWUKbHIDbJLsfCfs/GlnTSo88n7jkdPBGx3DnA6r3BgwQzwD
eRNn4j3gZwM+5QxY5SZYJTn6Xjj6WWfNTNjlZmOX5OX74OXPGd4PDnRKsvH9sPHni1UOoHLOpDlI
2zgRHwS/UOz1c2GW24vN6VLtAdRsl5wH3mE8k9JhpJcCtp2Pyk5UiI6ALhRraT7McifMkmz8Qdj4
ywHr0uCXuxy/JAM/CgPPMnwM/EqxttLhl7vhl2Tkx2Hkrwas9W+zEGv2mjWUHkL6U7EtFukTMPDX
SrxukX4YVbgL7uyHYeGvB6xbrE+i8mcnL0E+YDKlU0hvlGhvqX4Etv3mHdVHUX3LpGVIh0yy82nk
t4u94j7UHkCN6AzonRIt3qf/gOpfTFqOdNikkkdmBdYd4XXEj4HfZc4APwj2+/pR/Ff0L7Ht35ax
P+wm7rlzWHOs5HY85+8N+0fYRb7K7tjC2L83rCq2uL/EFuZ3sYQFh33QpAkvCz6mZU1ki/P3VpO7
/aaa0MeU13Mp4hmrVejDqornSsR5/2+q4TVfRZyx8LeKYqod+iz+LvEvzEO/VJlh96gX7vLv3t+w
Svl9NWGVdFC4N5l+cUWJ3y/j//cPYQPR6tq7tvqmVfJ3qYSZ5uiXvjit+UdNws6htV/v2tr5u7bm
DfjdLCXOZ3h31Qd/Lt+lzd13tBniTU5Nn1Ta3nrDT6CtE3dt63jJtqbabZW2r15PiOqDP3dra8Md
bQXbbQX+XhvTlv+3/MxVmfTbbbA8+zYtNyFbnA9Zd/ttN/tLvs/Kcq2btaPfU3L3n3v4CaGm83MP
HawoT1pEK/55r3/r9+NYP7gyg1Ii4ouvQTbXOtavD5ocEYcts3nLMXwug82a+IgBljco3rWNqbaV
g79L/dmMkMkBP5uhXZnqU1dmRIhVqfO3VpRrrutIXJ/UafTzGS07efvPnLkgLX1+QnrqnNneOcne
9JQkb1JyclJiuj/NTJg9tfkc/oVFKUkJ6d6kxYkpCbOnJXkT52DD1MTUpNnp3t84Zp8jVDWfhz5B
oyddUXf8fF3A9u8j3Ot8/kyr0supVsNmrvjfeg29x8aAfa40tIHVsH+ZJr99NgN/ko9+eq9S4Uc4
Pp+7Kxc7o6W+W3DLwHcb47YaD+oT03xgQy+OYtEhTF2IozQzdVZCepI3LWl2WioqqelLvAvSUmdP
8w7u0bd/TIw3fcHspKne9Dne2JjBzUq5jkpcQ0Ebgva7F7utEmtC/NdQ0Pago+65QbedLYNK2YPn
Edo6e5BlaSvHSuE/Ue5+QftdCb//OUKjXN6wKq7td3yOFqEtXFFh2rXF2WbPXT5BJ/MJ6N3n8p+o
0B9cXteUf+PdO4Q+HxYV5i3l3buHZoXhXQO2Kf3d2wS8u9n30NzQ512Jv//u2uuuEqHdG+58dx3l
9kaEuFc722y6y7t3vHPfdba7imtqqU8S338CK/5NDzBUHPCTAQAAhtthRn2hHrYPAOgD+hQAAAEA
6QMoAAAAgBYAAOAQAADgEAAAgBYAAAUAAAAKAAAAAAAAAAAAAAABAAAAAAAAAQ8A8gNiAQAALwDI
DwwAAAAwANIPBAAAAAAAAAAPANUHmAAAAAAAtw9EAAAAVABpAG0AZQBzAAAAAACwRwAwD9IABAAA
fwCQhX8A4LB/AOCw/78g1v+/kNJ0AAAACAEAp3QAjIr/v5DSdAAAAAAABAAQALcPRAAAAFMAeQBt
AGIAbwBsAAAAsEcAMA/SAAQAAH8AkIV/AOCwfwDgsP+/INb/v5DSdAAAAAgBAKd0AIyK/7+Q0nQA
AAACAAQAAACkDwoAAACAAGAAAAD/////AAClDwwAAAAAAAAILgAAAAIAAAAAAKkPCgAAAAcAAAAC
AAkEAABAAKMPbgAAAAUA//0/AAAAIiAAAGQAAAAAAAAAZAAAAAAAAAAAAEACAAAAAAIAAAD//+8A
AAAAAP///////xgAAAAAAQAAAAUAACABIAEAAAAAAAUAAEACQAIAAAAAAAUAAGADYAMAAAAAAAUA
AIAEgAQAAAAADwALBFACAAAPAADwSAIAAAAABvBYAAAACCQAAAoAAAAkAAAACQAAAAEAAAAHAAAA
AgAAAAQAAAADAAAABwAAAAQAAAAEAAAABQAAAAQAAAAGAAAACAAAAAcAAAAFAAAACAAAAAUAAAAJ
AAAACAAAAJ8AAfCMAQAAQgAH8CQAAAADBDlrY0QuXK++SXuFpo+MT+v/ANwBAAAEAAAAAAAAAAAA
1iBCAAfwJAAAAAMEGxyD5cCpzOp+8QUfBFOQ4/8A8jIAAAEAAADcAQAAAADWIEIAB/AkAAAAAwSg
AoNvpIP/Q99Uobtccyuu/wAqJwAAAQAAAM40AAAAANYgQgAH8CQAAAADBISu1TE6AhRaN5VwlZlB
6MH/AIggAAABAAAA+FsAAAAA1iBCAAfwJAAAAAMEv6tFYG5w6QY3VM90K83V1/8AVCcAAAEAAACA
fAAAAADWIEIAB/AkAAAAAwSSmE+jUxmwCKwe/r+lgUe//wBsWwAAAQAAANSjAAAAANYgQgAH8CQA
AAADBBNZURlVLHaF+nnCc6mkDVr/AJcjAAABAAAAQP8AAAAA1iBCAAfwJAAAAAMEI8BuMHWDvEb6
/wi3VCfxSv8AKHwAAAEAAADXIgEAAADWIEIAB/AkAAAAAwS8AwGiHtIE5Ua3pP5HdcFp/wDxogAA
AQAAAP+eAQAAANYgYwAL8CQAAACBAQQAAAiDAQAAAAi/ARAAEADAAQEAAAj/AQgACAABAgIAAAgg
ABrxCAAAAP8AAAD/gAAAQAAe8RAAAAAEAAAI/4AAAAIAAAj3AAAQHwDwDxwAAAAAAPMDFAAAAAIA
AAAAAAAAAAAAAAAAAIAAAAAADwDQB68BAAAfABQEHAAAAAAAFQQUAAAAuh117ADKmjsyTs3JAMqa
OwEBAAEPAPoDZwAAAAAA/gMDAAAAAAEAAAD9AzQAAABkAAAAZAAAAGQAAABkAAAAAAAAALDS/78A
AHQAgB96AAAAAACw0v+/gP///4D///8AAAAAcAD7AwgAAAAAAAAAcAgAAHAA+wMIAAAAAQAAAEAL
AAAfAAcEPAAAAAAA/QM0AAAAIQAAAGQAAAAhAAAAZAAAAFCWDQECAAAAANP/vwAAAABnAAAAINb/
vwAAAAAAAAAAAAHSyB8AEwQ8AAAAAAD9AzQAAABkAAAAZAAAAGQAAABkAAAAUJYNAQIAAAAA0/+/
AAAAAGcAAAAg1v+/AAAAAAAAAAAAAdLIHwD/AxQAAAACAAAEDAAAAAAAAAAAAAAAAgAAAA8AiBNw
AAAADwCKE2gAAAAAALoPFAAAAF8AXwBfAFAAUABUADIAMAAwADEAAACLE0QAAAAPAIgXPAAAAAAA
iRc0AAAAAAAAAAAAAAAAAAAAWAIAAAABAQABAQAAAQEBAAEAAAAAAAAAaM8AAAAAAAAAAAAAgAIB
4D8A2Q8MAAAAAADaDwQAAAAAACUADwDwDwkPAAAAAPMDFAAAAAMAAAAAAAAAAgAAAAABAAAAAAAA
AACfDwQAAAAGAAAAAACoD2MAAABJbnRlcnByZXRhdGlvbiBvZiBtb2RlbCByZXN1bHRzIHRoYXQg
c2hvdyBjaGFuZ2VzIGluCyB0aGUgZWZmZWN0aXZlIGNsaW1hdGUgc2Vuc2l0aXZpdHkgd2l0aCB0
aW1lLgsAAKEPFAAAAGQAAAAAAAAAAABkAAAAAQAAAAEAAACqDxQAAABjAAAABgAAAAkIAAABAAAA
AAAAABAAnw8EAAAABQAAAAAAqA9oAAAAQWx0ZXJuYXRpdmUgdGl0bGU6IElzIHRoZSBjbGltYXRl
IHNlbnNpdGl2aXR5IGRlYWQ/DQ1TLiBDLiBCLiBSYXBlciwgQWxmcmVkIFdlZ2VuZXIgSW5zdGl0
dXRlLCBHZXJtYW55DQ0AAKEPJgAAAGkAAAAAAAAAAAA0AAAAAgAAAAIAAQAAAAEAAAABADQAAAAA
AAAAAACqD0gAAAA9AAAABgAAAAkIAAAGAAAABwAAAAMACQgAAAgAAAAGAAAACQgAAAgAAAAHAAAA
AwAJCAAAFQAAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAAAAQAAAAAAAAAAgAAAAIBAAAAAAAAAACf
DwQAAAAAAAAAAACoDx8AAABEZWZpbml0aW9uIGZvciBzbGFiIG9jZWFuIEFHQ01zAAChDxwAAAAg
AAAAAAAAAAAAHwAAAAAAAgAkAAEAAAAAAAAAAACqDxIAAAAZAAAAAAAAAAcAAAABAAAAAwAQAJ8P
BAAAAAEAAAAAAKAPAgMAAFQAaABlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkAdgBp
AHQAeQAgAGkAcwAgAGQAZQBmAGkAbgBlAGQAIABhAHMAIAB0AGgAZQAgAGUAcQB1AGkAbABpAGIA
cgBpAHUAbQAgAHcAYQByAG0AaQBuAGcAIABmAG8AcgAgAGEAIABkAG8AdQBiAGwAaQBuAGcAIABv
AGYAIAB0AGgAZQAgAGMAbwBuAGMAZQBuAHQAcgBhAHQAaQBvAG4AIABvAGYAIABDAE8AMgAsACAA
ZQB4AHAAcgBlAHMAcwBlAGQAIABhAHMADQANAETwVAAyAHgAIAA9ACAARPBRADIAeAAgAC8AIABs
8CwADQANACAAIAAgACAAdwBoAGUAcgBlACAARPBRADIAeAAgAGkAcwAgAHQAaABlACAAZABvAHUA
YgBsAGUAZAAgAEMATwAyACAAZgBvAHIAYwBpAG4AZwAgACgAVwBtAC0AMgApACAAYQBuAGQAIABs
8CAAaQBzACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsAIABwAGEAcgBhAG0AZQB0AGUAcgAgACgA
VwBtAC0AMgAvAEsAKQAuACAADQBCAHUAdAAgAHQAaABlAHMAZQAgAG0AaQB4AGUAZAAgAGwAYQB5
AGUAcgAgAG8AYwBlAGEAbgAgAG0AbwBkAGUAbABzACAAYQByAGUAIABuAG8AdAAgAHQAaABlACAA
bwBuAGUAcwAgAHUAcwBlAGQAIABmAG8AcgAgAHQAcgBhAG4AcwBpAGUAbgB0ACAAcwBpAG0AdQBs
AGEAdABpAG8AbgBzACAAYQBuAGQAIAB0AGgAZQAgAGYAZQBlAGQAYgBhAGMAawBzAC8AcwBlAG4A
cwBpAHQAaQB2AGkAdAB5ACAAbQBhAHkAIABiAGUAIABkAGkAZgBmAGUAcgBlAG4AdAAgACgAcwBl
AGUAIABCAG8AZQByACAAYQBuAGQAIABZAHUAIAAyADAAMAAzAGEAKQAuACAAAAChD14BAAB4AAAA
AAAAEAAAWgARAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBcAAAAAAABEAAAAABaAJwAAAAA
AAAQAABaAGcAAAAAAAIAGAABAAAAAAAKABgA5/8QAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAA
AgAYAAIAAAAAAAoAGADn/wMAAAAAAAIAGAABAAAAAACCAAEAGAABAAAAAAACABgAAwAAAAAACgAY
AOf/AgAAAAAAAgAYAAEAAAAAAIIAAQAYAA0AAAAAAAIAGAABAAAAAACCAAEAGAABAAAAAAACABgA
AgAAAAAACgAYAOf/EgAAAAAAAgAYAAEAAAAAAAoAGADn/wwAAAAAAAIAGAACAAAAAAAKABgAHgAG
AAAAAAACABgAAQAAAAAAggABABgAHgAAAAAAAgAYAAIAAAAAAAoAGAAeAKAAAAAAAAIAGAACAAAA
AAAAAAAAqg8uAAAAigAAAAYAAAAJCAAABAAAAAcAAAAAAAkIAADzAAAABgAAAAkIAAABAAAAAAAA
AAAA8wMUAAAABwAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPJQAAAEVmZmVjdGl2
ZSBjbGltYXRlIHNlbnNpdGl2aXR5IGRlZmluZWQAAKEPFAAAACYAAAAAAAAAAAAmAAAAAAACACQA
EACfDwQAAAABAAAAAACgD4oEAABNAHUAcgBwAGgAeQAgACgAMQA5ADkANQApACAAZABlAGYAaQBu
AGUAZAAgAHQAaABlACAAGCBlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUA
bgBzAGkAdABpAHYAaQB0AHkAGSAsACAAZABlAG4AbwB0AGUAZAAgAETwVAAyAHgAZQBmAGYALAAg
AGEAcwAgAHQAaABlACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAcgBlAHMAcABvAG4AcwBlACAA
dABvACAAYQAgAGQAbwB1AGIAbABpAG4AZwAgAG8AZgAgAEMATwAyACAAdwBoAGkAYwBoACAAdwBv
AHUAbABkACAAbwBjAGMAdQByACAAaQBmACAAdABoAGUAIABBAE8ARwBDAE0AIAB3AGEAcwAgAHIA
dQBuACAAdABvACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAdwBpAHQAaAAgAGYAZQBlAGQAYgBh
AGMAawAgAHMAdAByAGUAbgBnAHQAaABzACwAIAByAGUAYQBsAGkAcwBlAGQAIABhAHQAIABhACAA
cABhAHIAdABpAGMAdQBsAGEAcgAgAHQAaQBtAGUALAAgAGgAZQBsAGQAIABmAGkAeABlAGQALgAg
AFQAaABlACAAZQBxAHUAYQB0AGkAbwBuACAAZgBvAHIAIAB0AGgAZQAgAGYAZQBlAGQAYgBhAGMA
awAgAHAAYQByAGEAbQBlAHQAZQByACAAdABoAGUAbgAgAGkAbgBjAGwAdQBkAGUAcwAgAGEAIABo
AGUAYQB0ACAAZgBsAHUAeAAgAGIAZQBsAG8AdwAgAHQAaABlACAAYQB0AG0AbwBzAHAAaABlAHIA
ZQAgAGQAZQBuAG8AdABlAGQAIABE8EYALAANAA0AbPAgAD0AIAAoAETwUQAgAC0AIABE8EYAKQAg
AC8AIABE8FQADQANACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABhAG4AZAAgAHQAaABlACAA
ZQBmAGYAZQBjAHQAaQB2AGUAIABjAGwAaQBtAGEAdABlACAAcwBlAG4AcwBpAHQAaQB2AGkAdAB5
ACAAYwBhAG4AIABiAGUAIABlAHgAcAByAGUAcwBzAGUAZAAgAGEAcwANAA0ARPBUADIAeABlAGYA
ZgAgAD0AIABE8FEAMgB4ACAALgAgAETwVAAgAC8AIAAoAETwUQAgAC0AIABE8EYAKQAuAA0ADQBU
AGgAZQAgAGUAZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkA
dgBpAHQAeQAgAGkAcwAgAHQAaAB1AHMAIABhACAAaAB5AHAAbwB0AGgAZQB0AGkAYwBhAGwAIABj
AG8AbgBjAGUAcAB0ACAAZQB2AGUAbgAgAHcAaQB0AGgAaQBuACAAdABoAGUAIAByAGUAYQBsAG0A
IABvAGYAIABjAGwAaQBtAGEAdABlACAAbQBvAGQAZQBsAGwAaQBuAGcAAAChD/ABAABbAQAAAAAA
EAAAWgATAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBIAAAAAAABEAAAAABaAAEAAAAAAAAQ
AABaACEAAAAAAAEYAAAAAAEAWgABAAAAAAAAGAAAAQBaAGwAAAAAAAAQAABaAEMAAAAAAAIAFAAB
AAAAAACCAAEAFAABAAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAACgAUAB4AMQAAAAAAAgAUAAEA
AAAAAAoAFADn/9oAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQABAAA
AAAAAgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFAACAAAAAAACABQAAQAAAAAA
CgAUAOf/AgAAAAAAAgAUAAEAAAAAAIIAAQAUAEwAAAAAAAIAFAABAAAAAACCAAEAFAABAAAAAAAC
ABQAAgAAAAAACgAUAOf/AwAAAAAACgAUAB4AAwAAAAAAAgAUAAEAAAAAAIIAAQAUAAEAAAAAAAIA
FAACAAAAAAAKABQA5/8DAAAAAAACABQAAQAAAAAAggABABQABQAAAAAAAgAUAAEAAAAAAIIAAQAU
AAQAAAAAAAIAFAABAAAAAACCAAEAFABxAAAAAAACABQAAACqDy4AAABvAQAABgAAAAkIAAAOAAAA
BwAAAAAACQgAAMgAAAAGAAAACQgAAAEAAAAAAAAAAADzAxQAAAAIAAAABAAAAAIAAAAEAQAAAAAA
AAAAnw8EAAAAAAAAAAAAqg8KAAAAAQAAAAEAAAAAABAAnw8EAAAAAQAAAAAAqg8KAAAAAQAAAAEA
AAAAAAAA8wMUAAAABQAAAAQAAAAAAAAAAQEAAAAAAAAAAPMDFAAAAAkAAAAEAAAAAAAAAAUBAAAA
AAAAAADzAxQAAAAKAAAABAAAAAAAAAAGAQAAAAAAAAAA8wMUAAAACwAAAAQAAAAAAAAABwEAAAAA
AAAAAOoDAAAAAA8A+AOiCQAAAgDvAxgAAAABAAAAAQIHCQgAAAAAAAAAAAAAAAAAAANgAPAHIAAA
AP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAAYADwByAAAAD///8AAAAAAJaWlgAAAAAA
+99TAP+ZZgDMMwAAmWYAAGAA8AcgAAAA////AAAAAACAgIAAAAAAAJnM/wDMzP8AMzPMAK9n/wBg
APAHIAAAAN728QAAAAAAlpaWAAAAAAD///8Ajcb/AABmzAAAqAAAYADwByAAAAD//9kAAAAAAHd3
dwAAAAAA///3ADPMzAD/UFAA/5kAAGAA8AcgAAAAAICAAP///wAAWlgA//+ZAABkYgBtb8cAAP//
AAD/AABgAPAHIAAAAIAAAAD///8AXB8AAN/SkwBxPjkAvnlgAP//mQDTohkAYADwByAAAAAAAJkA
////AAAzZgDM//8AM2bMAACwAABmzP8A/+cBAGAA8AcgAAAAAAAAAP///wAzZpkA4+vxAAAzmQBG
iksAZsz/APDlAABgAPAHIAAAAGhrXQD///8Ad3d3ANHRywCQkIIAgJ6oAP/MZgDp3LkAYADwByAA
AABmZpkA////AD4+XAD///8AYFl7AGZm/wCZzP8A//+ZAGAA8AcgAAAAUj4mAP///wAtIBUA38CN
AIx7cACPXy8AzLQAAIyeoAAAAKMPPgAAAAEA//0/AAAAIiAAAGQAAAAAAAEAZAAAAAAAAAAAAEAC
AAAAAAcAAAD//+8AAAAAAP///////ywAAAAAAwAAEACjD3wAAAAFAP/9PwABACIgAABkAAAAAAAA
AGQAFAAAANgAAABAAgAAAAAHAAAA///vAAAAAAD///////8gAAAAAAEAAIAFAAATINQBIAEAAAIA
HACABQAAIiDQAkACAAACABgAgAUAABMg8ANgAwAAAgAUAIAFAAC7ABAFgAQAAAAAIACjD24AAAAF
AP/9PwAAACIgAABkAAAAAAAAAGQAHgAAAAAAAABAAgAAAAAHAAAA///vAAAAAAD///////8MAAAA
AAEAAAAFAAAgASABAAAAAAAFAABAAkACAAAAAAAFAABgA2ADAAAAAAAFAACABIAEAAAAAFAAow9S
AAAABQAAAAEJAAAAAAEAAAAAAAAAAQABCQAAAAABACABAAAAAAIAAQkAAAAAAQBAAgAAAAADAAEJ
AAAAAAEAYAMAAAAABAABCQAAAAABAIAEAAAAAGAAow8MAAAAAQAAAAAAAAAAAAAAcACjDz4AAAAF
AAAAAAAAAAAAAgAcAAEAAAAAAAAAAgAYAAIAAAAAAAAAAgAUAAMAAAAAAAAAAgASAAQAAAAAAAAA
AgASAIAAow8+AAAABQAAAAAAAAAAAAIAGAABAAAAAAAAAAIAFAACAAAAAAAAAAIAEgADAAAAAAAA
AAIAEAAEAAAAAAAAAAIAEAAPAAwEDAUAAA8AAvAEBQAAEAAI8AgAAAAGAAAABgQAAA8AA/CcBAAA
DwAE8CgAAAABAAnwEAAAAAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAAEAAAFAAAADwAE8NIAAAAS
AArwCAAAAAIEAAAACgAAkwAL8DYAAAB/AAEAAQCAAAAVfwCHAAEAAACBAQQAAAiDAQAAAAi/AQEA
EQDAAQEAAAj/AQEACQABAgIAAAgAABDwCAAAAIABsAHQFFAEDwAR8BAAAAAAAMMLCAAAAAAAAAAB
ANBUDwAN8FQAAAAAAJ8PBAAAAAAAAAAAAKgPIAAAAENsaWNrIHRvIGVkaXQgTWFzdGVyIHRpdGxl
IHN0eWxlAACiDwYAAAAhAAAAAAAAAKoPCgAAACEAAAABAAAAAAAPAATwFgEAABIACvAIAAAAAwQA
AAAKAACDAAvwMAAAAH8AAQABAIAAgBZ/AIEBBAAACIMBAAAACL8BAQARAMABAQAACP8BAQAJAAEC
AgAACAAAEPAIAAAA4ASwAdAUAA8PABHwEAAAAAAAwwsIAAAAAQAAAAIA0FQPAA3wngAAAAAAnw8E
AAAAAQAAAAAAqA9SAAAAQ2xpY2sgdG8gZWRpdCBNYXN0ZXIgdGV4dCBzdHlsZXMNU2Vjb25kIGxl
dmVsDVRoaXJkIGxldmVsDUZvdXJ0aCBsZXZlbA1GaWZ0aCBsZXZlbAAAog8eAAAAIQAAAAAADQAA
AAEADAAAAAIADQAAAAMADAAAAAQAAACqDwoAAABTAAAAAQAAAAAADwAE8MgAAAASAArwCAAAAAQE
AAAACgAAgwAL8DAAAAB/AAEAAQCAAKAXfwCBAQQAAAiDAQAAAAi/AQEAEQDAAQEAAAj/AQEACQAB
AgIAAAgAABDwCAAAAGAPsAFgBoAQDwAR8BAAAAAAAMMLCAAAAAIAAAAHAdBUDwAN8FAAAAAAAJ8P
BAAAAAQAAAAAAKAPAgAAACoAAAChDxQAAAACAAAAAAAAAAAAAgAAAAAAAgAOAAAA+A8EAAAAAAAA
AAAAqg8KAAAAAgAAAAEAAAAAAA8ABPDKAAAAEgAK8AgAAAAFBAAAAAoAAIMAC/AwAAAAfwABAAEA
gADAGH8AgQEEAAAIgwEAAAAIvwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAABgD7AH0A6A
EA8AEfAQAAAAAADDCwgAAAADAAAACQLQVA8ADfBSAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAA
oQ8WAAAAAgAAAAAAAAgAAAEAAgAAAAAAAgAOAAAA+g8EAAAAAAAAAAAAqg8KAAAAAgAAAAEAAAAA
AA8ABPDKAAAAEgAK8AgAAAAGBAAAAAoAAIMAC/AwAAAAfwABAAEAgADgGX8AgQEEAAAIgwEAAAAI
vwEBABEAwAEBAAAI/wEBAAkAAQICAAAIAAAQ8AgAAABgDyAQ0BSAEA8AEfAQAAAAAADDCwgAAAAE
AAAACALQVA8ADfBSAAAAAACfDwQAAAAEAAAAAACgDwIAAAAqAAAAoQ8WAAAAAgAAAAAAAAgAAAIA
AgAAAAAAAgAOAAAA2A8EAAAAAAAAAAAAqg8KAAAAAgAAAAEAAAAAAA8ABPBIAAAAEgAK8AgAAAAB
BAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAA
PwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAACAAug8kAAAAQgBs
AGEAbgBrACAAUAByAGUAcwBlAG4AdABhAHQAaQBvAG4ADwDuA9gBAAACAO8DGAAAAAAAAAAPEAAA
AAAAAAAAAIAAAAAABwAAAw8ADASIAQAADwAC8IABAAAgAAjwCAAAAAMAAAADCAAADwAD8BgBAAAP
AATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAAAgAAAUAAAAPAATwbAAAABIA
CvAIAAAAAggAACACAABDAAvwGAAAAIAAoNzuBL8BAAABAP8BAAABAAEDAgQAAAAAEPAIAAAAwAOw
AdAUkAYPABHwEAAAAAAAwwsIAAAAAAAAAA8A0LQPAA3wDAAAAAAAng8EAAAAAAAAAA8ABPBsAAAA
EgAK8AgAAAADCAAAIAIAAEMAC/AYAAAAgABg3e4EvwEAAAEA/wEAAAEAAQMDBAAAAAAQ8AgAAADg
B5ADUBMADA8AEfAQAAAAAADDCwgAAAABAAAAEADQtA8ADfAMAAAAAACeDwQAAAABAAAADwAE8EgA
AAASAArwCAAAAAEIAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/
AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAA
DwDuA9gBAAACAO8DGAAAAAEAAAANDgAAAAAAAAAAAIAAAAAABwAAAw8ADASIAQAADwAC8IABAABA
AAjwCAAAAAMAAAADEAAADwAD8BgBAAAPAATwKAAAAAEACfAQAAAAMAAAALoBAAC5AAAACAEAAAIA
CvAIAAAAABAAAAUAAAAPAATwbAAAABIACvAIAAAAAhAAACACAABDAAvwGAAAAIAAIOTuBL8BAAAB
AP8BAAABAAEDAgQAAAAAEPAIAAAAgAGwAdAUUAQPABHwEAAAAAAAwwsIAAAAAAAAAA0A0LQPAA3w
DAAAAAAAng8EAAAAAAAAAA8ABPBsAAAAEgAK8AgAAAADEAAAIAIAAEMAC/AYAAAAgABg5u4EvwEA
AAEA/wEAAAEAAQMDBAAAAAAQ8AgAAADgBLAB0BQADw8AEfAQAAAAAADDCwgAAAABAAAADgDQtA8A
DfAMAAAAAACeDwQAAAABAAAADwAE8EgAAAASAArwCAAAAAEQAAAADAAAgwAL8DAAAACBAQAAAAiD
AQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAA
gICAAAAAAAC74OMAMzOZAACZmQCZzAAADwDuA9gBAAACAO8DGAAAAAEAAAANDgAAAAAAAAAAAIAA
AAAABwAAAw8ADASIAQAADwAC8IABAABQAAjwCAAAAAMAAAADFAAADwAD8BgBAAAPAATwKAAAAAEA
CfAQAAAAAAAAAHwAAAAAAAAAAAAAAAIACvAIAAAAABQAAAUAAAAPAATwbAAAABIACvAIAAAAAhQA
ACACAABDAAvwGAAAAIAA4MItBr8BAAABAP8BAAABAAEDAgQAAAAAEPAIAAAAgAGwAdAUUAQPABHw
EAAAAAAAwwsIAAAAAAAAAA0A0LQPAA3wDAAAAAAAng8EAAAAAAAAAA8ABPBsAAAAEgAK8AgAAAAD
FAAAIAIAAEMAC/AYAAAAgACgwy0GvwEAAAEA/wEAAAEAAQMDBAAAAAAQ8AgAAADgBLAB0BQADw8A
EfAQAAAAAADDCwgAAAABAAAADgDQtA8ADfAMAAAAAACeDwQAAAABAAAADwAE8EgAAAASAArwCAAA
AAEUAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkA
AAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAADwDuA0gDAAAC
AO8DGAAAAAEAAAANDgAAAAAAAAAAAIAAAAAABwAAAw8ADAT4AgAADwAC8PACAABgAAjwCAAAAAMA
AAAHGAAADwAD8IgCAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAABgA
AAUAAAAPAATwJAEAALIECvAIAAAABhgAAAAKAABDAAvw/AAAAH8AgACAAARBAwAAAAXB5AAAAAYB
AQAAAAsAZgBpAGcAMQAuADEALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQAbwBzAGgAIABI
AEQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3ADMAQQBFAEQA
OgAAAAAAEPAIAAAA8AOwAbATag0PAATwJAEAALIECvAIAAAABxgAAAAKAABDAAvw/AAAAH8AgACA
AARBAQAAAAXB5AAAAAYBAQAAAA4AZgBpAGcAMQB0AGkAdABsAGUALgBQAEkAQwBUACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABFAAwATQBhAGMA
aQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABC
AEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAAkADAABAXfwMPAATwSAAAABIACvAIAAAAARgAAAAM
AACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQAB
ABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAO4DdAQAAAIA7wMYAAAA
EAAAAAAAAAAAAAAAAAAAgAAAAAAHAAADDwAMBCQEAAAPAALwHAQAADAACPAIAAAABAAAAAYMAAAP
AAPwtAMAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAADAAABQAAAA8A
BPAkAQAAsgQK8AgAAAACDAAAAAoAAEMAC/D8AAAAfwCAAIAABEEBAAAABcHkAAAABgEBAAAADgBm
AGkAZwAxAHQAaQB0AGwAZQAuAFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ
8AgAAACQAMAAIBZfAw8ABPAkAQAAsgQK8AgAAAADDAAAAAoAAEMAC/D8AAAAfwCAAIAABEECAAAA
BcHkAAAABgEBAAAACwBmAGkAZwAxAC4AMgAuAFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABv
AHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcA
MwBBAEUARAA6AAAAAAAQ8AgAAADAAwAAYAztDQ8ABPAkAQAAsgQK8AgAAAAGDAAAAAoAAEMAC/D8
AAAAfwCAAIAABEEFAAAABcHkAAAABgEBAAAADgBMAGEAeQBvAHUAdAAxAC0AMQAuAFAASQBDAFQA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUA
DABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAACwBIcMgBb5CQ8ABPBIAAAAEgAK8AgA
AAABDAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJ
AAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAAmZkAmcwAAA8A7gN0BAAA
AgDvAxgAAAAQAAAAAAAAAAAAAAAAAACAAAAAAAcAAAMPAAwEJAQAAA8AAvAcBAAAcAAI8AgAAAAE
AAAABBwAAA8AA/C0AwAADwAE8CgAAAABAAnwEAAAAAAAAAB8AAAAAAAAAAAAAAACAArwCAAAAAAc
AAAFAAAADwAE8CQBAACyBArwCAAAAAIcAAAACgAAQwAL8PwAAAB/AIAAgAAEQQEAAAAFweQAAAAG
AQEAAAAOAGYAaQBnADEAdABpAHQAbABlAC4AUABJAEMAVAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAA
SABEACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBE
ADoAAAAAABDwCAAAAMAA8ADwFYMDDwAE8CQBAACyBArwCAAAAAMcAAAACgAAQwAL8PwAAAB/AIAA
gAAEQQQAAAAFweQAAAAGAQEAAAALAGYAaQBnADEALgAzAC4AUABJAEMAVAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBj
AGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
QgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAAMADAACQDP8NDwAE8CQBAACyBArwCAAAAAQcAAAA
CgAAQwAL8PwAAAB/AIAAgAAEQQYAAAAFweQAAAAGAQEAAAAOAEwAYQB5AG8AdQB0ADEALQAyAC4A
UABJAEMAVAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQA
NwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAACAEkAyAFqgNDwAE8EgA
AAASAArwCAAAAAEcAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/
AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAA
DwDuA3QEAAACAO8DGAAAABAAAAAAAAAAAAAAAAAAAIAAAAAABwAAAw8ADAQkBAAADwAC8BwEAACA
AAjwCAAAAAQAAAAEIAAADwAD8LQDAAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIA
CvAIAAAAACAAAAUAAAAPAATwJAEAALIECvAIAAAAAiAAAAAKAABDAAvw/AAAAH8AgACAAARBAQAA
AAXB5AAAAAYBAQAAAA4AZgBpAGcAMQB0AGkAdABsAGUALgBQAEkAQwBUACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQA
bwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3
ADMAQQBFAEQAOgAAAAAAEPAIAAAAkAAAAIAWhQMPAATwJAEAALIECvAIAAAAAyAAAAAKAABDAAvw
/AAAAH8AgACAAARBBwAAAAXB5AAAAAYBAQAAAAsAZgBpAGcAMQAuADQALgBQAEkAQwBUACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABF
AAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAAkAOg/4ANCwsPAATwJAEAALIECvAI
AAAABCAAAAAKAABDAAvw/AAAAH8AgACAAARBCAAAAAXB5AAAAAYBAQAAAA4ATABhAHkAbwB1AHQA
MQAtADMALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
MAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAAUAcHDIAW
3Q8PAATwSAAAABIACvAIAAAAASAAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1o
AL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kA
AJmZAJnMAAAPAO4DxwQAAAIA7wMYAAAAEAAAAAAAAAAAAAAAAAAAgAAAAAAHAAADDwAMBHcEAAAP
AALwbwQAAJAACPAIAAAABgAAAAckAAAPAAPwBwQAAA8ABPAoAAAAAQAJ8BAAAABlAQAAIIioBgAA
AAAGAAAAAgAK8AgAAAAAJAAABQAAAA8ABPAkAQAAsgQK8AgAAAACJAAAAAoAAEMAC/D8AAAAfwCA
AIAABEEJAAAABcHkAAAABgEBAAAADABMAGEAeQBvAHUAdAAxAC4AUABJAEMAVAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEA
YwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
AEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAAAAAAAAAA3gEA8ABPBeAAAAQgEK8AgAAAADJAAA
gAoAAJMAC/A2AAAAhQACAAAAhwABAAAARAEEAAAAfwEAAAEAvwEAABAAwAH/AAAA0QEBAAAA/wEY
ABgAAQICAAAIAAAQ8AgAAAAADGAJ4A2ADQ8ABPDnAAAAogwK8AgAAAAEJAAAAAoAAKMAC/A8AAAA
gACgtSkGhQACAAAAhwAGAAAAvwACAAIAgQEEAAAIgwEAAAAIvwEAABAAwAEBAAAI/wEAAAgAAQIC
AAAIAAAQ8AgAAADgCuANfhXmDA8ADfB7AAAAAACfDwQAAAAEAAAAAACoDycAAABTaW1pbGFyIHRv
IENDQ21hDUluIEJvZXIgYW5kIFl1ICgyMDAzKT8AAKEPFgAAACgAAAAAAAAAAAAoAAAAAAAEAP8A
AP4AAKoPGgAAAAsAAAAAAAAABQAAAAEAAAADABgAAAAAAAAADwAE8F4AAABCAQrwCAAAAAUkAAAA
CgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf+AAADRAQEAAAD/ARgA
GAABAgIAAAgAABDwCAAAAEAOYAmwDQAPDwAE8OgAAACiDArwCAAAAAYkAAAACgAAgwAL8DAAAACA
AAC8dQa/AAIAAgCBAQQAAAiDAQAAAAi/AQAAEADAAQEAAAj/AQAACAABAgIAAAgAABDwCAAAAOAN
4A0MFeYPDwAN8IgAAAAAAJ8PBAAAAAQAAAAAAKgPKAAAAFNpbWlsYXIgdG8gSGFkQ00yDWluIFJh
cGVyIGV0IGFsICgyMDAxKT8AAKEPIgAAACkAAAAAAAAAAAAoAAAAAAAEAP+AAP4BAAAAAAAEAP8A
AP4AAKoPGgAAABQAAAAAAAAABgAAAAEAAAADAA8AAAAAAAAADwAE8EgAAAASAArwCAAAAAEkAAAA
DAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEA
AQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAAEAAREGMAAAAABgAAeJy7
cF7wwcKNUg8Z0IAdAzPDv/+cDGxIYoxQDAYCDED5//9BTBgNAv9HwZACf4H430A7YhQMGGAIQs/5
pAEmBlaUPI9X8Wx2mcDsI4z/CKkjERBtP43AULYfACxB8hAAAHIXMAAAAAEAsAAAAAAAAhUAAKwe
AACMIAAAnCcAAN85AABsIgAATCQAABgsAACUMAAAEDUAAAAA9Q8cAAAABwEAACAFAAMAAAAASjoA
AAEAAAALAAAAAQAAAA8A6AOiFwAAAQDpAygAAACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAAAAAA
AAAAAAEAAAAAAAABDwDyA2IBAAAvAMgPDAAAADAA0g8EAAAAAAAAAA8A1QeYAAAAAAC3D0QAAABU
AGkAbQBlAHMAAAAAALBHADAP0gAEAAB/AJCFfwDgsH8A4LD/vyDW/7+Q0nQAAAAIAQCndACMiv+/
kNJ0AAAAAAAEABAAtw9EAAAAUwB5AG0AYgBvAGwAAACwRwAwD9IABAAAfwCQhX8A4LB/AOCw/78g
1v+/kNJ0AAAACAEAp3QAjIr/v5DSdAAAAAIABAAAAKQPCgAAAIAAYAAAAP////8AAKUPDAAAAAAA
AAguAAAAAgAAAAAAqQ8KAAAABwAAAAIACQQAAEAAow9uAAAABQD//T8AAAAiIAAAZAAAAAAAAABk
AAAAAAAAAAAAQAIAAAAAAgClnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6
WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6Wupp
qaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6Wuppqael
npZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6
WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6Wupp
qaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6WuppqaelnpZ6Wuppqf9o
S/fR0n2f0dLe5cm8Lz/V0exfWkfV43gR7+BTrDWto2pnzMMROBFn42JcjVtxLx7DC3gbn2CNaR1V
O2FfHI4TcBYW4yrcgnvwKJ7HW/gY06Z1VO2IfXAYjseZuAhLcTOW4xE8hzfxEVab1lG1A/bGoTgO
Z2ARluAmLMPDeBZvoOBr0zqqtsdeOATH4nRciCtxI+7GQ3gGr+NDfGVaR9V2mIuDcQxOwwW4Ajfg
LjyIp/EaPsCXpnVUbYs9cf7/AAADCgEAAAAAAAAAAAAAAAAAAAAAAAEAAADghZ/y+U9oEKuRCAAr
J7PZMAAAAMAzAAALAAAAAQAAAGAAAAACAAAAaAAAAAQAAADUAAAACAAAAOgAAAAJAAAA/AAAABIA
AAAIAQAACgAAACgBAAAMAAAANAEAAA0AAABAAQAADwAAAEwBAAARAAAAVAEAAAIAAAAQJwAAHgAA
AGQAAABJbnRlcnByZXRhdGlvbiBvZiBtb2RlbCByZXN1bHRzIHRoYXQgc2hvdyBjaGFuZ2VzIGlu
ICB0aGUgZWZmZWN0aXZlIGNsaW1hdGUgc2Vuc2l0aXZpdHkgd2l0aCB0aW1lLiAAHgAAAAsAAABU
aW0gT3Nib3JuAGkeAAAACwAAAFRpbSBPc2Jvcm4AaR4AAAACAAAANgBtIB4AAAAVAAAATWljcm9z
b2Z0IFBvd2VyUG9pbnQAZWwgQAAAAACwizQwAAAAQAAAAIB9Lcsja8QBQAAAAIBoKL2AbcQBAwAA
APYAAABHAAAAYjIAAP7///9QSUNUMloAAAAAAIcAtAARAv8MAP/+AAAASAAAAEgAAAAAAAAAhwC0
AAAAAAAeAAEACgAAAAAAhwC0AJoAAAD/gtAAAAAAAIcAtAAAAAQAAAAAAEgAAABIAAAAEAAgAAQA
CAAAACAACBGEBenkoAAAAAAAhwC0AAAAAACHALQAAAAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/
sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x
/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/
AIKB/7z//QD6/wAA5P8AAPn/BAD//wAA6//+AO3/AQAA+/8BAADp/wQAAP//ANj//QD6/wAA5P8A
APn/BAD//wAA6//+AO3/AQAA+/8BAADp/wQAAP//ANj//QD6/wAA5P8AAPn/BAD//wAA6//+AO3/
AQAA+/8BAADp/wQAAP//AOn/AHCB/7v/AQAA+f8AAOT/AAD5/wAA5/8AAOr/AAD6/wAA6P8DAP//
ANf/AQAA+f8AAOT/AAD5/wAA5/8AAOr/AAD6/wAA6P8DAP//ANf/AQAA+f8AAOT/AAD5/wAA5/8A
AOr/AAD6/wAA6P8DAP//AOn/AZyB/7v/CAAA/wAA/wAA//4A/v8HAAD/AAD/AP/9AAX//wAA/wD+
/wIAAP/+AAD//gAB///+AAL/AAD+/wcAAP8AAP8AAPv/AwAA///+AP7/BwAA/wAA/wAA/v8BAAD9
//4A/v8EAAD//wD9/wMAAP8A/v8CAAD//gAJ/wAA/wAA//8A//4AAf///gDd/wgAAP8AAP8AAP/+
AP7/BwAA/wAA/wD//QAF//8AAP8A/v8CAAD//gAA//4AAf///gAC/wAA/v8HAAD/AAD/AAD7/wMA
AP///gD+/wcAAP8AAP8AAP7/AQAA/f/+AP7/BAAA//8A/f8DAAD/AP7/AgAA//4ACf8AAP8AAP//
AP/+AAH///4A3f8IAAD/AAD/AAD//gD+/wcAAP8AAP8A//0ABf//AAD/AP7/AgAA//4AAP/+AAH/
//4AAv8AAP7/BwAA/wAA/wAA+/8DAAD///4A/v8HAAD/AAD/AAD+/wEAAP3//gD+/wQAAP//AP3/
AwAA/wD+/wIAAP/+AAn/AAD/AAD//wD//gAB///+AO//AXWB/7v/AwAA///9AAr//wD//wAA/wAA
//0ABv8A//8AAP/7AAb/AAD/AP8A/v8DAP//AP7/BQD/AAD///sA/f8HAAD//wAA/wD8//oABP8A
AP///QAK//8A/wAA/wAA/wD8//sAAP/+ABP/AP//AP//AP//AP//AP//AAD/AN3/AwAA///9AAr/
/wD//wAA/wAA//0ABv8A//8AAP/7AAb/AAD/AP8A/v8DAP//AP7/BQD/AAD///sA/f8HAAD//wAA
/wD8//oABP8AAP///QAK//8A/wAA/wAA/wD8//sAAP/+ABP/AP//AP//AP//AP//AP//AAD/AN3/
AwAA///9AAr//wD//wAA/wAA//0ABv8A//8AAP/7AAb/AAD/AP8A/v8DAP//AP7/BQD/AAD///sA
/f8HAAD//wAA/wD8//oABP8AAP///QAK//8A/wAA/wAA/wD8//sAAP/+ABP/AP//AP//AP//AP//
AP//AAD/AO//AXiB/7v/DAAA//8A//8A//8A///8AAH/AP3/BgD//wAA/wD+//wAAf8A/v/+AAL/
/wD+/wUA/wAA///+AAL//wD9/wcAAP//AAD/APz/CwD//wD//wD/AAD///0AA///AP/8AAH/APz/
AAD+//oA/v8LAP//AP//AP//AP///gDc/wwAAP//AP//AP//AP///AAB/wD9/wYA//8AAP8A/v/8
AAH/AP7//gAC//8A/v8FAP8AAP///gAC//8A/f8HAAD//wAA/wD8/wsA//8A//8A/wAA///9AAP/
/wD//AAB/wD8/wAA/v/6AP7/CwD//wD//wD//wD///4A3P8MAAD//wD//wD//wD///wAAf8A/f8G
AP//AAD/AP7//AAB/wD+//4AAv//AP7/BQD/AAD///4AAv//AP3/BwAA//8AAP8A/P8LAP//AP//
AP8AAP///QAD//8A//wAAf8A/P8AAP7/+gD+/wsA//8A//8A//8A///+AO7/AZaB/7v/DgAA//8A
//8A//8A//8AAP3/AAD9/wYA//8AAP8A/v8BAAD9/wkA/wAA//8A//8A/v8FAP8AAP///gAC//8A
/f8HAAD//wAA/wD8/wsA//8A//8A/wAA///9AAX//wD/AAD9/wAA/P8AAP7/AQAA/v/+AAv//wD/
/wD//wD//wD+//4A3f8OAAD//wD//wD//wD//wAA/f8AAP3/BgD//wAA/wD+/wEAAP3/CQD/AAD/
/wD//wD+/wUA/wAA///+AAL//wD9/wcAAP//AAD/APz/CwD//wD//wD/AAD///0ABf//AP8AAP3/
AAD8/wAA/v8BAAD+//4AC///AP//AP//AP//AP7//gDd/w4AAP//AP//AP//AP//AAD9/wAA/f8G
AP//AAD/AP7/AQAA/f8JAP8AAP//AP//AP7/BQD/AAD///4AAv//AP3/BwAA//8AAP8A/P8LAP//
AP//AP8AAP///QAF//8A/wAA/f8AAPz/AAD+/wEAAP7//gAL//8A//8A//8A//8A/v/+AO//AaWB
/7v/EwAA//8A//8A//8A//8AAP//AP8A/f8GAP//AAD/AP7/DwAA//8A/wD/AAD//wD//wD+/wUA
/wAA///+AAL//wD9/wcAAP//AAD/APz/CwD//wD//wD/AAD///0ACv//AP8AAP//AP8A/P8AAP7/
CQAA//8A/wAA///9AAv//wD//wD//wD/AADd/xMAAP//AP//AP//AP//AAD//wD/AP3/BgD//wAA
/wD+/w8AAP//AP8A/wAA//8A//8A/v8FAP8AAP///gAC//8A/f8HAAD//wAA/wD8/wsA//8A//8A
/wAA///9AAr//wD/AAD//wD/APz/AAD+/wkAAP//AP8AAP///QAL//8A//8A//8A/wAA3f8TAAD/
/wD//wD//wD//wAA//8A/wD9/wYA//8AAP8A/v8PAAD//wD/AP8AAP//AP//AP7/BQD/AAD///4A
Av//AP3/BwAA//8AAP8A/P8LAP//AP//AP8AAP///QAK//8A/wAA//8A/wD8/wAA/v8JAAD//wD/
AAD///0AC///AP//AP//AP8AAO//AWaB/7z/+gAF/wAA//8A/v8CAAD//gD+//4AAf///gD9/wEA
AP7/AQD//AAD//8A//4ABP//AAD//gAC/wAA/P8DAAD///4A/v/+AAn/AAD/AAD//wAA/f/9AAT/
/wAA//4A/v/+AP3//AD+/wIAAP/8AAP//wD//gDd//oABf8AAP//AP7/AgAA//4A/v/+AAH///4A
/f8BAAD+/wEA//wAA///AP/+AAT//wAA//4AAv8AAPz/AwAA///+AP7//gAJ/wAA/wAA//8AAP3/
/QAE//8AAP/+AP7//gD9//wA/v8CAAD//AAD//8A//4A3f/6AAX/AAD//wD+/wIAAP/+AP7//gAB
///+AP3/AQAA/v8BAP/8AAP//wD//gAE//8AAP/+AAL/AAD8/wMAAP///gD+//4ACf8AAP8AAP//
AAD9//0ABP//AAD//gD+//4A/f/8AP7/AgAA//wAA///AP/+AO7/ABaB/6P/AACB/87/AACB/87/
AACB//j/ABaB/6T//gCB/9D//gCB/9D//gCB//n/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x
/wAMgf+B/4H/gf+B/7H/AFWB/6P/BAD//wAA9/8AAPj/AQAA6P8BAADf/wEAAKf/BAD//wAA9/8A
APj/AQAA6P8BAADf/wEAAKf/BAD//wAA9/8AAPj/AQAA6P8BAADf/wEAANH/AECB/6P/AAD+/wAA
9/8AAPf/AADn/wAAg/8AAP7/AAD3/wAA9/8AAOf/AACD/wAA/v8AAPf/AAD3/wAA5/8AAK3/AQmB
/6T//gAH//8A/wAA///+AAD//gD8//4ABP8A/wAA/v8LAAD//wAA/wAA/wAA/P/9AAL/AAD+//4A
B/8AAP8AAP///QD+/wMAAP///gD+/wcAAP8AAP8AAK7//gAH//8A/wAA///+AAD//gD8//4ABP8A
/wAA/v8LAAD//wAA/wAA/wAA/P/9AAL/AAD+//4AB/8AAP8AAP///QD+/wMAAP///gD+/wcAAP8A
AP8AAK7//gAH//8A/wAA///+AAD//gD8//4ABP8A/wAA/v8LAAD//wAA/wAA/wAA/P/9AAL/AAD+
//4AB/8AAP8AAP///QD+/wMAAP///gD+/wcAAP8AAP8AANf/AQaB/6P/AAD+//0AAf8A/v8CAP8A
/P8EAAD/AP/9AA3/AAD//wAA/wD/AAD/AP3/AwAA///8AAL//wD+/wEA//0ACf8AAP8AAP8AAP/9
AAH/AP3/AgD///0Arf8AAP7//QAB/wD+/wIA/wD8/wQAAP8A//0ADf8AAP//AAD/AP8AAP8A/f8D
AAD///wAAv//AP7/AQD//QAJ/wAA/wAA/wAA//0AAf8A/f8CAP///QCt/wAA/v/9AAH/AP7/AgD/
APz/BAAA/wD//QAN/wAA//8AAP8A/wAA/wD9/wMAAP///AAC//8A/v8BAP/9AAn/AAD/AAD/AAD/
/QAB/wD9/wIA///9ANf/AQCB/6P/AAD+/wMA//8A/v/+AAH/APz//gAT//8A//8A/wAA//8AAP8A
/wAA/wD9/wEAAP7/AwD//wD9//4AC/8A//8A/wAA/wAA//kA/P8GAP//AP//AK3/AAD+/wMA//8A
/v/+AAH/APz//gAT//8A//8A/wAA//8AAP8A/wAA/wD9/wEAAP7/AwD//wD9//4AC/8A//8A/wAA
/wAA//kA/P8GAP//AP//AK3/AAD+/wMA//8A/v/+AAH/APz//gAT//8A//8A/wAA//8AAP8A/wAA
/wD9/wEAAP7/AwD//wD9//4AC/8A//8A/wAA/wAA//kA/P8GAP//AP//ANf/AQ+B/6P/AAD+/wsA
//8A/wAA//8A/wD7//4AD/8A//8A/wAA//8AAP8AAP/+AP3/AQAA/v8RAP//AP//AAD//wD/AP//
AP///gAD//8AAP3//gD9/wYA//8A//8Arf8AAP7/CwD//wD/AAD//wD/APv//gAP/wD//wD/AAD/
/wAA/wAA//4A/f8BAAD+/xEA//8A//8AAP//AP8A//8A///+AAP//wAA/f/+AP3/BgD//wD//wCt
/wAA/v8LAP//AP8AAP//AP8A+//+AA//AP//AP8AAP//AAD/AAD//gD9/wEAAP7/EQD//wD//wAA
//8A/wD//wD///4AA///AAD9//4A/f8GAP//AP//ANf/ARiB/6P/AAD+/wsA//8A/wAA//8A/wD8
/xUA/wAA/wD//wD/AAD//wAA//8A//8A/P8WAAD//wAA//8A//8AAP//AP8A//8A/wD8/wgAAP//
AAD/AAD9/wYA//8A//8Arf8AAP7/CwD//wD/AAD//wD/APz/FQD/AAD/AP//AP8AAP//AAD//wD/
/wD8/xYAAP//AAD//wD//wAA//8A/wD//wD/APz/CAAA//8AAP8AAP3/BgD//wD//wCt/wAA/v8L
AP//AP8AAP//AP8A/P8VAP8AAP8A//8A/wAA//8AAP//AP//APz/FgAA//8AAP//AP//AAD//wD/
AP//AP8A/P8IAAD//wAA/wAA/f8GAP//AP//ANf/ANyB/6L/AQD//gAD/wAA//wAAf8A/f/+AAD/
/gAG/wAA//8AAP3/AwD//wD6//wABP8AAP//+gAA//oA/v8CAAD//gD9//sAAv8AAK3/AQD//gAD
/wAA//wAAf8A/f/+AAD//gAG/wAA//8AAP3/AwD//wD6//wABP8AAP//+gAA//oA/v8CAAD//gD9
//sAAv8AAK3/AQD//gAD/wAA//wAAf8A/f/+AAD//gAG/wAA//8AAP3/AwD//wD6//wABP8AAP//
+gAA//oA/v8CAAD//gD9//sAAv8AANj/ACKB/4H/3f8EAP//AACB/9L/BAD//wAAgf/S/wQA//8A
AML/ABaB/4H/3f/9AIH/0f/9AIH/0f/9AMH/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAM
gf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ApoH/uP8DAP8AAO///gAA//4A9/8EAP//AADu/wQA
AP8AAPD/AADk/wcAAP//AP8AAPr/BAAA//8A1P8DAP8AAO///gAA//4A9/8EAP//AADu/wQAAP8A
APD/AADk/wcAAP//AP8AAPr/BAAA//8A1P8DAP8AAO///gAA//4A9/8EAP//AADu/wQAAP8AAPD/
AADk/wcAAP//AP8AAPr/BAAA//8A6f8AbYH/uP8DAP//AO//AAD+/wAA9f8AAOn/AADt/wAA4P8A
APP/AADU/wMA//8A7/8AAP7/AAD1/wAA6f8AAO3/AADg/wAA8/8AANT/AwD//wDv/wAA/v8AAPX/
AADp/wAA7f8AAOD/AADz/wAA6f8BfoH/uf/+AAT/AP8AAP3/AQAA/P8CAAD//gAA//4AA///AAD+
//sADP8AAP8AAP8AAP//AAD7//4AD/8A/wAA/wAA/wAA/wAA///+AAH///4AA///AAD8//4AC///
AAD/AAD/AAD///4AA/8AAP/8AAn/AAD/AAD/AAD/+wAC/wAA3P/+AAT/AP8AAP3/AQAA/P8CAAD/
/gAA//4AA///AAD+//sADP8AAP8AAP8AAP//AAD7//4AD/8A/wAA/wAA/wAA/wAA///+AAH///4A
A///AAD8//4AC///AAD/AAD/AAD///4AA/8AAP/8AAn/AAD/AAD/AAD/+wAC/wAA3P/+AAT/AP8A
AP3/AQAA/P8CAAD//gAA//4AA///AAD+//sADP8AAP8AAP8AAP//AAD7//4AD/8A/wAA/wAA/wAA
/wAA///+AAH///4AA///AAD8//4AC///AAD/AAD/AAD///4AA/8AAP/8AAn/AAD/AAD/AAD/+wAC
/wAA8P8BooH/uP8CAP///QAP//8AAP8AAP//AAD/AAD/AP7/BAD/AAD//QAE//8A/wD+/wUA/wAA
///+AAL/AAD+/wsAAP//AP8A//8A///6AAH/AP7/CQD//wD/AAD/AAD+/wIAAP/+AAP/AAD//QAg
/wAA/wD//wD//wD//wD/AAD//wD//wD//wD//wD//wAA2/8CAP///QAP//8AAP8AAP//AAD/AAD/
AP7/BAD/AAD//QAE//8A/wD+/wUA/wAA///+AAL/AAD+/wsAAP//AP8A//8A///6AAH/AP7/CQD/
/wD/AAD/AAD+/wIAAP/+AAP/AAD//QAg/wAA/wD//wD//wD//wD/AAD//wD//wD//wD//wD//wAA
2/8CAP///QAP//8AAP8AAP//AAD/AAD/AP7/BAD/AAD//QAE//8A/wD+/wUA/wAA///+AAL/AAD+
/wsAAP//AP8A//8A///6AAH/AP7/CQD//wD/AAD/AAD+/wIAAP/+AAP/AAD//QAg/wAA/wD//wD/
/wD//wD/AAD//wD//wD//wD//wD//wAA8P8BcoH/uP8IAP//AP//AP///AAB///8AAH/AP7/AQD/
+gD9/wAA/v8GAP//AP8A//wA/v8BAAD9/wwA//8A//8A//8A//8A/v/+AAP//wD//AD+//4AAP/8
AAX/AP//AP/+AP7/CwD//wD//wD//wD/AP7/CQD//wD//wAA/wDa/wgA//8A//8A///8AAH///wA
Af8A/v8BAP/6AP3/AAD+/wYA//8A/wD//AD+/wEAAP3/DAD//wD//wD//wD//wD+//4AA///AP/8
AP7//gAA//wABf8A//8A//4A/v8LAP//AP//AP//AP8A/v8JAP//AP//AAD/ANr/CAD//wD//wD/
//wAAf///AAB/wD+/wEA//oA/f8AAP7/BgD//wD/AP/8AP7/AQAA/f8MAP//AP//AP//AP//AP7/
/gAD//8A//wA/v/+AAD//AAF/wD//wD//gD+/wsA//8A//8A//8A/wD+/wkA//8A//8AAP8A7/8B
e4H/uP8KAP//AP//AP//AAD8/wEAAP3/AAD+/wMA/wAA/v8BAAD9/wAA/v8IAP//AP8A/wAA+/8B
AAD9/xgA//8A//8A//8A//8A/wAA//8A//8A/wAA+v/8AP3/BQD//wD///4ADf//AP//AP//AP//
AP8A/v8DAP//AP7//gDa/woA//8A//8A//8AAPz/AQAA/f8AAP7/AwD/AAD+/wEAAP3/AAD+/wgA
//8A/wD/AAD7/wEAAP3/GAD//wD//wD//wD//wD/AAD//wD//wD/AAD6//wA/f8FAP//AP///gAN
//8A//8A//8A//8A/wD+/wMA//8A/v/+ANr/CgD//wD//wD//wAA/P8BAAD9/wAA/v8DAP8AAP7/
AQAA/f8AAP7/CAD//wD/AP8AAPv/AQAA/f8YAP//AP//AP//AP//AP8AAP//AP//AP8AAPr//AD9
/wUA//8A///+AA3//wD//wD//wD//wD/AP7/AwD//wD+//4A7/8Bq4H/uP8WAP//AP//AP//AAD/
/wD//wAA//8A/wD+/wUA/wAA///+AAT//wD/AP7/CwD//wAA//8AAP//AP7/IQAA//8A/wD//wD/
/wD//wD//wD/AAD//wD//wD/AAD//wD+/wEA//0AGf//AP8A//8A/wD/AAD//wD//wD//wD//wAA
/f8DAP//AP7/AQAA2f8WAP//AP//AP//AAD//wD//wAA//8A/wD+/wUA/wAA///+AAT//wD/AP7/
CwD//wAA//8AAP//AP7/IQAA//8A/wD//wD//wD//wD//wD/AAD//wD//wD/AAD//wD+/wEA//0A
Gf//AP8A//8A/wD/AAD//wD//wD//wD//wAA/f8DAP//AP7/AQAA2f8WAP//AP//AP//AAD//wD/
/wAA//8A/wD+/wUA/wAA///+AAT//wD/AP7/CwD//wAA//8AAP//AP7/IQAA//8A/wD//wD//wD/
/wD//wD/AAD//wD//wD/AAD//wD+/wEA//0AGf//AP8A//8A/wD/AAD//wD//wD//wD//wAA/f8D
AP//AP7/AQAA7v8BaYH/t//9AAL/AAD+/wEAAPz/AgAA//4AAP/+AAP//wAA/v8BAAD+/wEA//4A
Av//AP3/AQAA+/8CAAD/+AAG/wAA/wAA//wABv//AP//AAD9//4A/v8CAAD//gAA//wAAf///gAB
///9AAL//wD+//4AAv//AP7/AADY//0AAv8AAP7/AQAA/P8CAAD//gAA//4AA///AAD+/wEAAP7/
AQD//gAC//8A/f8BAAD7/wIAAP/4AAb/AAD/AAD//AAG//8A//8AAP3//gD+/wIAAP/+AAD//AAB
///+AAH///0AAv//AP7//gAC//8A/v8AANj//QAC/wAA/v8BAAD8/wIAAP/+AAD//gAD//8AAP7/
AQAA/v8BAP/+AAL//wD9/wEAAPv/AgAA//gABv8AAP8AAP/8AAb//wD//wAA/f/+AP7/AgAA//4A
AP/8AAH///4AAf///QAC//8A/v/+AAL//wD+/wAA7v8AFoH/gf+w//4Agf/Q//4Agf/Q//4A7f8A
FoH/gf+w//4Agf/Q//4Agf/Q//4A7f8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/
gf+B/4H/sf8AQYH/g/8IAAD//wD//wAA+f8DAP8AAIH/4v8IAAD//wD//wAA+f8DAP8AAIH/4v8I
AAD//wD//wAA+f8DAP8AAKz/AC6B/4H/Av//AP7/AAD5/wAAgf/b/wAA/v8AAPn/AACB/9v/AAD+
/wAA+f8AAKn/AIOB/4v/BQAA/wAA//0AAP/+AAX//wD/AAD9//wACP8AAP8AAP8AAP7/AQAAgf/4
/wUAAP8AAP/9AAD//gAF//8A/wAA/f/8AAj/AAD/AAD/AAD+/wEAAIH/+P8FAAD/AAD//QAA//4A
Bf//AP8AAP3//AAI/wAA/wAA/wAA/v8BAAC6/wB3gf+K/wsA/wAA/wD//wD//wD+//0A/P8FAP//
AP//+gAF/wAA/wAAgf/4/wsA/wAA/wD//wD//wD+//0A/P8FAP//AP//+gAF/wAA/wAAgf/4/wsA
/wAA/wD//wD//wD+//0A/P8FAP//AP//+gAF/wAA/wAAu/8Ag4H/iv8LAP8AAP8A//8A//8A/v8D
AP//APz/DQD//wD//wD//wD//wD//ACB//j/CwD/AAD/AP//AP//AP7/AwD//wD8/w0A//8A//8A
//8A//8A//wAgf/4/wsA/wAA/wD//wD//wD+/wMA//8A/P8NAP//AP//AP//AP//AP/8ALv/AIOB
/4r/AgAA//4ABf//AP//AP7/AwD//wD8/w8A//8A//8A//8A//8A/wAAgf/1/wIAAP/+AAX//wD/
/wD+/wMA//8A/P8PAP//AP//AP//AP//AP8AAIH/9f8CAAD//gAF//8A//8A/v8DAP//APz/DwD/
/wD//wD//wD//wD/AAC4/wCMgf+J/wMA//8A/v8DAP//AP7/AwD//wD8/xEA//8A//8A//8A//8A
/wAA///+AIH/+f8DAP//AP7/AwD//wD+/wMA//8A/P8RAP//AP//AP//AP//AP8AAP///gCB//n/
AwD//wD+/wMA//8A/v8DAP//APz/EQD//wD//wD//wD//wD/AAD///4Avf8AgIH/if8FAP//AP//
/gAD//8A//4AAv8AAPz/+gAM/wAA/wAA//8AAP8AAIH/+f8FAP//AP///gAD//8A//4AAv8AAPz/
+gAM/wAA/wAA//8AAP8AAIH/+f8FAP//AP///gAD//8A//4AAv8AAPz/+gAM/wAA/wAA//8AAP8A
AL3/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/
sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x
/wBegf+d/wAA7f8AAPT/AAD+/wAA9/8AAPj/AAD1/wIA/wCZ/wAA7f8AAPT/AAD+/wAA9/8AAPj/
AAD1/wIA/wCZ/wAA7f8AAPT/AAD+/wAA9/8AAPj/AAD1/wIA/wDJ/wC7gf+i//4ABP//AP8A/P8A
APr/BQAA/wD/APb/BgD/AP8A/wD3/wAA+v8CAP8A+P8HAP//AP8A/wD7/wMAAP8Aqv/+AAT//wD/
APz/AAD6/wUAAP8A/wD2/wYA/wD/AP8A9/8AAPr/AgD/APj/BwD//wD/AP8A+/8DAAD/AKr//gAE
//8A/wD8/wAA+v8FAAD/AP8A9v8GAP8A/wD/APf/AAD6/wIA/wD4/wcA//8A/wD/APv/AwAA/wDV
/wEJgf+i/wcA/wD/AP8A//4AAP/7AAD//gAI/wD//wAA/wD//gD+/wgA//8AAP8A///+APv/AwD/
AAD+/wEA//4AAP/+AAj//wAA//8A///7AAD//gAC/wD//gCt/wcA/wD/AP8A//4AAP/7AAD//gAI
/wD//wAA/wD//gD+/wgA//8AAP8A///+APv/AwD/AAD+/wEA//4AAP/+AAj//wAA//8A///7AAD/
/gAC/wD//gCt/wcA/wD/AP8A//4AAP/7AAD//gAI/wD//wAA/wD//gD+/wgA//8AAP8A///+APv/
AwD/AAD+/wEA//4AAP/+AAj//wAA//8A///7AAD//gAC/wD//gDY/wEbgf+j/yEA/wAA/wD/AP8A
AP//AP//AP8A/wD/AP8A/wD//wAA/wAA/f8KAP8A/wD/AP//AAD6/wIA/wD9/wcA/wD/AP8AAP7/
AAD+/xEA/wD/AP8A/wD/AP8A/wD/AACt/yEA/wAA/wD/AP8AAP//AP//AP8A/wD/AP8A/wD//wAA
/wAA/f8KAP8A/wD/AP//AAD6/wIA/wD9/wcA/wD/AP8AAP7/AAD+/xEA/wD/AP8A/wD/AP8A/wD/
AACt/yEA/wAA/wD/AP8AAP//AP//AP8A/wD/AP8A/wD//wAA/wAA/f8KAP8A/wD/AP//AAD6/wIA
/wD9/wcA/wD/AP8AAP7/AAD+/xEA/wD/AP8A/wD/AP8A/wD/AADX/wDTgf+j/wQA//8A//oABf8A
//8A//cAA/8A///+AP7/+QAA//4AAf8A/v8DAP8AAP3//gAA//wAAf///gAA//wABP8A/wD/+ACu
/wQA//8A//oABf8A//8A//cAA/8A///+AP7/+QAA//4AAf8A/v8DAP8AAP3//gAA//wAAf///gAA
//wABP8A/wD/+ACu/wQA//8A//oABf8A//8A//cAA/8A///+AP7/+QAA//4AAf8A/v8DAP8AAP3/
/gAA//wAAf///gAA//wABP8A/wD/+ADY/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/
gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8AT4H/gf/+/wAA/v8AAPz/AAD2
/wAA9v8DAP8AAIH/8/8AAP7/AAD8/wAA9v8AAPb/AwD/AACB//P/AAD+/wAA/P8AAPb/AAD2/wMA
/wAAwv8AZ4H/gf/+/wQA/wD/APz/AgD/APn/AQAA+/8IAAD//wAA//8Agf/z/wQA/wD/APz/AgD/
APn/AQAA+/8IAAD//wAA//8Agf/z/wQA/wD/APz/AgD/APn/AQAA+/8IAAD//wAA//8Awv8AoYH/
jP/8AAD//gAQ//8AAP8AAP//AP8A/wD/AAD+/wMAAP///gAA//4AAP/+AAD//gAC//8Agf8A//wA
AP/+ABD//wAA/wAA//8A/wD/AP8AAP7/AwAA///+AAD//gAA//4AAP/+AAL//wCB/wD//AAA//4A
EP//AAD/AAD//wD/AP8A/wAA/v8DAAD///4AAP/+AAD//gAA//4AAv//AMH/AKWB/4z/EQD/AAD/
/wD/AP//AP8A/wD/AP7//gAB/wD+/xUAAP//AP8A/wAA//8A/wD/AP8A//8Agf8S/wD/AAD//wD/
AP//AP8A/wD/AP7//gAB/wD+/xUAAP//AP8A/wAA//8A/wD/AP8A//8Agf8S/wD/AAD//wD/AP//
AP8A/wD/AP7//gAB/wD+/xUAAP//AP8A/wAA//8A/wD/AP8A//8Awf8AfIH/jf8CAAD//gAC/wD/
/QAA//sAA///AP/9AAL//wD+//oAAP/5AAH/AIH/AgAA//4AAv8A//0AAP/7AAP//wD//QAC//8A
/v/6AAD/+QAB/wCB/wIAAP/+AAL/AP/9AAD/+wAD//8A//0AAv//AP7/+gAA//kAAf8Awf8AFoH/
gf/v/wAAgf/O/wAAgf/O/wAArP8AFoH/gf/w/wAAgf/O/wAAgf/O/wAAq/8ADIH/gf+B/4H/gf+x
/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/
AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8A
DIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAM
gf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wB5gf+l//0A/P/9APv//gD7
//4A7P8AAP7/AwD/AAD4/wAA/f/+AAL//wCd//0A/P/9APv//gD7//4A7P8AAP7/AwD/AAD4/wAA
/f/+AAL//wCd//0A/P/9APv//gD7//4A7P8AAP7/AwD/AAD4/wAA/f/+AAL//wDF/wEDgf+k/wAA
+/8AAPf/AgD/APv/BQD/AP//AP3/AwD//wD+/wAA/P8IAP8A//8A/wAA/v8BAAD+/wEAAP3/AQD/
/gD+/wcA//8AAP//AP3/AwD//wD+/wAAsv8AAPv/AAD3/wIA/wD7/wUA/wD//wD9/wMA//8A/v8A
APz/CAD/AP//AP8AAP7/AQAA/v8BAAD9/wEA//4A/v8HAP//AAD//wD9/wMA//8A/v8AALL/AAD7
/wAA9/8CAP8A+/8FAP8A//8A/f8DAP//AP7/AAD8/wgA/wD//wD/AAD+/wEAAP7/AQAA/f8BAP/+
AP7/BwD//wAA//8A/f8DAP//AP7/AADb/wD6gf+j/wAA/P8AAPf//gD7/w0AAP//AP8A/wAA/wAA
//4A+/8JAP8A//8A//8A//4ABf8A/wD/AP3/EQAA/wAA//8A/wAA/wD/AP8A//4AAv8A//4AsP8A
APz/AAD3//4A+/8NAAD//wD/AP8AAP8AAP/+APv/CQD/AP//AP//AP/+AAX/AP8A/wD9/xEAAP8A
AP//AP8AAP8A/wD/AP/+AAL/AP/+ALD/AAD8/wAA9//+APv/DQAA//8A/wD/AAD/AAD//gD7/wkA
/wD//wD//wD//gAF/wD/AP8A/f8RAAD/AAD//wD/AAD/AP8A/wD//gAC/wD//gDa/wEJgf+l/wMA
//8A/f8AAPf/AwD//wD8/wMA/wD//gAD/wD///4AAf8A+v8SAAD/AP8A//8A/wD/AAD//wD/APz/
GAD/AAD//wAA//8AAP8AAP//AP8A/wAA/wCx/wMA//8A/f8AAPf/AwD//wD8/wMA/wD//gAD/wD/
//4AAf8A+v8SAAD/AP8A//8A/wD/AAD//wD/APz/GAD/AAD//wAA//8AAP8AAP//AP8A/wAA/wCx
/wMA//8A/f8AAPf/AwD//wD8/wMA/wD//gAD/wD///4AAf8A+v8SAAD/AP8A//8A/wD/AAD//wD/
APz/GAD/AAD//wAA//8AAP8AAP//AP8A/wAA/wDZ/wEJgf+l//0AAf8A/v/9AAH/AP3//gAC//8A
/v8CAP//+wAD/wD///4A/v8DAP//AP7/DQD/AP//AP8A//8AAP///gD9/wAA+/8DAAD/AP7/AgAA
//4AAf///gCx//0AAf8A/v/9AAH/AP3//gAC//8A/v8CAP//+wAD/wD///4A/v8DAP//AP7/DQD/
AP//AP8A//8AAP///gD9/wAA+/8DAAD/AP7/AgAA//4AAf///gCx//0AAf8A/v/9AAH/AP3//gAC
//8A/v8CAP//+wAD/wD///4A/v8DAP//AP7/DQD/AP//AP8A//8AAP///gD9/wAA+/8DAAD/AP7/
AgAA//4AAf///gDZ/wA0gf+B/wEAAPj/AADd/wMA/wAAgf8BAAD4/wAA3f8DAP8AAIH/AQAA+P8A
AN3/AwD/AADN/wAhgf+B/wAA0f8BAACB/wH/ANH/AQAAgf8B/wDR/wEAAMz/AAyB/4H/gf+B/4H/
sf8ADIH/gf+B/4H/gf+x/wAggf+P/wAA5P/9AIH/7/8AAOT//QCB/+//AADk//0Arf8AqYH/j/8A
AP7/CAD/AAD/AAD///4AB/8A/wAA//8A/P8AAPv/AAD9/wcA/wD/AP//AP3/BQD/AAD/AIj/AAD+
/wgA/wAA/wAA///+AAf/AP8AAP//APz/AAD7/wAA/f8HAP8A/wD//wD9/wUA/wAA/wCI/wAA/v8I
AP8AAP8AAP///gAH/wD/AAD//wD8/wAA+/8AAP3/BwD/AP8A//8A/f8FAP8AAP8Axv8Ar4H/j/8B
AP/+ABP/AP//AP8A/wD/AP8A/wD//wD/AP3/AAD+/wUA/wD/AP/7AAX/AAD/AP/+AAP//wAAh/8B
AP/+ABP/AP//AP8A/wD/AP8A/wD//wD/AP3/AAD+/wUA/wD/AP/7AAX/AAD/AP/+AAP//wAAh/8B
AP/+ABP/AP//AP8A/wD/AP8A/wD//wD/AP3/AAD+/wUA/wD/AP/7AAX/AAD/AP/+AAP//wAAxf8A
soH/j/8GAP8A/wD///4ADf8A/wD/AP8A/wD//wAA/P8AAP7/DAD/AAD//wD/AP8A///9AAf/AP8A
//8AAIf/BgD/AP8A///+AA3/AP8A/wD/AP8A//8AAPz/AAD+/wwA/wAA//8A/wD/AP///QAH/wD/
AP//AACH/wYA/wD/AP///gAN/wD/AP8A/wD/AP//AAD8/wAA/v8MAP8AAP//AP8A/wD///0AB/8A
/wD//wAAxf8AhYH/j/8BAP/+AAD/+wAA//wACP8AAP//AAD/AP7//QAG//8AAP8A//QAAv//AIb/
AQD//gAA//sAAP/8AAj/AAD//wAA/wD+//0ABv//AAD/AP/0AAL//wCG/wEA//4AAP/7AAD//AAI
/wAA//8AAP8A/v/9AAb//wAA/wD/9AAC//8AxP8AIoH/gf/1/wAA5P8AAIH/7P8AAOT/AACB/+z/
AADk/wAAxP8AFoH/gf/Y/wAAgf/O/wAAgf/O/wAAw/8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B
/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/
sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x
/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/
AAyB/4H/gf+B/4H/sf8ADIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AAyB/4H/gf+B/4H/sf8A
DIH/gf+B/4H/gf+x/wAMgf+B/4H/gf+B/7H/AP9vbAAAAAAAAAAAAAAAAAAAAAD+/wAAAwoBAAAA
AAAAAAAAAAAAAAAAAAABAAAAAtXN1ZwuGxCTlwgAKyz5rjAAAACkAwAAEAAAAAEAAACIAAAAAwAA
AJAAAAAPAAAAqAAAAAQAAADMAAAABgAAANQAAAAHAAAA3AAAAAgAAADkAAAACQAAAOwAAAAKAAAA
9AAAABcAAAD8AAAACwAAAAQBAAAQAAAADAEAABMAAAAUAQAAFgAAABwBAAANAAAAJAEAAAwAAABC
AwAAAgAAABAnAAAeAAAADwAAAE9uLXNjcmVlbiBTaG93AFAeAAAAGgAAAFVuaXZlcnNpdHkgb2Yg
RWFzdCBBbmdsaWEAAHQDAAAA3P8AAAMAAAAjAAAAAwAAAA4AAAADAAAAAAAAAAMAAAAAAAAAAwAA
AAAAAAADAAAAJAUKAAsAAAAAAAAACwAAAAAAAAALAAAAAAAAAAsAAAAAAAAAHhAAABEAAAAGAAAA
VGltZXMABwAAAFN5bWJvbAATAAAAQmxhbmsgUHJlc2VudGF0aW9uAGQAAABJbnRlcnByZXRhdGlv
biBvZiBtb2RlbCByZXN1bHRzIHRoYXQgc2hvdyBjaGFuZ2VzIGluICB0aGUgZWZmZWN0aXZlIGNs
aW1hdGUgc2Vuc2l0aXZpdHkgd2l0aCB0aW1lLiAAIAAAAERlZmluaXRpb24gZhCOxqk4H5fjetyJ
HivwKt7HF6Z1VG2DPXAgjsIpOA+X4TrcgQfwFF7Be/jctI6qrbE7DsACnIyFuBTX4nbcjyfxMlbi
M9M6qrbCbtgfR+IknItLcA1uw314Ai/hXawyraPqRzqaPd46mj3+czpalsz72bcd5b6JL7697y3n
Uv/Affl/U5mPFq7Y5aZevh38kzlffz3nV98U/mZO118tKFz41Tdzuv56TtGvC/WWwm+WdM0d2+s7
/9/qD+7H8Zz9n24TrnP/7EbldHE3XCL5X+4HPhvXuGTLKF3rmtbqg9VHruqNa6xjydvojWv6Rm+r
09vqMmO+jvV1rvEbVxu50reuaZ3+WMcqG7voWPfWNdaxpCbS297q4UlHrqLe/UjHVH2UrIy/u8rM
DamWUZSuf8cXb10yP4rqXLIkqrdlSaTPm8yJIltGUekblxVFFc59Ue+Sqaiu1mV1iSptmRNV6VK/
61Gsj99SaY1LRWnnmte7RH592qXy621Rkk7HT2qLqEoXOVGpa5GlLzaq0JV+d811lYpKq/VZK12z
VHxkXuvrq7K5TucuzGmdWzJX6pxirtA5UeWaxnPpK6djk6SOL12iODNl69QvM2Xp9KMfOkX6qfd2
ibcZUkaO0dLookdb315Xfb/5NvZLx+cwMw7SUU9HMx2H1bhEgnmEzinmfJ1bHHnXUuDLXpl6AVRD
k3HceuzOonfI9JZK/gEAAAAAAAAAAAAAUwIAAEoAAACUTXMAGFcOAFEBAAAA/nicjU89SwNBEH13
kRhFIdorY2GjojGVWgUEYwRRtLVZ7vZyi5s9uduL2gk2FhGs/Kr0N1gL/gFb/4Glpa3n3EXSic7w
lpl5w7y3zhfy2HL3MeFmY8i4dxt95OHuTt4WxSN8BK3mXg0OdwfclZqxOAqXV/GPcBkVhvM89fT6
5/YDegWmWWt04GK44GpYwaFzUf1AnWvPuap+MlPh7DNn1XeQc4akqGbQ4PcR1yjntp38H/eoZG9s
Z7ZQusUCRlAqN6WRXQGUOMdxhEUMARkwf/6ys6HaaSypvkYtrdPExsKqyFAUUBgdkxcK01amTVoY
fynypDAUSmEp0OkJeVGqfYplkmpLypANJaveMW5+8TX542uut21VR1JXxKf5eRkE0rOqK8nTqiOs
pESaRPFEnVIQpcbP7wvSES9vCn99u84DK9t9u4sY6D7gskD2DfV3cJIwVBzwIA8AAJoHFCjrJHhW
ZGQJ1A7+az7x9Ss37TWUbVzVEGM3I7wEfEsAAAAAAAAAAAAAnAEAAN0AAAAQ108ArNMqAN4OAAAA
/nic7VxdjCRVFT7V1d01P91TC5KIm7A1LA8O+MMwEtxNjLW+uCEsRtFIND6wyiIqP+sGFRNDdUwM
iVmCCYki2YflDaIJoImJD5p68MEHEjUa/EVLRUWRULi7M9XT1XX9zrm3/rp7fnZ39jcz29XnfHeq
btU959xzzzm3Zm/7GvHPy9YxuqKhOqQyosY+ffBP+9VOJMzTdDfdc+v+OxbJAvoUkL3/yMHD9960
SJv4aeCYwmH95JoffnHDs4/TUTl24V4zxVM46GGK5ulj1t7WM9Ze5jqd1jOdDu2mu2Z/s4eYWnv3
8LN+m9r8mBbzT9GU+hvATun5SXonTZPd3n/ogUNfPkhk41+XPkzvpiaRInrHq1+3bsZ538XxHdpt
Pad7tp7bRM8L1q/oVes95dWNTF/dyDZztT2Pq5fKq5u366ubt2/m6uaDuPqm8urWMX1169hmrm79
FFcvFlebs6254uyXcOWd5myjFfnp0mFcfY+6cfaDDx75zOce+Oz8wp331/T2JF0pJvAcfcvQo/Yr
tK/9BL1IVuMNGv9M9YmCVA1papXIHRjGZ6a9SquMB3icnLFzxskZd4zxDNPwVJSQMyDLz1Y0TQ1N
NA1iQ6MRGm6O+qPUXO/l1PTv5tTc1zHPYedUrcgDW6qHB14lS4Wa+rGmXpqwXBqOivoTJMVMMDgb
WZVC89cSWrBFQhsTXjQivHhEeOa+rnkOJ9us0LKq0DBGPx/sljITzXrk04arXTwhxD9BTsYmeJKm
MhZ375RhklM0nZHtKxUu51y6TDN8UaYI4srZzLBDRVAWsw5YDHdmaFoxYLB2qvo0k+q2eJWmUmlb
pRnWONqSgbBWqqiX0syqaU15WqItHNIM5qeLthTzMSGZqIm0gFmB1WWGcYRZ5nGAcU5BHaZBmPYy
5We6zLRXiLuYSeRK7p3ZICvuya1ZKiy3RvrpbG4dCMtyiAba0IdmSNxmhmkNzdA9btPiQJsWEbcl
CbdhZD0tQZfbShH3VioqKNWiNRWf0jpUuQ6jQnW94uxkudpZzsKopzIRoG6zjA7NUxkd2lqHojoW
j2ZZyaEeKcsk0Sy39gZs6azkgXYPQ6WlxN3HWoxeKVHpXovc19JnpTpjSnWzqg6ZcZT5lZWf42XG
JuyhYXxh+mJqWpm+NiB+IMeYFXssbWoyBm2AUGYqRskadNlQwaRap0Np6WuhpVo8mbbXLBmdDtVJ
oqfO2spMTpUTMZ+ZZqKaabuZGY7PNCKf5kmydgjXBrconAPuMM3Y4HALK6ZZZkMWq+Ej8LbhYTYN
1/B42oZn+IznVkwdhC62gkE1VERdAHF7Nr6pg4dX8H22o3oCAti47SLQYeBDSraPAXUxWFf1+ugG
yprLWKkQcBPfGtoqBcTiCQj3BpseUBMC0zBQsCe2g0wgy5Qbs4x2DPluKslysmMoM7YRybyNMjFt
K4E+MtFw0Gf7SGXxEftIZa2iWLwrmN5QT+tUW64xFNx/SpuPtnF2FWz3fR4XJsUm1XVhPzN6+aBe
VrCZYfsssYJNShbKm2Y2UVbJ9QouLLio4GKag5dwVWhDu5COQJ/dCg5ojmEQsQyhBQ1hPLCjHiY/
zWGZtaCjFpRva2hngH6EMwQ6UFsLJkoaugmgW0JosuWwY+/NSVgEaKdj0Bfowy20rBHI8zCsQS/s
chABb9GsI7V1aE7CFL7hhlA/XSBDKaAvMCuGImIoYWKgEQOL0C2lwgL20lyEHosfysK93IFM3Azq
wFQWPOvyLGXdoj/GjmLPCexpbGPewnlHFto7vNIPVDNkgIkDtmehq86qhOBN9h7UXRVH2mJfEgnC
WtJK2M0IwiLRisU+unp5aYX8bNTt07TPToFYhYzgImAIFhtXwmvlpidmLSVwzijQHY94K0lBrONb
T63U49xkk8nBVse7m00WNh33mmTBvfBxb/Uzi3XBS/S155Pf7ONBcjYWJl5emHeZTzXvM88zaJXV
yVMDK1NHRM8AvqArChEUaWRrFGvkaJRMQq5GcAMdM//lSwBOQcJjAPoS/9sxLkZ8cw3Mip2x86jz
HbFD9iJwHx3j6/B1nkHtCXIw+pyTR9YxfhTmP0k0NQBJWq4BLk5HCptLusdhkUaOw74z14JjG8+Z
I/g7xWhGe02Ol6fYZxbRayrxibimVDtUnShp1jHBrYnBI0mpOBgd0HSfQzSFMHdtx3hBHVCyvgOy
2HGy8Rv/E0TG/xR+J7wI/E4u21LahQLAcCZlUkqTIdV1JmlFWtduqXFtBWwnem01cx6IQ5Ic8bLM
a/NkDyCWmBgjlTlvHIAr5ptu6ACqk2Fjb7D2/Lt0PUBVHDVB1URYCLcu9zGd1PU1ostSzxs6AWM6
IwZlzKwwvdPyBqOmzelcdHJDKmlfxONFtrcNLm7AVSF/hR3dVjNrmdE6OwC8X7AwcQfgQ7Rg/4Gu
bbxriUYq/3NyxkfoXkMP2k/Q1fYr9FWyGido5NNGUphKnCZpYM5zEMR8RwobSoNuCzNJ8cTNkatU
WCIP87KG4hL5sZ9UUOimJQp6dlZBJDO+QJSjaaJH+OQCSU5aIC5fRFXk1pAT11BSRXYNcd7EqAGS
cbpdRaqG8DAGZVzMCnP0CIe9URUhFzcoYJTk9/N7kvPnKJSikkEInDmMZWQzyrgGZJCbSKnMIIeR
lyM7kcqSQVaiS0miWNoz1HGX09eOedwiqh+JTnqDS5YWA1lvjvEu27Nr7bI1rspedq+fnz/4wN3z
Dx26//D8wm3XT9pps+/QO22gR+kDtM9ee6dtJMXWtbJq/ayoqZV1tkr1razIlVW6Su2urOeVNb6x
+t9YhXCkgjihvlitPo7UJuuVy3pZs1bxHKuFFlXSkQJqtbZaLbqOFWOrRdpq8dYUdSu13rIAXC8K
60LxOirCqcgchNiaOJq4mnhDKW/PS8Fd2EUutGl2T6JTQLDv65tgEPz7+zp6Yt7v6+RIJNVb1ZUm
vSJxLJ+DmAP8zIBkVbvoLoNUUt7EoExS3tggJcEVHPucOAiEgJwVaAgmlUY5l1XIASJsoCv6TTgo
hL3xqXIz/sYvh9w8lJtoFPDShpukYicerw+6b4aSU+s7d+W02DxWV7pI2CIyjdC9rDwD6qTUlgoW
R2MMAsUrT6yBxzVRFWmA/rHShAOaTanF9seBG/NsfUGmea6zsb3OsAVnltIbNs1A2Wy2zPrqURVp
1lW/UGZzhyckNCKlrUz1uZgL+1SZbP1iRiSawUzRjG92hU3mJVuemAick/HjMLUwF9oIOVNNHtYE
FnP+w461PtvbJ9vbJ2eR1OeVlrBMveJaVWbdXL5S5amXf3ShiLe88zSxVjaqlJSK4p0/qQ5Vy0/r
ufvERF42JCJxT+vmzucwYZe0vJfKolKk6MF4kdGr8nDHlA9ZxpKn5DJKIyYnqQIWk2MqIZzOy7md
gZaDSKQotfK2C0A7iEkXYWdXqeXJ7r1Ualu8H8LLhVSLVjB3t5w5XZPdfsFpsP2C02X/glMts7Ak
kOlzeBNakZ6YFm9EJpp3mM9kOwVRFW9Q6u2Uti8glGmdKTvMN1P4bRNG2h/zcjiOCu+c+KEOUoEQ
ECG39QvEmS57ZEZeysjJUcLINgiRgs/7mlVEOYpqKMzRHBajQCP2npNg7/xCVX8MhvVHLpFVG1wd
2QZ5cQ0lVfG5aVW0bsbIK/ZZqKIER1RSqbn6oZ0j6M0PZQ/GGIBUXPP12tRc/bLm6lU3XrKy0FrZ
eInLd8hM1dXLq652UXX1Nqy68gttvJRx5rXOPttEPjBLe1hZZLcGqHVBV0A1hGBUhhoMnCrwqoCT
LQ443b6iCptOZJOSjUs2Kln0OKXZVLet6p0yw+KRJy43Z0EveKw6wTcim7GW2bVuNaNDn1AyZQmJ
5MVH7WEDeUMk37DumQ3renw10OGYbKkUAZqbVEI3J50Qx9UiPC80YN0J0RvhzeQ4B9tM6+85CYiq
02Zsn2kT2861CF+ZjfsyLcj3nR0uUFeWKE7USg94ljvNdvHG7hnsM28Qr26/fXPpv31TqSAGWodW
rkyvptXTSEfYVBGhy8IwkH5Iu5E2krGg53I1T0cMQU+iOxNNIBIJwmps4UXVKMQ1Cbcv8YtjEEcz
EdlJDZloIpDdF6uGKCtRPIqCArl1lIwi34R0BuWxFBdR1oR48BGo3wKcDEPZ1wlKaFUgD0v1ihjO
i+UVvDyG40fiHeki3iIV55EZFyiC1K0ipbLc20DsBbI0SkvkCTLLBpehTGAekSM+SkJ2iF8CMwYO
P2aeifPLflzJdZZ5AqUXfsW9CD/bWy8X8dZLuV93nB6Tv0ucbz1v7W093+nQPB2w9tIB+RvEAzNX
0h7a3XpY6OS/t/u82dvjvzhcaC9Mf7+5dMviYnkH9OL8QPcidP1e0INzoLl080gPrY/qHoRu2EPz
9ebS0kgPjRO6B6Eb9tB4rIkOFsf2NStXvATwlWLsh3HVi+0bm584dPDIuHSP499OpWTf06Ed+Le7
9QXrzl3/oet2/Yyu874H+iPQb4I+Zdr4dy/iuAb8v0BfAh2AJjj+aPg3cMTgO6Cvgy6DvonjreB/
CboL9NegNo63gf8H6O9wvAX8CuifQd8O+nscFvhrdNuu18BfC/oCKPra9V4cfwd/NegJHH8y1+N+
3s9Bb8CxA3zT3L8LvgWagf4F9N/6Oq8BOmWuOwm6GzQ1bRiv90/z7Kug3N4H/18zTozB4+f4MWgb
9AocO831hOOv4F8z47gK9H+Q+dOjGghb+yzI/hvWrTb6LI54DX4EN+ONz5nIr3f+hGuap/FMZ3TP
6phyDH3Cp5yzo3kO+74Q97mMxqTnyfHLcmzbY9q+z5nca+KcuEzGdkneZ3tMF/w+pzUntmV4adxr
e0xndRRz4nIb27ZdjOi4kkfulp/8f29qHWt4dBeO6nk7zVvOjnwvNp5t32D3Zx+lpcbT7d1Na/Zx
c7X+zZuzAc3bb7aXhLu28QK+82xV1wvmbbv9cdt2blmjEvFbU4nI77tg3+R8cmre/AdGZUUir0LM
24+jv8fX6q/RHunvhqNX7r/vwU8fvE9e0z505OBDXzpyaKTO8Rip/wOeQr04MFQc8MMVAABkQkOn
FEScZ50BrH/tmMeV0JuhmfBkvO/8WX99LDFJbeRGAAAAAAAAAAAAAC8BAADuAAAApLc6AAgfLgCB
FQAAAP54nOycC3wV1Z3Hz5kzM2fIg4siFVnojTaFVC0ElTVQ9GJhBXxAlkqLSF1QiGBtzFJfoPXG
VsWKsrhrK1Bb7QeqfrCC+tGN4ut2rda2FnyssoripfVRtYWrCEySyZ39/f9n7isJEFoWty0hyfx+
M3POnDnnfP/nnMlcTn1b0NdWOUwcYoUVIswKYY0xP/Slm3pdweInYrZomDh+Sq2QcDPg1Pj5s5rm
Dh8uevBl4cfDj3xi0EOD9nr2neIm/vksrlWWL4VGDp6oEmfIRrdWNpLyVrm13ipxlJjpXVQnaCsb
66isPxAuFVOSXiG88HcwAzjnZeJY0Usod/ycxjmXzRJC4V+lqBdDhS1EKESN+I4cJEfgzOX4uU0c
Ja8zecvrepB3jbwbqU8opLZWm9TW6p6ktp5H6uMLqdV6k1qt70lqlUHq4wqp7e0mtb29J6mdfkg9
vJDa7W9Su/17ktodhdS1+dTR2bJ3/uxX0QmeiM6OWpW/KkUTSj47e0j/KXMumHdx46yLqi6Z882m
qvPnzmq8YE5VzelfECW9YJk4lLRzpVgabW8SV4kbnF3yMCGtbWLP316rsGKh3ybK2pBfNhSZduFB
JjvCdlHWjn0B9gUsE5DZQHjtoi0UzR2iLMBhyIyRccigQ3iQydYQ+zpQUD8UqazoA6myoZWm3yLN
O1QsDP1sbtO7Q1iJMAyElQyzxiZDXNfSYWhsGDa3CzsMU0L0zgpLhUGbsONh2lgdZmDxGxWYpVtq
bhUq9IWoyAqZyPpCJbLGJH2fLmpMmIHRYbOoRGeXYQoOv0UFnAqbd+GqaVGuqGZ2onwZowPoeKR9
6Fik09Aq0ilomRFlpJt3CMheQF5/ImQTKxeqlpUN1WdPTYRThezgjTIbbTYxs4mjqnFvVbjZhJG1
PjUgyzpItEU55OhWIWWkT4ZWkU5Ax6C5pprbhIznTBomkTOoX5nMRgYdRoZo7EoyQTvuNfQjl22n
xslEDr0IbZPu4EaKh80BtU3KWIiAd/K51IQBLoE+UMnt68OF6G90Kl+MfuNgB+3u4IsYl0QR6SIB
9xPkl8ubLETuypV8WiYqViVn4VOPyBqH7KlL4HYqAuFS4MddGZNEf0FSY5CZiIVpY5C/iIepdlEe
CIf6XyJsY029L5k1GpkK6q9l1IOzknmDTIaKui3JRLgoTBsZCzeEqTYDH2hBi4A4AqdV9Gqn/hlm
W4lREOEbAVKMSIRpI1AqIzSBoNuotX3eSrDgtgoRmM0VZoMe41FX2IWq3O9ir0Go03eBilJSDD1F
SBWT1oXAYjKLiY1ILkG8E/3FgaFLyMgHk9I40ykIdQ5RnQJY1/BWFPy6BMcu4bMotBbCbSEEFwXm
QrAuBPCisF4I9UXhPzck7Gu7HfhvKqpkWFoJoZREDChvI96gfaM1adx1RRuRC03xhkyCDWIRzsqG
ChphqhJ1I43LGKe6cz47rUM/kTKBEA7QJVKo5JwTcLGscfGAnM45n5yKHHojHIXmghM5ly5xqZzr
jXZKGpdEvOvONh9YG5YWg2xpkQtOltxcqVORi2dKnF9cfbGguGpjWXLxINckoqgRNDdJrrkQbRMp
lXNot0QqRg0bdYCQOgCBkAQcKSMJGfQX4iQegFDaF+swGLXRgBwK30jZYSZKiKZJgIThB71TxLOA
qxdihAppLNE+Da89RouhJX6zeZmNZCuFg7z0CxKRqRdJP5QF1ZxXqbxK51VG9AZC6L6oIIxsPttE
QHePlgvYJtMUIKgW2CIyouEwDnKj87zCCalLs6We7aA9ZchWozUcNKgwNoYGcGIFixZwNE1ZmsnG
0QiOCrrYBNsE2sWRnSwNNKkSG0+hhWUSg75d6sL95+iCSb7gXq0pXZJvJW8TbLP5W+FqKFg/slE1
UBXGCrVCFRwPclVIMzYnQfMlEWvnUSmL5sA4xb48RkMQtS3yI6/RpmjnDHone8WRMEzTNKWCAmB7
aFNYo34N2Yx4RxGTuLBpaBSVREZH6NBAmWYHJhyfxlB2Gi7D/aPSkOEQ5hgyMYVJhDyzCoxDdEZH
kNS5fJqX9RgNggvlMWjq9kgkciLJgu6lLRIqJ3QXEcuJeCQwX8T4r7lmd/E2kY22fuk2mYm26d1s
U/u2TeS26dJtPLeNrhfLbaNy6MBsVVROhXJ7PC9vNvM+mt3QNpEx2zgmgGamSFNGE1w69r/o+Vhe
tL5JmjaUucaMl7Sq2yba9t643KYUE2PtCJpGIh8B6NDFXfT8ZHOM1hpmrEk287wgGocwhhG7hVEp
ni4ev2KZyPHIpyNH4yBmaH6Ji8ahJC6OcFjiRLbgMp1dMu9ipc7v7BLRZCByuVGYpni7tSh4J2vi
UPeWhuHCcJ8wKOcs3RY4z43+8QwHgdzoT0WiuJIfqUWYyY3pWLGB4FixC8NsbqRGteedNC4ouDg7
msVhXKJJcjSlSwsKKMagZIqHdDKaikktzNNDVD6tM/VOAig4GHI+jZCDBZ3cSfe+v0UPW7OcFsVY
QNGkjXSMdGB0gnTIawZUE41yZs0gQzYmNFiRM6EBqz12JhhgXcfO787FjAs4EvFQzr/Y4BSpcwZ5
8VSqIpot8DSrxJRz+wXmGU+RruD2pQkBQKyIpi0yeaBNSQlypnM5u7+zimhKxI+pulZNiUFNylhk
KJ7IaPpvJkIyGRRCTL4VEGLMJCjnKGqRKzMTIBooPJr+5FYCycJKIFG8EgiM1KUrgbSZ/idy03+d
n/7vwxznwHznClUoZr7kubtJFe4xU3LnJbVRqKGo1go1WVrF0dKZqt/vpmmKmi0PSKK7ti7pBSWd
pdTk+lRlNAm3unbKAwUMd/7mgAfxPAjJriDHizU6k8jdMt9Lrq/zXUbVpP1iQ9VEeyqi1RifS0Yy
H+micEYzHR5JM8IEOhoiMT/C2s48QaHlAz155UndLoz9+13sa5ctGYljJSPxPswOdzcOp/3S8Tfo
4fi7r+Nt6s8cb4N9HG919FS4U031dM6y+7oqVFpid5WW3E+VttfJSqZT5UXXjUXl0D2epGSLK+3/
wbrIOviY8+Bjzr/Jx5x6hxnKaMm/h7lstzoZDe2pokF2/5hwj6ay3TxltIoOFU81yOhiEy82tKCl
v93EWs0ziUgG3Uq/IDMFmS5I5OgZGZh9bWY2GkkUudvh5i/Yfupz1e7D46e9lLQOPr06+PTq4NOr
v6enV5/2xHAPi3aIwpJdFZbsRU8o4mZo3+Pq3XRW6v7RhBGO/pYW5pfzGf6jUvfPu3gBH60/Y/yE
K1qZxngBH3T3GKfkcVe3C/jdPvv6VNby/8fPu4qro6SiSqowX7ml9d6lTUrbq1NbFtp5r4+84oVZ
YVGHirpZvuv95c++yrNC0XSYmDiQ+s+Yfxz8K/3Bv9If/Ct91+nGwWcWB59Z/I08syha3kVvXSfy
iz1+jBGaLS/9AxqvA8N7ZcAvfkZvKSMtXS3DbzRHHvP/gN8djTyRx28sG08ldhDGE7yc6BBMqeA1
Ay1IiNrcSoG8YqZjfMnexts+JQ7oMED26Q8vSXq5mjy9vRwGKEsm59FjAuKS37v2KMt4Ftm1s6VY
prNxekWarU/UJei96JyVYZJehq7Mcjdh22beBKebxq1FLs3OL3JJenm2yKUil2LX3GZevuU/WGRb
CyYRFBu/2GSKTbrYpP6KzIF/L1vkP7Vyp7iZP3dU5dbJRrfOWyWqxDjZKMbxZ4zG6bdFnTjKFbzt
/vMwp0SfcKFPFNW49+u71fFDC5+KQR7ucyYP3u45D6R3F6vjho4oTu/cZ9Lzdq/pnSakL7m+fYtJ
z9u9prfPUsNLr68uM+l5u9f0aiTSl1zfmm7S83av6a1Bqrbo+l3PfxVEjsvXeZOo0WfJXw0af9HF
50WfI5ozf9Yll86fU/xxos6tPaC5fxgiSy1s/Kt31sirnfXyx1Dr5CrndfkLqFOsMmeWdbSotzdZ
K+x2ax3UdHW4vVCdKOrVC2qzymDSVK8m2IvVXPteqDI7o452+oh6q83ppwY4I6BedBqtj5wlUK87
o7F/BtR/OQ3W75zroX7orLUeczZArXVarA3ORqivOs9YlznvQM1ylXWN+zmomW651ewew6oGagLU
cHes9c/u+VDnubXWd9x6qM+5k62x7sVQh7szrRPdZlEv29wF1gB3OfYd7U6xTnPnQ1nuSuso92mo
w9wm6wR3Kc5rdR+3jnDfgNritljSpbIc4S6xRrpr+LzHcN4mHN3qhlZvHYf6k/uWVemGUB+6W61y
3RvqR3qIfEKPh/qj+45VoR2oF7Avw/ve1INlhz4V6h13h+XoflAZPczqoydDPaqnyNc0yic36iPk
Lj0S6rv6DrlSPwX1oF4gX9K4D7lOD5Sv69FQT+gzkOdFUNt1tdVXj4Nao0fJ9Xo61F36cvmsvg3q
23oRSnY3l28ZUj0C9Q29Uy72PgP1fb1WPqzRCvJJfavcrB+CeljfLF/R90HdqO+Sq/WzUMv0LfIR
/QDUY/oGuUnfA7VJ3yTb9c+g7tBPy6f076Ea9Afyeq8M6hJPyFu9KqjzdYf8rjcIap7eJr/nxeg8
HL2ejzZ6/eQSD/1F3qI3yQd0O9RCvUWu8CTU1foV+WOMvfXySt0qf+gdATXBGyzneqdyziFypva4
yvPk7V4NVJPXRy71avkaA3ENqqup3mh5qYf+J0/0psuveQuhTvamynO9S6kE2kcJ+kPVeE3InXrE
FK9BzvfQT+V4b6K8wJsHlfQGyTu8kzi/auRHNX4j1GpWJ3nT5Ne9K6C+4F0lJ3q3c9qFSLsCaoZ3
Nsq4AOp0XOMbuEaeRyGXLz8Tded8IK92y5jEe0Hib5jEOSDxOiaxw1rhDGISW0DiRiLRHqM22zOZ
xNUg8ddM4hyQeB2RqGaCxGYiUUmnUR1JJKpjnNHqdCJRxZwGNYxJfAkkfswkPgsS32US25xnQDGR
+ABIfJFJvB0kPs4k/itIvIVJXAQS72YSzwGJVzKJi0Di3UziLJB4DZFonQkSv8kkNoHEpUxiHUic
xiReABIXMYlZkPhZIhGMt4BxKstokDiDSfwiSDyTSXzSDdFb48zzW+CZSHzF3Sp3MIkbQN02os7q
CxKPZxI3Y1+WSbwLJD7LJL7p7gCT/bgHD0MPnsx9b4pcwSSuB4lbmcQFIHE5kzgJJDYyiY+BxE1M
4rdA4n8wiT/S1SBsHHM6CpwSiReCxBuZxFtB4kNM4sUg8d+YRA0ShzCJ40DibCZxAkicyyROAYnz
mcSxIPF8JvFrIPFyJvFUkNjAJA4BieOZxDqQOI1JrAOJ04hE8SewVkmsia0gsTeTqEHiECbxaBw9
jY9+DBIPZRJrQOIEJvFQkHgckzgJJDYyif1A4ggm0QaJ1UzikSDxFCbRA4k1RKJ4HyT2IhLFdpDY
l0gUL+P3diJRbPSmi11EovitNxVlJBK/CBLPJBLF416TeINIFCu8BrGOSBTPeRPFH4hE8RruoZVI
RF7VyBk1Lp70qsVmVilvmkgTieIB7yrxIpEobsCV7iESxU+9s8UzRKJYg2usLyZxjHzqGoyN9WDv
audDJvEJkPgmk7gcJD5KJDpfAonnEImOow53Ps8k3gMSnyMS7S/bi+3ziES7ys7YY4hE23P62TVM
4u+dRlsxidud0XZfJvF9p8HuRSSql5212I8+oJ5zWtQfiET1AkjMEInqQVepl4hEtcotV78gEtV9
bo36LZGolrlj1SNEorrDrVVPEYnqRneyWk0kqsXuTHUvkajmuQvU94hENd+dov6dSFSz3ZXqWiJR
gUTFJKp/cR9XSSJRfcVtUd8iEtUV7hJcBySqC93HkDtIVGe5obqESFST3LdUI5GIfVuxDySqYXqI
mkzUqXPcd9SVRKL6Evadw/vG6MFqJpGopro71KVEopqgh6m5RKIaqqeoSUQizjsC542kSKbvUEcS
iWqAXqBGEYlqrB6ozicS1fH6DPUVIlGN1tVqBpGoTtCj1FlEohqiL1fjiUSoRVAgUQ3Wy9SpRKK1
S+9UhxOJqq9ei5yoFQbqW5HTQ3y1m3G1+yhu6rtwVyAR5bhFnUIkqmP0Dep0IlGN1Deps4lE1Uc/
rWqJRMvXH6j+RKK1zcOKkFiz3tcdqheRaL2ttymbSLQ2e8LK8tEtXj8liUTrPb1JaSIRd75FHUkk
KqFfUVVEotWuW9U/EInWW95gKyQSrTd0aAVEorXd81RfItHKeH1UHyLReskbaH1MJFrveqOVSyRa
L3vTcS5ItH7pTbXeIxKtDu2rQUSi9Z9ek/UqkWj9j9dg+R6PGN5E5DKPcxmEXE6iO/KqcUeocWsn
1GdYbfGm4T6uoLmgd5X1EZGIu1yIu1xBs0LvbKuNSLQ24Brbiklc2mvkyncbRL3bB2NiLZP4iVzl
HsYkbgSJu5jENSBxPZN4HUj8KZHoHKs2O2cwiaG92Ikzib8Eie8xiQ+CxJeIRPt6kHgXkWj/DCQ+
TyTaS0Hi/USi3eCsxRnoA/bXnRb720SiPdt5xr6WSLTrXGVPIxLt0W65PYNItAe6NXAg0R7gjrVH
EYl2lVtrjyEScXQyjoJEu5870x5BJOLoAhxFD7aPdafYZzCJGXel3YdIRC5NyIVIfNd93HaZxE/c
FvswJvEjd4l9CJP4K5D4PpO4FiRuYBJ/AxI/ZBJTIDHNJD4K6l5j6lpA4kYm8fvY9zDvWwES1zGJ
LSBxI5N4DUj8CZO4GCTeyySuBIlPM4mzQeK1TOJlIPEHTOL9IPEFJnEJSFzDJN4GEluYxBUgcR2T
2AgSlzCJs0HitUziaSDxQiJRfR4k/hOTOAEkzmUSJ4PEi5nE6SBxIZN4Dki8kkk8FyRezSR+FSRe
xiSeDBLPZRJrQWI9kaiOBomnEYkqDhITxBqOdqh6IhGkb1MziERVjaPj+OghIHE4kajqQOI0JnEo
SJzEJA4FiZOIRMSMVnU8kajKvcHqGCIRUSFUpxOJCmOi4jFR9QaJQ4lEEDJQ/SOTmAGJfZjEd73p
oGkhszsV7IJE1Q8kjmASP/SakDuR+N8g8RMm0fcmIrbMo/gAEo8kEhFNqnEH4zjeVCPelJL4PEj8
I5P4c5C4hUl8AyQGTOJ6kLi1iMQ78W/AUfyV+x9J3P72r8VM/NyJVWlhFmu+NP+uFS/Kn6tK+87/
HYMRw0nGncyiLCuguiEyrCwzGBSYWRlPglmKDDeBJFq/lJGNSY/Ri6kISy/4DpBzENoLhtnLy5DA
oMHoCSzBFPwUfBLzUhQQ4xzwFjZjO9DM0zjN3INmplYjh0Iw1DC4WbA2AhMHkx6TD06zLmIxy0/B
Pzk1MQ9hFqyUY+oEmnUWp1l3MMziBLoLbJYC+mhOL8N/ACRfh4AwVBzwfA8AAFFhNZUfBv3/PPbB
/P+GcogO37DTiuAwOjzjlnLUILnxlkwAAAAAAAAAAAAAwgEAAOkAAAA4NFcA/CYtADoPAAAA/nic
7VxdjBxHEe7Z2d3ZW+/uOAaJYCk3h4PEhT9djgT8gBgLJAIEoWAeIiRejthgUH4cy4HwktkHBAg5
ElJECBEP5o0/QaQIKS9Io+AHRB5iRSExAsEIlD+iJGNs383uzk7zVXXP3/7cre2LfUbr27mqb3am
p7uqurqqes6ff1TQv9eMp8V1FdkSMhGickAfoeE399un+Yqfi0Pia5+97eCKMIC+AlT7/Np37nvg
+K1ihn8VHA0cxh9ueHLrq0+KE3ws4lnNrBer5vWVp5q77V9M6It527G1o0duXpne5l3iTuOTxoVL
7gt6kj3fwv0NsWTebZ5tnDbPEtd5vnG687zYZz7Y+dl+QdQ8u5+k9qioUycN4h8XDfkvgL3c7mPi
g2JBmPXbDt97+FtrQpj4aYs7xIdFVQgpxO561ArpEMvm4+ZJ4xbc81McPxH7qs+op1SfmeEpy9U3
cPdH8rvri+ru+uIsd9cP4O7V/G7rfnW3df8sd1uP4O6b87sbp9TdjVOz3N14GXevZHfrq41OdvUL
uPNOfTU0lGmtLY7i7u8Zr+z69H3H7vrGvV9fWr7znpIOHxN72DB/J36k6QmrWokWnjS/K4zKW2L8
0+gJ4cVyKBp9IeyBZlxi6n3RJzxAd1LGTBkrZewxxtFMxZFBJKyBMNxkQ9FY00hRL9Q0GKH+bNQd
pfp+J6W6fTul+rmW7oeZUrnBHTZkFx3uC0P6irqhok4ckVwqlgx6EyRFjDe4HFnlQnOnCc3bJqGN
CS8YEV44Ijz9XFv3w0pmFVpSFBrG6KaD3VZmolmPfOpYAFbOMXHPCSshEzwvGgmJu3tBM9EFsZAI
05XSX0+5eF006aZECogrZRPNDqWAsoi1wGK4zaE+iwGDNWPZE81YnQv7ohHzub5oksZxLhowa8RS
dGPR7OuzMU1LnPOHoon5aeNcjPkYCZ6oEZ8BswGrSzRjMbNO4wBjXYA69Alm6usivdImpr4hqIlm
xHdS68R6SfZMOpvEzNLZQPXOpLMDZkkOwUAZ+lAPic7pYRpDPXSHzilx4JwSEZ2LIjqHkXWVBG06
l4u4u1FQQa4WpanwgtKhTHUYZKrrZldH68XGUhZG3UhYgOqcoXWoe6V1aCodsupIPIolJftqpCST
SLF0tjsgSyclD5R7GEolJWo+VGJ0coly80rkrpI+KdUaU6qdFHVIjCX1V0Z6jZNomzCHmnGZ6bGp
KWW6yoCoQ5Y2K/JYytR4DMoAocyYjZI0aJOhgomVTod8pqeEFivxJMpek2h0OhQniZo605UZXcgn
Yjoz9UTV03aWGY7PAmKg6nlh7GauDm6FOQvcUSyS4PAIIxS7iPVJrJoPwJuah9lUbM2jtxVH8wnN
rVC0EMaYEgZVkYFoA7DbM/FbtNB5Cd9nWrLLwIONmzaCHgIupGS6GFAbg7Vlt4dmoKxOQkqFgKv4
raApY0AsnoBwb7DpgahCYAp6EvZEdpAwJJnSySQRu4f0NBklKdk95BlbCXjeBgmbthFBHwlr2OuR
fcS8+LB9xLxWiZC9K5juUE3rWFmuNhQ8v6HMR9k4uQqy+x6NC5NiRnVd3U9TLR+im2RsotkeSSxj
o5yF8haIjaSRc92M8zMuyLhQdOAlbOmb0C6kw9Alt4IDmiPoBSRDaEFBGA/sqIvJLzpYZg3oqAbl
mwqaCaAb4AqGFtRWg4kKBe0I0M4hNFmzyLF3OxwWAZrxGHQZunALNWME0jz0S9Dx2xREwFtUy0hu
H+pwmEIP3BKq3nk8lAy6DJNsKCyGHEYaajGQCO1cKiRgJ05F6JD4oSw8yx7wxE2gDkxlxrtsmqWk
W7RH2JLkOYEdhU3MWzjvwMD5Fq30A1n1CWDigO0aaKrV5xC8St5DtPvsSGvkSwJGWEtqEbkZRlgk
aiHbR1stLzWf+ibaPbHgklMQpEJCcBEwBIOMK6K1cuaJWUoJrEsKdMcj3kJSEKr41pEb5Tg3mjE5
2O54d9ZkYea4VycL9tWPe4ufXVgXnEjdeyX5WbsHyZlYmGh5Id4mPla8SzzNoD6pk6YGVqYWi54A
fEGbFcIoUMhUKFTIUiiahGyF4AZaev7zLwa4BAmPBmiL/W9Luxj2zSWwi+2MnEeZb7EdkheB+2hp
X4dfVxiUepCC0X5OHllL+1GY/yTRlAAkadga2LgcKWwq6S6FRQpZFvnOVAuWqT1niuDvJKGm8poU
LzfIZ2bRa8zxCbumWDlUlSgp1tLBrY7BA06pKBgdiIUehWgSYe50x3hVHVC0uQMyyHGS8Wv/4wXa
/2R+x98BfieVbS7tTAFgKJPSKaXOkMo647QiLms317iyArITtbbqOQ9EIUmKaFmmtXmyB2BLjLSR
8pzXDsBm8423dADFybC1N5g+/65dD1AUR0lQJRFmwi3LfUwnZX2N6DLX85ZOQJvOiEFpM8tM76K8
wahpUzoXnN+SctoX0HiR7c3BzgZUFXI3yNFtNzPNjDbZAaD9guWJOwBfEMv1fuWvlQ+tipHKf4ev
+KI4oula/cnKaatq3iyMyjkx8qkjKYw5TuM0MOUpCCK+xYUNqUC7hpkkaeKmyJbSz5GDeVlCYY7c
0I0KyLfjHHldMykgwTM+QyJFC0I8RBdniHPSDFH5Iigiu4SssISiIjJLiPImQhWQhNLtIpIlhM5o
lFAxy0/RQxT2BkWEXFwjj1CUPs/tcs6fIp+LShohcKYwlpBJKKEakEZ2xKUyjSxCTorMiCtLGhmR
KiWxYsX+oYq7rJ5yzOMWUfxwdNIdXLM0G8hmc4x22X45bZetdovxY/umpaW1ew8tHT98z9Gl5dtv
mrTTZh5UO22gJ8y1SlSfvtM2kmKrWlmxfpbV1PI6W6H6llfk8ipdoXaX1/PyGt9Y/W+sQjhSQZxQ
XyxWH0dqk+XKZbmsWap4jtVCsyrpSAG1WFstFl3HirHFIm2xeKuLuoVab14ALheFVaF4ExXhUmQO
TExFLEVsRZwhl7eXuODO7AoV2hS7P1IpINiP93QwCP4TPRU9Ee/2VHLEkur2VaVJrUgUy6cgpAA/
0SDqKxfdJhBzyhtplHDKG2okObiCY++wg0AISFmBgmBiPsnXkgopQIQNtFm/EQWFsDe6lB9Gv/Hl
kE4P+SEKebS04SEx24lD64NqmyDn1OrJbb4s1N1qcxMRWUSiEJrnlWcgWrGocwWLojECnqSVJ1TA
oZqoDBRA+1hp/IHYFYsa2R8FbsST9XmJ4qnORvbaJAtODKk2bKqeNMlsiXXl92WgWFs+K/XmDk1I
aIRLW4nsUTEX9ikT3vrFjIgUg5miGFfvCuvMi7c8MREoJ6PuEDUwF+oIOWNFHlQEFnPlw45pn/n2
yXz75DKS+rTS4uepV1iqymyayxeqPOXyjyoU0ZZ3miaWykaFklJWvHMn1aFK+Wk5d5+YyPOGRMDu
adPc+W1M2Dkt78a8qGQpujdeZHSKPNyxSIfMY0lTch6lFpMVFQGJydKVEErn+drWQMmBJZKVWmnb
BaDuhUIVYXf1Rc3h3Xuu1NZoP4SWC64WbWDubjtzsSY7f8FpMH/B6f/+BadSZmFwINOj8MY3AjUx
DdqIjBRvEZ/wdgqiKtqgVNspdZeBz9M6kaafbqbQ2yaElD+m5XAcZd45cn0VpAIhIEJu62aIMl3y
yIScmJCVooiQqREiBZf2NYtIpCgoIT9FHSxGnkLkPSfB7pWFstwNguUu58goDa6MTI2csISiovjs
uChaOyHkZPssoqAEi1VSqLm6vpki6M31eQ9GGwBXXNP1Wtdc3bzm6hQ3XpK80FrYeAnzd8h01dVJ
q65mVnV1tqy60gtttJRR5rXJPttE3tNLu19YZLcHyE1Bm0ExhCCUhxoErCJwioCSLQo47Z4UBTae
yEY5G+ZskLNosaHYWJ3rq50yzaLLE5eby6BXPVad4BuRzRjr5Fq3m1Ghj8+ZModE/OKj8rAevyGS
blh39YZ1Ob4aqHCMt1SyAM2OCqGbFU+I40oRnuNrsOmE6I7wenK8DdtMm+85MQiK02Zsn2mGbedS
hC/1xn2eFqT7zhYVqAtLFCVquQe8zJ1mM3tj9xL2mbeIV+dv31z7b98UKoie0qGRKtMpafUi0hEy
VUTovDAMuB2h3EgdyZjXtamapyIGr8vRnY4mEIl4fjG2cIJiFGLrhNvl+MXSiKKZQJhRCelowuPd
F6OERJKjcBR5GbLLKBpFrg7pNEpjKSqiTIXo+AhUbwFOhj7v63g5NAqQhiW7WQznhPwKXhrDUZdo
RzqLt4QM08iMChRebBeRlEnqbSD2DBkKxTlyGOllg8pQOjAPhMU+ikN2iJ8DMwIWdTPNxOllP6rk
Wus0geKrv+LuwM9862UHb73k+3UnxcP8F4pLjTPm2caZzvNiyTxknjUP8d8jHmq9KPaLfY2TTCf/
vd039d4e/fXh8sIdrfurqx9dWcmfgFaax1UrTDdvBS00O9XVW0ZaaFynWmC6ZQvWr6urqyMt1H6r
WmC6ZQu1z1TRwMrYvmbhjhcAvp2N/SjuOt94q/rlw2vHxqV7Ej97peR9T0vsxs++xiNVe/E1caPz
R3Hj4q9Af4/jh+AfAz0FSt89A7oI+groX0AHODbA/03xi2+BhqAt0DdA10HP4ngX+GdBHdDnQE3Q
d4O+BHoG9B26nX+Avk+fM0BvAMW5xddB9+F4Ajzacj4G+m/Q60HPgf5dP4uOP4H/AOhuUDzH+a/u
Tx10CPpPHK/p+yqgDXUf4xtBY1A69x/wL+m+D/T4enpcb6oxOPvBP6Xbvg50r76f+h6Avq75d3I/
TkJTIxrwawcMyP43VcOE7LIjLPD6qG7y3dRjWjtbtTHD91l/3ryM9qidaffDHuBTZj6qF3HtvJ0d
3Y6aJyd3XL/m7czbuVrtXNKcuIbGN29n3s7FtnPZc2KHj2/ezrydiz3G5sQO6de8ne1rZyyP3Mf/
0v/JqXGqesZ8sHqmdN1e/Zazxb9Xan9uvGnt7dwuVmtPN1629nW+pO9W3+zpfEosWXsa68y9p/Yc
fqfZqqoXLNXfu7AXR39KJeJFXYlIn7tcP9hcbCzp/8Aor0ikVYil+hNo74lp7VXqI+29/8Se2+6+
76trd/Nr2oePrR1/4NjhkTrHw9noy//zVtd4tXq0cgd/o+Vh/sAIq0cqn8u+PTihH08B3JpVWHxI
IRRH+FiuHjBeNdYmPl/+D8fR/MMwVBzwgA0AAIwrgh6RDUynVlaoyqRd/RU6NhRmsP+dzxyOZtdQ
4j6OaiIAAAAAAAAAAAAALwEAAPEAAACktzoA3LMuAD4NAAAA/nic7VoLcFTVGf7v4zwSEhbUSovK
rkFseDSEgECUuoi8FEsDvkpHKwGjQQPEBFBqZVetAirWR8UHalFjrdIyvkdF6draGR3a6VgcplbU
1fFta2MhYZO9e2///5yzrxBInNJOO9PN7n7ff+75z+N/nHPu3VRcAvT60hoLg+2gDAIfwJ6qP/QS
60quUOQBuBAuOm3W/GqwUDoPJWdWS31z47ga6MfLxo/Ej/XSMU/X9Vl7M9ykPsOwr9LcKAS2ICEC
061aPtuqJSbb+GzZBhWwUDZNBkKrdjKNdSNwGqZF/B6QwfsoDFUt3wVjoAQcPqthWcOqegAH/8qh
DqrABQgARn9yjTUB692NnzuhwtqpW7Z29qPlSqsDPrHG57WdmVrbmdkfbacRtWvy2u7zWtt9vj/a
7luoPS6vzcdobT6mP9p8LmpX57RNbWtgrvYurJkxtY1X1KscmnHkW4O75cymlVdEKs9dCkVeuwsO
I251wy0Gb7LXQp17NewGy/479PqWXQAxL8iA7AYIpQ2JEuHd0E1ymtoyxMkSkSWh/UjYEDscJFMg
0mBF/X0aPYMpjbF2g8kemOjqnDlYpbUu0eXdolIX+e8WeogTJfUs9JpJRHq+W8SLujf6dqM0q/o3
8fmpYqUXkp6eyreZ89QlKq2LT0+FLXWoy9yYuW98Fuv0KfQyaJE5xWldRXrJxXfNPFn8XX/4Nr75
beZJbFWiLzF+krrMpaKP9+6x46UO7565ReZuVbysFpmHSMcXRb2t9OHjq0LfTvM6lx3/F0t9V7Yo
0UtG/6ot9MFcy6jSFvr4rktU8cY1q3ON4kswP6rNzPEFWFJvsz6oiy/ZpvFFXJ/IbDkdS6JUfOXG
Y370u6jSxpbR5aii1vafbhg9I7rp4r1T45q8iS/RqL4m3qa6KdI26GaxIT+qtEFflQ058V7IqY3P
djpjQrdDdo1zdca/GHrFNI4vhWo9lP/nww9f3h9+vt8Y390stoEa7KqGm+2DTdhwczbctGzm7+zy
7wWgYRs+qMa3Pfluar7Xoe9X6nsN+7BwDfr3QR8/KGiDur4v7vsKN2jz+16/b3iDsr+vfYN/Ad79
q/C/PW//P5/Z+uq7vs4wzMh/7XLe6ImpqDbTWF8dv309snpibah6N+jVH+8lPbyltqtS0buto+fB
hi5RvONq48sg3prxYYniwxIP+ZHu7CY1mZ/p3o8n3ZfxwUtnTuJ/t3e9oZVcVfzeue/NvJe87IBQ
sCKdl+xio+6H3fWDkdZOVR9Ge6LRD2fRtB/KoulXmHE4WQz2qQFbQRwH3A1WkNAYbdcY9lJkF1sE
ya5eLEUklv5XbJU3WvRARosdIqPtZ7xkD+O19zCe6TdkxiH8/hrNLzQazjGanewhJQeK7MI3x7W2
eo+C6B4QPoXgXpA+mTveYUiqA0p8cKJBkOjMMq8TSknJDwDNlaW+oZkA0FlEBVKcbmnGlOKEkTpe
0AWlni5r7wbpqbJuKCWPY1kqrajlBRD3oLTblHqUlliWyEAp5mcIyzzMxxSoRE2pEiT7MOp8Q4Qi
nTQPJKID3WEKFOGdkK0ZIsL3ATVRmlKa1DrRmJ/rk0p9T1EqTerROVSaVpTskEzrQM+YKVGZmaaV
MVMPU5k2B5ZpE1FZKkVlOLO4tmCIyvImju8rcEHeLdpT7R3ah0HWh8mc6+K52qnOwsayFINa+sqA
uswyPjSjMj50tA+V68g8mpKTE3qmZJOUplQaT1Okk5PTennIBNpK1Hy7NmM4b1HVvDZ5VFufnCr2
c2rIL/QhERGYS1a2Ttg3MeFkDIkq0qVCTTszqgOIBiRMWNGKpUNNzUEHIDrTU0FJHgxRoCLxtE8z
qqRLG83T5vF1vPqpnulQmCQ6dQ7szFRHPhGzmWkS1aRtfzK8BM897l6wBinGkVUrJpA1Q6mDDNu3
2mEA0QTZ1PAkcsdwjBk7ZDgO1Q4b7lNitUMZHlycAKPJDpJQjoJa8xz8hjIceYALnyOCuBJiGOBO
CI85JETRRE4UZ1OOMw0F8S5sBj010CePonVd/NaiE3go4s6JIq5tGNBpcNFaWowFGEwUBL4SyaBU
6PswKEO9BSk/C4MyKl3tpErapK/i2kqhM3zl3lgXBYendh4VHJ7aqKBdLa1I4hmd054OWxMl2L/U
saMDnNYJCvoumhdmRH989Z9/YzxgKqpJRNSCpWg17cSaTlELsqInU3pnYABtiZgTgGYqU9tlhvY8
I2D2WqGskEIhnBXQlFYsKyCq1C1Pg0C3U/QYSZCHReBrySH3hwNsqKwbeEDLTtCuhRhGDfpfC+Eg
ju2hZwZ0AwsFCWzAU9wJkqHA09wKUtFALzouHu2ChF501ELoQUmXihBcxYlhKHma4cjIjymKuaQu
slT0mYuGoWpCs7BSIBbDgFMhQGuZCgsXFaIYIXqYHk5dDw2niBPXPBYkLRomcQpwGj4ajaMqLYGe
MROtMTRjksKUNCEyBklRMppDdtJSgvIxpSRaTSgHPeMHNLNyRs5DOd+htiUKXWwFxb4vCIkegVIQ
PiaoTJj1GY7/vsMQ7gi4WaAlRSdO0teIa4o+EST0ySCW1EiTJwwbDKU0Ck+jk0Vfo5XFII80ZRJx
mSWTf1WUHeoA2YM4qkqHzjc1IoMhg+RQvR36ZpVK4yqVp16epnql7XmazNO4sWQ68HJrX8rTZR6G
81dddiRuQFYnueVQk/6PQW2pyb19otqmkpQ0uDv9X/jvFugIG91HAXGoyYHC6CDPK+jpRmWvzyvm
QqV9FYyzv1XT80nFQFVjHjQarLcnYt21sB4sGw98xW+88aGMHuDTnX0mxwNP8zJ1EAu0UM5oW6X1
IyvRjpWXcNdKFknteSnaHk0VSImQl5dicccvkLDDQgmyUgnAGqqck8iuiZxEx61koRQqkkR7kZQq
lJwiyfK0hOsBDtLxi6SgSMLBGMmnk3ciK61BCQdTIOHJ10gxklLZ/qJxOuflpIQ6BBspnCLjJ0ly
SPLp/GCkUEqd640kSApnJSelTsJGslL66KscC5MzeusWXfTUIdMzHHq81bMLPJ38r2JuIgfLsc/w
6uBec6wO8+YkuNsa2WuGDTcZNhwutA+HZsyyN3rLMGNGdSr09NHOy96ye+rOIWRuWc0DDtxK8bKn
N110mUO7p0+3N3jODSgdk1pSxzJBNyRl5kCGX765edKnaLyX0fdVGTo3YqyVqduvNIZuQgshPGhS
rCohiqdTCk4lxNCAjoPJMACjFu9XHQsHU0qRjzckazRNIT1Z03akwzTF+1d7oKYJpFxTXFtthB62
yXtmM2xQz8sjvM6q5XWyDSIwxaqFKerZ+BTxLkyGCv51hb0/Bz4l9xz4VfGgM74q/yQY9flrWl9h
n/r8Jqem6oRCffa01lfYpz67HPWL+nfv1/oK+9R3651xxf0767S+wj71nTmoX9S/3ar1Ffapb090
qov7t87X+gr71LciqL/fk/iC+rswLKeb+vT0ffTNbcfMalq+qL4psqJhaXNDS/2KlS0NkcWN9csu
bohUzhm5X5wMpZsZSkpw8a+Ou9Ymfpy1DerYNivB3rKSyFbZx7GN9nRkQ+0n2In261DnfuCMZq4z
B9kW5wt3hzsQ2f3uXe529zlkC9y0u5odhWwtC7uPsCiyq9jl7n3sTmTb2Qz3HdaA7GW23H2P/QTZ
a+xZ91O2C9nb7CU3w95G9gLb4f6FfY5sPZfuo7wSR+DwQWw4r8ayN/kYt4ufgSzgs1iYX4xXK/gE
No2fhQz4fBbhLareYqx3LY2eX8lO5JuQDeZns3F8JV71+MPsaP47LDuMt7IafjsyybezSv4OXu3k
z7Mj+ZtYdjK/hf2AP45sPn+RtfDdeHUTD9xtIoxltfxdtoAHyH7Bv2CvCrLGTnG8u0fMxLIq/hGb
KzgyJo5nI1TZOWIEWyVmIBvLO9h3xdeQHSGq2AQxF9nZoo6tFM3IpohvsPNELbLTxb3sEvEisjPF
KtYqNiJbII5iq8VJyMrEHDZGXEo2EMPZNHEqskZRy9aJBUpjBWr8FNlo8WM2R7QhO0Hcgf08g2yW
+JJdLAcjqxNbWLPYgWyxuJVdK55AdoG4gcXEY8haxYPsdvEbZN8WG9j54lfILhXXsRvFw2rM63HM
jyK7SPyaXY8rTB2bKj5kCyVDNlukWaPEiGA/FPvYPXIIsvXiM/aoLEU2D69epq4ukyF2sxyL7A6x
iz2Dd4c0grdxBBk139dxvl8iWyT2smvkEchulBG2RU5FFhPd7GdyKLIrpcM2yeE0I1nKmuUoakUe
yWJyIsWznMg2ynNopPJMdr1sJTvLuew8uQzZk+If7E/yMLKabGStch2yuLyAbZYxsqmcxtbJRchu
l0PYU3ISsuvlMPZzeTKyJfIYtl5+W/U7D/u9jCwkV+AYyfZXyRZ2n7wN2Y/kfHavxOhk12EfD2Mf
uXwcrF4wzxpknWZNtVbDgty1zfj3ALThfS3A0Ar1Ktprza+iVqVV7/zSHY97KsCxvFowxTbDQ6j9
NOB50B40CFQZac+wpql9ooL0pECcYV0jJeJi6yElx61XFN5vfahwm80Vvml/U2GnPZvQPtxeQnr2
OPsGJc+1tyhssn+vcL39N4WPOAMVvuKMVfi+U6cwcC4jdI52bqN2nBOdp5R8rvOGwpVOh8Lb3CMV
Pu5OUvgH93sKP3NXk54r3XtIdke42xSe6u5WuNDNKFzDhincxKIKn8MYJb1d7Gol72EPErLB7LcK
q9gHCs/gTOESfrzCtXyWwjbeqPBlvp7aYe/yx5Ts8R2EfCj/q0LyBBT5gPy5GZ4p8nDhKSmCa9wu
WIgfXdPESM7f9KqGJ52k/WzJdKiBx5w/29tLzjCRoK9sLZkCEXur84lix8IL+N1j1YeP3e9Yo91b
e9lhdiOfZHaYbL/lsBAqrVHuR+UR9UPvqla12+T2lnwM34jt/vFA7UJnj3ZHtcnxVRMmjYucu/Qg
e97HACaeac87FUdyM9+p7uBy/Zvc0FaosE9wSyQoHGVwjsEmgxsMbpW9/Tr+IQqf92YD+/vuRwMi
rU3LmxsiFy1viRxk1G+hMKJgp0Zd/lLBL/z7a3wK9F8M+f9TGMLPXL100fIm+j+FITDydGv6fufx
HieJvLbEdfOUliX1TeCI12HkdOusg+nSfEfmxjoXRk8fbddc0VdvDxTPTrwnIpGaqomROT3OHBsg
+CcXOdPEMFQc8EAdAADA6YpjgOUxn4Il4xa9ICHyneNXUCS/qBJMFalUVI6SmjKTAAAAAAAAAAAA
AOYBAADEAQAAKC5eAHCXVwD+HAAAAP54nOybC5gU1ZmGT3VP1SmqzukCjRuXi81qFpFFZfBGAGmM
imtERdfbKjGMAooRRAWDkdgt8b4SibreUIMYjWweFkJ8dAWBhhUTHgGJsKwSIy0uKA8EW/DSzNR0
7ff/VX2bGWAwLO5mgZmp76upc6lzzvufc2qqH+4r8M943dgsOsUCJYKiELHB0XdezOjU0VtNV4hn
xUgx+uyzLuwjDLjhcObQhltvmDjhJNGOfzF821TQwm7zNu716hniAf4+AmU55Vr0dWzxTsePO/Rr
oy7xs25qGH9tff1uszROE11i3Yyjv3JdUJNy+RLpbdHduSg2xHsxNoSUPdJ70R4pjnSutXv3E3SM
DelHrfaosKiSBuknhR1QiZ0538dFb9FBxK2zRo0bdUuDEHH812KYOE7UCREI0dHK2SPoW/R07jc+
N05Cmifw/Zg40h0fluKOb0cpPd2HkPrESmo1KUytJrUntXoSqU+opNaZMLXOtCe1nonUfSupE/eG
qRP3tid14l+Qur6S2psWpvamtSe1Nw+p+5RTR1cbifLV6zAYFkZXo3/Lfa7FeNT8W8Uth1846pox
N4xruL77hFFjx3e/+tqGcdeM6t7znGNEzXh4XBxCyczbxLTo+IAz0BjhvWJsE0bsE7HnL3uXiHlB
oVE4jULIYiDyTcKGTDcHTcJpwjkf53yWKciiL+wm0RiITLNwfPwaMh/KJKTfLGzI9K4A55pR0UIg
skXRETJeDGI5+ilyfCLuBUGhWDokmkUsFQS+iKWDYmjTAcqNySAIbRBkmkRdEGSFSBRFLB74jaIu
GeRCK4M8LH6iAYt0S5ldIh4UhFBFYaSKBRFPFUOTLhSo0NAEeRgZZITGsDeCLBx+CgUXDzJfotSc
cOPUMl+gfvlQ+9DJSBegvUjnoOORzkIbeeGQznwuIDsAffmZMMazsqD6sKqD6rinLsKlwmjmQzw8
yPDghYckmhr31h03mwplnwJ1IMt+kOgLF3LgLmEYkR4EHY90CtqD5pbKNAojWTI5mFTJoH2NdDEy
GDBGgM7WZPwm3GtQiFyxiTonHzmMIvRNrpk7KRlkfOqbbGghfD7J11IX+igCY0Bz/xbgAow3upQL
o5/4ZTOdbuZCQpdGFakQn8cJ8ivlTRaiVLLmy/JRtTRnUaARUQwdsqchgdtRvrBoMsJdhSaN8YKk
oUFmwgtyoUH+Ihlkm4TrC5PGXypoZE2jL10MNTIVNF4dGsFFg3mDTAdxGrYkU8E9QS6UXvBWkG0M
4QMt6BEQR+DsEh2aaHwGxV3EKIgohAKkhCIV5EKBWoVCEgiykXq7wEcDLFi7hPDDw6TwgBFj01D4
Ek2538Veg1CLrwoVtaSE9FQhVU1aKwKryawmNiK5BvEW9FcHhlYhoxxMauNMiyDUMkS1CGCtw1tV
8GsVHFuFz6rQWgm3lRBcFZgrwboSwKvCeiXUV4X/0pSwr/124L+oqgbDsosQyhqIAW4j8QZdCLUk
jbtWjUQuNMUbMik2iEW4qhjEoRGmNNrGCF0+dPG2XIGdlEEhlQ0DIRygS2XRyCUn4Lxi6JI+OVly
BXLxyGE0wlForjhRcrkaly25BPopHbo04l1bNnNgbVBbDbK1Va44o+bmal08csl8jStUN5/nVzet
VySX9EtdIqo6QXKXlLoL0TaVjZcc+i2V9ahjowEQ0AAgENKAIxtKQgbjhThJ+iCUznnNIUaNNCEH
ohBKozlcKCGapgESph+MTpEsAq4OiBHxgOYSWaDptd1oMbTEb7Esi5HcReGgLAsVicjUgWQhMCoq
U1bZssqVVV4kgBCGLxoIM1uBbcqnu0fP+WzTOQoQ1ApsERnRcZgHudN5XWEGNKTZ0sg20Z9GwFai
N0x0qAithw4wvYpFD5iSliwZskl0ghn3W9kU2xT6xTRaWJposjU2mUUPG2lM+nW1Lth/jgpMc4F7
tWHt0nwrZZtiWyzfCjdDxRYiGzUDNaFXaRVq4KRfakJasZkpWi8Jr4lnpSK6A/MUe9ejKYj6FvmR
l+hT9HMeo5N9nCNhkKNliqIA2BTUUVijcQ2ZQbyjiElc1NHUKDSR0RyYNFHm2IEJs0BzKDsJl+fx
oUMyTMIcUyaWMKmAV1Z+6BCdMRAMGlwFWpe1Gw2CC/UJ0ZRNkUiVRJoF3UtjJOIlIVsJrySSkcB6
EfO/5Jb9ko+pYnQs1B7T+eiY280xu2/HVOmYqz0mS8eoPK90jOoh/fAYj+oZR71tXpdnwnUfrW7o
mMqHxyQWgOFKkZaMYXBp3v+i/XN51f4mHfahUerMZE2vWo2ice+dy31KMdFrQtAMJfIRgA5D3MLI
T2c82muEc006w+uCaB7CHEbsVmalZK56/vLykeOZT0aO5kGs0Ao1LpqH0igc4bDGiWLF5Vu6dNl5
ta7Q0qWixUDkSrMwLfF2a1HxFjaMQ21bmoYr030qRLlk6bbAeWn2T+Y5CJRmf6oSxZXyTC2CfGlO
x44NBHvVLgiKpZkazV52Ruj8ikuyo1Uc5iVaJEdLupyggBIa1CzOUzoZSdWkHublIRqf9pnyCwLI
Pxhyvo6Qgw2d8QXd+/4W7exNlzbF2EDRoo20R9oPdYp0wHsGNBPNcuGewQjYhKEhFrkwNGC3xy4M
BtjXsSu05bzQ+RyJeCrnH2xwiSFLBnnxUkpFqwVeZtUYl/vPD5/xVGnF/UsLAoCoomWLkT7QpqYG
JdOynm3fmYqWRPyYqnXT1Bi0pOFFhuKJES3/w4WQkfYrIabcCwgx4SKo5ChqkXPCBRBNFDYtf0o7
gXRlJ5Cq3gn4oZS1O4FcuPxPlZb/srz834c1zoH5KlWqUs1yzUt3k63cY77mzmtao9JCUatVWrK2
iaOtMzV/oY2uqeq2MiCptvq6ZhTUDJZaUxpTOlqEx1oPygMFDA/+jM+TeBmEdGuQk9Uag0mUbpnv
pTTW+S6jZpKFakPNRGdUtBvja8kYzEeuKpzRSodn0rwIAx1NkVgfYW8XPkGh7QM9eeVF3ZeY+/e7
2NchWzMTezUz8T6sDnc3D+cKtfOv3875d1/n2+xXnG/9fZxvZfRUuEVLtXfNsvu2qjRaaneNlt5P
jbbXxUq+ReNF5XpRPWS7FynF6kb7X7Avih18zHnwMedf5GNO+Xk4ldGWfw9r2TZ1Opras1WT7P4x
wR6NbgqfMsaqflW91CAjq02y2tCGlv524+0Kn0lE0m9TFioyX5G5ikSOdij98FxjuBqNJKrc5nTz
Zxy/9rVq2+Hx695Kxg4+vTr49Org06v/T0+vvu6F4R427RCVLXu8smWvekKRDKf2Pe7ew8FKwz9a
MMLR39KC8nY+z39Uavt5F2/go/2nx0+4op2pxxt4v63HODWPu9rcwO/22dfXspf/H37eVd0cNQ1V
04Tlxq1t91Z9UttfLfqy0s97feSVrKwKqwZUNMzKQ+/Pf/blFkWclsPExIHUX2H9cfCv9Af/Sn/w
r/StlxsHn1kcfGbxF/LMomp7F711nSpv9vgxRhAeeevv03zth7xrn1/8jN5SRloqLc9vNEce63+f
3x2NPJHHbyyHnmpsIoyneDvRLJhSwXsG2pAQtaWdAvk4M+1xkYnQ1xUosU+/BsgF+sNLml6uJk9v
Lwc+6pIveYwYn7jk965tyjJZRHZNbCmWyWKSXpFmWyDqUvRedMkaQZpehtZFHiZsG8M3wemmcWuR
y7ErVLk0vTxb5bKRy7LLNIYv3/IfLIq7KiblV5tCtclXm1y1yf4fMgf+vWxR/tTKDDGVP3/U3Zsb
G+LNtUeK7s7Q2BBnKH/aaKhcKPqJI71JfGz78zCnRZ9woc8W9ezYU2biJxxX+VQM8rBWia7I45Hw
6Aw1N4R58nHPeSI/c2a8b21+dfkwv/AIb4T58XGv+cVfj9fX5hc/JMyPj63TrwMBZ5TvcTzyWBE7
rNtZ199wVfS5nVE3NUyYeNOo6o/vtGzdzpnDgwBZSlGH/8O8PrFLvGGxW6D6x27xLo89KoYlVsZW
JP4U2wZ1U3xI4qH4aDFMN8fnJLrF34LK1F2qZ9T9EMqq26J7mB3EMLXKHKS2m1dCZc0rVc68HepJ
c5aaby6Hmmnerpaaz0BNNWeq2eZSqDHmBnWfGUBNNjerpywLqre5Qw21DoE6yeqhLraGQJ1oHasu
ss5ldSbUKCjHGq56WZOhTrGGqkut68Uwt9karbpZd0PttCaoQ61HoN6x7nML1ixcV2eNUd+y7sO5
DdZsN7BWQuWtKaqjNZOvW4rrNkIttRa5G633oT63pqvDrAV83RJc9wHUKqvJ3S67QK20cu6fpIB6
09rmbpUK6i7Z1X1eDoRaYW1yt0kT6jeym7tGngq1SHZx35cDoN6wdribJe7SXS2PcvPydKhn5GBc
MQLqVdnJfVfWQ42VU9ypkur3mGxwX5F3QP1cHuoulidAzZQD3aVyONTbsrO7Q/aHekT2dl+SQ6Gm
yhHubJmBulaOde+VU6HulJPdX8inoC6Tb7qT5FaoH8sH3aflHM5vEvJ7HGq6vNldIB+Gulne4z4s
fwmVkRPdGfKfoWbIcW5W/hTqNXmj+578GdTdcob7gsxC/YNcglTUViPkWqT6DGqYXO2Ol3moS+Qy
9xa5ia9bg+t2Ql0hN7m32dRWP5IvuU/KtVCj5Hy05nqoMXKOe5/EqHNHy1UoZztUP7nTvcw+FOoC
5HIj53KNXO/eIxuhhssP3Mm2wWVsdW+2XagzbMsdafeAOsZOumfbKajj7a7u+Tb11uVyBcrGaHe7
2H3dAfaFUKfZvdwG+7tQp9id3Ett6o/r5Db3fpt6+gy5A/lRD06Qn7qP2J2gjrOPcM+zB0F1tQe6
A+3hnLY/0l4OdQ7K/QGXO8Cud6+wL6jwKIwnnjj3Q/A3GiTezSQeCxLPZRK3x1Z4CSZxGkicSyQm
LgCJNzKJm+ouTZhM4vdBYppI1N3NQXowkai7mFfqAUziGyBxM5O41bxdu0zi2yBxB5M4HSQuYBKn
gcS5TOJikLiBSbwdJD7DJF4HEu9nEs8AiSOZxMtA4iQmsQ9IHEYk4txonAOJ6mSQeAmRqI6y7lOn
M4mng8SriUTVyZqt6olENQAkXsEkvgcSfSIRjC8C4yBRfQMknkgkKgkSj2YSZ4LEpUxizsopwST+
G0h8h0mcBxLfZhI/sTYpj0lcDBI3MIlTQeJsJnExSNzAJN4NEl9gEkeDxLuZxF+DxN8ziSNB4p1M
4iCQeCWTOAMkZpnE74PENJN4F0h8nkn8OUhczCReChJ/yCT+GCQ+zSReARJvIxKdZpDYjUk8ESRe
xCT2A4mXMYmngcQGJvFEkHgRk3gmSBzFJJ4MEi9hEjuDxP5MYi+Q+F0m8RiQeDaR6GwGiRaR6HwE
EiWRiHKXoVwisRsYOpUYcraCRJdJ7AISBzCJEiQezSSeChK/xyQ6ILEXkeg0gcQuTOJhyOUkziUA
iUki0dkIEmNEorMNJCoi0VllW852ItF52046O4gIZ7nd1dnCJHYHiYOJRGe+3ddZTyQ60+1ezgIi
0Vlmd3I2EYnOWrnN+YxIRM47kDN60HlNfuq8RyQ6C+0jnD8Sic5ce6Czmkh0/snu7/yKSHSeR7nL
uNzZdr2zsprEwcbiOzA3DvPOBoljmMRTQeL3iESvK0gcyCT+DiR+zCQ+BhJfIRITp4PEq5nEj+q2
JCST+DuQ+DGT+BuQuIZI1A+Zs/Q8IlHPAIlZIlE/Zs7UrxCJ+ifmBv0ckahvNTfrJ4hEfYe5Qz9L
JOpRVg99F5Go/9E6Vt9KJOoG60x9B5Goz7OG63FEor7YGqonEon6O9ZofRWRCDUBCiRqzIL6DCJR
97bG6KFEok5as3WKSNRHWlNw7UyKHtZSPYBI1B2tRboPkajrren6AiIRuSxBLhhdupPVpOuJRK2s
nO5NJOLcNpxD/6hPZFftEYn6m9YmfQqRqBplN92ZSFSB7KKTRCJS7EAKuktLHqV7EIlquxysE0Qi
ruuE6+opkskpajORqN6TDconErUhD9V/QySqnXKgPpRIVE2ys+5CJKrPZG/9DSJRfSxHaJtIhBoL
BRLVR3KylkSiek2+iTxBolonH1RfEInqfTlJFYlE/OZmlPYwxU15j9pBJKoP5UQdJxLVVjlOu0Si
Ksgb9eFEolojZ6A+IFEtkkuQE9pKvSzXIneQqObK1Wo1kah+JZepN4lE9Uu5Rv2WGFKz5Ca1nEhU
c+RL6i0iEXc+H3cOEtUyOUdtIhJVVq5SOSIRaXeq3xKJ6hfI5XXOZb5cr9YTiSj3A7WOSFRPya3q
NSJRzbYttZJIVE/ZSZwDEepndlf1ayJRLZUr1EYiUf3E7queIxLVs3YvtYRIVNPtTmoBkaj+VW5T
q4hE3NEOtZpIVAvkp+oPRKKaZR+B+xhEa0F7oJpPJKoX7P7qDSJRzUS5S7ncJ+x69Wo1idM6fPu5
zSDMuxckvsgkjgOJP2USLwaJE4lE7/j4EO98ItFz43O8v2MSF4DEPxCJiYdA4jwiMTHCHJTIEImJ
oeaVieuJxMTfmrMSZxKJibPM2xPXEImJ48yZifOIxIRtbkj0JBITwtyc6E4kJixzR6IHk/g+SCwy
iRutYxMxJnEZSNzEJP47SPyQSVwOErcwictA4iYmcRFIfJ9JXA4StzCJa0DiTibxGZC4iEl8HST+
F5P4CEh8iUl8FiQuYRKfAYmLmMQfgcQnmcSrQOIUJnEySHyKSbwJJD5EJOrrQeIDTOJ1IPF+IlGf
AxJ/QCTqYSBxPJN4HUi8n0nsDxIvJxL1d0DiVUSivgwkTiISweMUnSIS9fGyQZ/PJI4EiXcSifpM
kDiKSNTngsSxRCLK6I0yQKLuCRL/nkhELmORC0gEhZP10UziR/JNuK0cCx5ELJhDsUVOQmwBifqv
5M36ZCJRf1Peg4gCEvVfg8RvE4n6EJDYl0lsBondmMS8nKE7Molb5RJwSiR+INcibhCJn8rVuhOT
2CSXIWYQiZvlGpRNDP0HSPycSSzIl0D2Wo5L8xGX1rOaA/UWx4xViBlE4lsg8RMmcStycTmXFSBx
G5P4e5D4KZP4LkjcxSS+DBLXMYmzQcRKJuJVkPguk/ifIPFLJnEeSHybSXwaJC5kEheCxD/aYWTc
pjYzictB4hYm8WWQuK4FiY+CxJeZxP9u7/pC4yjC+Oyf293cXe/SKlgD3m1TwbOlEo+2BkEvKIio
tLV9iD6IxqYYi9a2CPapOUFEJIJQRBEfIvigtdRiEYv4cGoein0wlkojFj2Qpq2l7cU0l73m/vjN
N7N/7s8mF9PaS5zLzX3fN7vzzc7MzmZmvm9+OwQ98RD2xE8g3xHM933oiV97euIw/HV04sfGAom+
GzCDAwETjnzsGcWyj46/XcEv5V6YD24kyeBBeXM4H3iQp2ZHxgP3EDM8Lj+L3KrgN/BbMy8NnpNH
QmsVo8Es+AwI3/FZsJ3vMvIcSYTWKM8Y5ibzib5d/aa7ruCMsEMDoPOQr85va3Sued0wt3Flji57
jBC6II+E1/nq+rmBrk3m5u07+na5uuynXHgn6Drsq+tMna42uC7UZdaunrzjtEgVnoyyUj4WbI9+
6o8n00V8P9tJr/SQNEUWgCfj5M/vIeUlZcIYVSYoFzlljEZOkU5lX+Qjinii7FMm5kQ8oSs87ZoV
ztFAEsqHyrAX90U9wXSpJ5rQlVAvQWoP7osWY6m1WDOptR5I7cF90few1PqeZlLrByC1B/fFGGGp
jZFmUhvjkHoO3Bepl/jgvhhvSudCj7yyd/uLu14wE70vV7UUR3qRv2BIL0CHdFW22o4qb/ggvQg/
6fl4dgg/6cXpJ61RyJtJJKlJaj2FW/AqXeaG6k5PccaaIm1ltK5k8jZXzCNGTorahKYdtsxZuovH
QpY6OkBxqWMlxhbQ71IpVgoItUHjctcQiQPiGHILdZOwGIKSRO1UrvOEhdYnbsYq8J000B8tgh3V
whhgptH0wxgdmTyihDBDU4VHIKPliX1mlDLaNKEqghbD9CgyFk1fLE8aW3YNYlluMaOxbNMPrYfs
DLvRS7xINI4XUyrxosdpHKsOiGNVROMsi8ZBydKsBqM0zq3i9LSnCdxmYS2Vm2JtWLHbMOs0Xdo5
28p7ldks3NTUugEVyOIk3ob8qngbKqwNselo9TCWNjKH3aF1YnEEHloGhMQqOdhY0ZJnaxS3K8bd
GkX1rMpTrPZpo+p1jRote9uQMmgDpIck+5x4md8TSokzKWQKeKuxxkyxGwg9clzr6CA3f86w2DRu
3yniTUlbMEpvVGCKrE1LGFNglVZk1VPmzj5WbXfwdhLWdfwb05pyO6LdM3lH5d22SScbAQokQIGE
R5bwyBIeWQI3ZT7j3aXtBu58W9xdVoAtLDLn8yUNtnBTH0DW7A8giT446c3Pnz+DWf78cZ47mRZ4
7ojtJ2L7yRLdfoKz1OzVOWmYu6pC9ReE0OLCTXCi9bcAUHtBoqEFYBNJaNfkX+V1SVKz8h/BM54k
A5z2aUflUV1V7iWSPElqvhpMCos4TsNpoM3TQRDlw7iwUWHCsgBFtqYd15ailUrGleLQL6uknCul
cinLI2WiRVcaTCtlj0SwxzsSsaU2QvbTkx0J56SORJcvsl4pWiXpuSrJ8kpKlUTnTVSSgZRxg7BH
qlRJcDFcKtPFrIwt7afD3qxXgrk4lwapZNn5pdI457elDC4qcYk5yWeppFAJ/eC5FLVwqYxLuoXb
ALikWLiyxCXJYktJDMG9u8TGXXqBPZjr7wjvF0cn6ZlFS52CzNbHqJXtMz8rW2C99F70btOkdmR8
twL1ym5gaVO2Mksb0CGlT7Y0f0tbzRRbvFOhIt6pUBHvVBDvVBDvVBDmk0ViPhFAkP/h7F0AQQog
SOHgdAPWW5egg1PVzEKAKqQFqEJmKYAquAMPAQQpgCAX+r1xKJBs6JPBmTIOidDxsWgD+NEpDx9F
pbnBunp8NcOGY2hScQZoUcszdNOLDcZxVSO8eIYLs3aIdA3PO8cNMDPNbnNCIevtNnV2pibMzlUj
/Ao33LvTAtvurNMFas+/KDpRc5+AC7Q0K47H7nUB9RfeN0vM+0bgvgrc19bGff1ffYXppYVNLw1w
pYwxZcIYi5wiptKvTCj9uOuwP3yaYjYZw0gb77fb6dl1mGjbEt6jJjd2dbk5gJbgq0wL0tm1gIZg
RE2ur9FgLGcakM6pQf9cTSZrNAQOMw1I59QQeFQFBV11ds1qvCnymlP23ZDqqnFFfXpH39762sWd
wpUK2j110g5/ncYBNRq7QFbHfyCrYweBfgXhbeA/ADoClB47ATQG9BzQX4DOQJgG/jfGx64AzQEN
A70ENA90AsJtwP8ENA70JFAF6O1AzwIdA3oL1/M70Lt4nAT0DqAQF7sItBPCEeBBV/w+oH8CXQl0
EugZnhcNx4FfC7QdKOQT/5tfjwa0BPQPCBd4OhmowdKhvBpoESiN+wv4s/zaZ3j5Crxcl1kZ4t3A
H+O6lwPt4OnptWeBXuT8rXgd3j3YvAUygR4J6v6QKilQd07IeXge1FmO+QY/PXPpaOK4cz2XF6CP
6vFLD/cDPFOaDuo8zhV6WloP6yfDLXddQo/Qc7P0/Ks+sYjKJ/QIPfPVs+A+0eLlE3qEnvmGuj7R
Itcl9Fw/PXXzyGrML2NEHVP2qWOzYX4FfjQu6x2Rx0ky8L0xrndGttmYX3hkReRhYuorjDxyqwIn
4deerbL1AlO7s60DwjWflYjTpBoHK6FtDcYMkwMYefC++CqEqR0BfUf89Mlajb41QyvqobSbxNdK
S+fV3fIWPMLrQ3lLyqkD8mPO0a0NruMYCBucFZYM1EKODGBIqD3SeamvQf5DJBncQo6HeqRulLqC
T5HRULe0wYl/wCen+3lONJfdGBKhdnJcer5hKSv/ALap0lwwVBzwOw4AABSjqmh3lTutb8UehlPX
tD+rHyUjuAQdr0+I+ttray7pNi8AAAAAAAAAAAAAngEAAN0AAABIOlAArNMqAPkNAAAA/nic7Vp/
jBxlGX5nZmfnbu+ue4VAI+ndbK8YrhTK9UDSGuhYPVoJRUEIaoRIkRZKSmkK1hKMs/SfRoOK/0g1
DSlWTI2JYkASEzEbjb+CSgiKqDSsBBCj0iXS3tze7Hw+7/d+szt7d93dkgpivPa793m+nfl+ve/7
fN/M3gUXE/8csR6kxbYaJJUQ2e+Twj/5VwdrGjxEN9PWyzd+ZIIssOvBnI27Nu+8dS318mOj9KFY
T4w89pWuVx+k+3QZRV+F5ig8tNBHJbrWOuQetg4xGlzqHh5cSmN048BLa4itdWgNj/WrlOdhWoy/
Tn3qRZD1uuX9dB71k5PfuGXHlt2biRz8G6KraBXliBTROO21XOeiVe/BtV9DeYDGrEBat4IeWj/3
Bdw8Qa27bV/utv1e7q46F6LrzN2JuTvpre8L2/p2jsjdzpHe7p5s6zv3hNyde6K3kU+29e0ekLvd
A731vTrbt7naWtS8+lncea+52kSF/hminTTunK1Gitds2XHntru27d52192l8StWtMXOfjqNsePQ
/cbeZ+2hj+XuoZfIso9Sh/99M2QXVVSnQp3ISxTVZqkPMGyoWSrMoi5GXaxhAJjE1DdLdUXlBhVi
fAxYE+gDxg3qAwxnFOoamFSkqJLQMKCTKLvKv6mqK5yiUlGSmkUNsgOlYrJDlQgNFfq1PaWEKlWe
pZxSFaJFCdmOiuuU81VVqKdqoPiNNUt4SuUZclRENJiQFSQROUEiJIwi7lSIqoF4qkxDyA9LVcDw
mwbBHFWeRq9VGnB4ZY5jfDXBMbBvcARcNLgK7BhcAbZqVGBcPkaA/VAJ7w2ydmqUB5rQKAc03MlF
uJSshjaOGE9MUYyPpcbcSphsIHAiYgdquAYQvhgAvGSGLMvgdcCOwQFwEVivVLlOlp+SKkiQEqyv
FSaGIGAsBWcPMYlnMVcVGZbMsnNqhiGK4JtqQzvJV+WYfVMRChDrSn0tuzBGF4iBIe3fCEwh3vhS
3Rn/xocNrm7oToSFGCJ3Eus4QXtp20wB0p6H9GU1M6wh3UTEEZEIQ/McEpjOYEx53iswKyEh4gW3
CkFjVFRVIWiffFWZpYGYXI6/QNU15ugLE8FolDheCxzBiaXzDTBUDoctw0DtU1WBRfWUqtQl+ZAt
8AgyjhNnhvpnOT5VMsM5ioyIBCBTBASqKgCjEuBxInh19nakrYVcyM8QxWL2iEHE9HEoTGMpTzno
rEDz/7eyoj1TJHsyKZXNtHkZmM3MbMaaTG5L8TnZnxWGeZLRFJN2nZkjQnMlao6AzZe3jPjNE8d5
8pmR1pbctiQ4I8wtsW4JeEbWW1Kfkf90SzhZv71l//OYQOm4NpeICY6TNwvfVKbFRsYm07wCWFz4
VkAtBUgATiescFkSy1Fp9sAVAnzFSVfnSODs5JVRvDIMAoXk7p/RnyH9GSE1ef0i7UdURdJ8rBE3
jwWf5g9jAT77vH9amoevjuvmBQSscf3HpflEI26+iSBVuIx9hnAA8BEfiCyGISBCsDDNG4ayEQwD
WA6MZJo1jTGCrYKB8SWJykGyEPRYF4fHA2XTBINDvBkS8tWEwB6SaSJK7SDSzNMhavuxZnwX5wWi
bAZts+Lig7qePku4k2iGwdRajIfD+ptwGCacB5aioVlpW9jgrLQNpwoJdDqBDMwaXzRxlMEVjQsc
C3BlCuMWrLVgRUOEAq2LUrRGIxNw8yPRO8aKKvswb6e6mbg3jB160GArxJ516ojqSIY00ftd86OG
HAeaxMsSP0s4LFl+ijPQkhaMF4RRC9ZasNqCaLFPYCx1LGAtiCG3pfUpsD1KDA5Gjh9RUJdD0luG
e9K+CRG9dUb0ymZ2NWPjVPTKqdZVM6LHAJkk6udlNC9KzxAtzUP2MLLmi16xZ9GrZUSPtQ59Yzti
5GRULxaADwV4DDi7UhsYW8xwvtBqu0OUEyB/XKsPemaJbKQ9x4JC3XMh0tsq745m1LGMOtSjhoCR
xR/H6YwTmXGgZ8w7Jn/MyyCrlchqBbJarGRUkcOblx7efL3M/aJfvPLaK2qOezIOgwtTn7b5GD43
IWAC4p0Yy/+X0f9pGf0vjzvvODsypoE6uYv4YaAm+HNYNFYCxjgv6UManO1Z/DyjxYsZji4U6nML
M09YVTOnCJZoXxnGOhEJ84XFcp+vHzVCw3CiclTFTwyr8QOKl7JqG6vgcZQ41lLGDQkLF2CcMYug
0iGeXDl/ELEnpmGL+nNodBIU4++VViistmiwIDU5x5PlJyrVXBZ+oEpZjZ/f0qn77SzG+kHvhRUT
PLqRWU4qJsrhI7QwTzNlnKKf0JrMESbO9PgczsdiJHad8qzjTRLyUyAHBBP9DMixwjFV1EdpHV8Q
PQ6VmPLHiB/HeglbbMMUxry38SPbrAFBCkINMAurboCTAm8eKKbANwAbcE12HF+1HqHaHqmMDc1O
FFZPYCsnZ5viUm23fmpNf8XUmnF4Zmd0zDgdJacfS2+ddXmsZxvUxPq8yepXJLL/imacctD75sfn
Kku/8Znh90AVqyrag+CqWJFgPotZiBMJJmCWISaBJhJZCFtg0SAWGWaiQXzMmc+iNMCjoGKlAV5U
FWRY0GQEVkzSFCItNYZFzJyWWgWtZBOWSdIsq6TM5D6zjBS00fJbS1X7MDKaM28CVtvk2pnTVKA2
FmWXrxhnlxabBJjf1BzKOMHTLkndhX0qqDgtBYqDSpEdawJATrZ1rRF8LmDI733KIg9+zEeEOr88
lndBdf2SgCKBVkPe9s/otwh8cGC58RMlJ1+oX4ROI5aHju+HvGnOzFl98g/4VWx/JE8K+i0sv7nW
LwQQ0A19gmMF1u9reY25Px4vb5y8rhQkeirM+USlh1aVF8zMG7LVJvJw0NBb7XDCY0w4ixKHY7tZ
od/LmopAKqpa+nVFlHCyiV90RS0RxeaOuCKs6grSXtUVFVT4inQILDYVeV+/PUb46Jqyfk2etGrU
CWoic3WzJkxrhmUTh+6aLtIKeaGdraiaisVcoV+e91JTmVPjLFBTnlPjNWuGpUb7o62imKlweedr
q0Da6bWfXxFmKjgRWhWVtKLcqgijTEVQlR26VVEjrX16SXUFH7SyFVA2/S1Fq0Lh4Fc1ATisXV4J
9Yqw3/mAxwlUNjNG7JHX4InpfE50TvGsJIr0iS+RN8INjnI+DqaUcyHUb/ZsndXMzVs0PcaivA0u
p3yRfuSQL0D49BlzkGqGlOEzLVoVGxtbXehg0fo28iB9UX8fXXIfsQ65jwwupRJtsg7RJv3d86bC
WlpDY+4ebRf+nvM2880lf9M8nh/vfyY3efFE9ttS2uS9Kq1o27kVtODtzU1eNKcF9wFpQduuLbir
c5OTc1pwNkgL2nZtwa7m0MDEvG9tM3c8C/KZ5tx34q4D+btyH9+yedf81T2If2fd37/20CtbyaNh
/CvlLOtRut76FT55SH9eAnsud4P1Gi1z9tqDtHz0XKCz7Y1Ai1CeoeUjv4T9C8p64L/Ccvk18FbY
b6AUgP9u7DHYxSinAy+B/R3Kc8AjsMfMNdzWD1HeDWzDDqOMAT8O+wLKMnP991A+AFyDraK8C3gD
7BGUnwOvNdd7wD+DdVH6gF+U/kcngBuwz8P+CXYGBe2OJLAllFkztxgFdSOrYf+M8jrwGbAK5Q/A
58D+C8UC5jZs0w+38zLKcuDn9cotH30KeAUsj/k1YKWtrHbGKwrivXUrjeWuth5DP8vcs60aLcvd
Yw/h+pdQfoR7uc9DKD7wt2EDM9ffSNujvwD+Erx1jfNlsMfNip9jRvF92CmZ3chvYYsy2pGfwu5B
WULLrKfdVbTM/oG7Ca28370N2HL34ff97sPmymtRsJ4jv4e9AOVV4KPGH5cBH5Y1Hb0V+McmHhIT
J7xOlwPD56OnoTwGfCXsK2ZUB2CPmrhaCvtd4+MPwj6JUgd2YNkX/wDuk7gZ4bgcMjH4KEa7tnAQ
c3m4gP5H2O//RPmkWXvE7+hPgOG70UGJ6ZHT9PrO88mY/mn+VcyN9m73gL277bqzzN9IePr3hJ24
69yDQ+tp0j7uXuweHrrc3C2f7B9aC4Xb727QaJmTx+/U8yYfnSvdm50r8/YCmf4K8d/OSKan/Wq1
c+7Jl5xSqdRBJf7I+t/865w+72l3/a5tm7eT4z2tVWPFVadv3XXH7aUtO7bsuuXu0k2bt2/e8akt
nXSHleqzqVI5R93r+krmp9NdfyP+G6LWXwktyV9z9+033bGd/0poCa2IrKlufX7B3M0jXzGVv7p0
aeeZc4+jJ+wRI/e+ZW3vcP/LmftltT5EKy9daW3sMs5iVpOdo32+1W2U6brolfC7r8RY20pY13a6
PjsLPYOpzjN4A+T87I7qHO23ndLKTnOYO+sVn7B6joVe5xy2zdnbMDfi0t2tlLvBvSV3Q375Cdp5
cE4ejef25ae8UkknQY/RpOMnt8+79z8fP+il/s6On9y+viMOcvXk4mdrtzGdkR2Tv9La1GVMA+1j
6t/bcVXnjejM7hE92u6F7b3OIBsbnWaxQGwU3n5tafPDVHc/jLX7ofC6XVrZbUxtnpjqHhtt8YrY
+PDJxcbA/W97bCykG51msUBsDK5722Njrm5088OZWT+4U+51duczBY/pm1lPnOd9+s5tO27pfhJp
U3J3Kv9kVyV/M9n6naxH3Cnvwn5sWRetmuj93GLG1/f5N7XTdIkYy20fX79dKJXOX43xjX/09m6+
Hcv4dtwtDAza509289XGTH8rL3uvc8EVK5p3yLn6i6T+DfQMVlIwVBzwkSUAAHuN7vNWWFFNkigM
Bhj6QZk+FF1OtRvClUsZ1Y2yIxVtFrUAAAAAAAAAAAAAIgIAAMQBAAC4zmkAcJdXAE8lAAAA/nic
7FwNmB1VeT5zZ3fn7tyZc2bpw09Twl0D6KaBmAQCqUQGZBuwRAyKRbS1LCYk+CRkG0ET23Jv6w+R
xj6RWg08tg0/fYyoFRCB2lIvhedB+SkVHhFF5VbaQvgpt5CfuXtnZ/r9nLkzc/dudgMxKXY3u/ne
d+6cM+d833f+v7nfPkLAj3F/YY4YKMSOiCMhCmfov4bYPuAN3Ip3iBvESnHpO89+zwJhAPs9YL3L
Rzatv/KKxWIaPwX4K+KD7pl9+z9Oefd2sYX+joFn2e1SLLKL/UPecwObu5TFPHvDyOiahYsmzdI4
0zi+MLuw8DWXBUrSfr4F6Yti0F5uj6gd9ggi7w61w7tDzLHXeH+8RKC0R5ag1r4o+rCQBuLrRTH+
BZBZlO82cYLoF2bf2asuX/WxESFM+OeKFWK+6BEiFsLrqxcvxj8xZF9je8bJkOY6+PuSmFO6jZ9S
um0aTxkqPQ6pT0pTO2Oc2hmbTmr3aEi9KE0tz+LU8qzppJarIPXCNLXawqnVlumkVn8PqRe0U+u7
Ddm++wm4c1zfDRZqW80Vo1DyS4r3FpetvXLj4NCF60TOgtvEYeQVY2Krlluc0/o3ysV2jzAKL4uu
v8WmEJUwHhfFMSFUSwMfQd+YGEPewrw0MBNgJUBNAGUNCuW4HgirJQw/2ssy1DJgWWloWe+QtelJ
v1Pq9OVE6vxVIvVzLV0OM5HxXiqwEVehwGPCiGss/QbLchigXgpWXG920RSCSuv16CpVmj+Z0ioH
SGkTlFfvUF6jQ3n6uUqXw4qmq7QoqzSoo59U9oCCyTw7+9sHI8CCV0n4rworQhfcJYoRqru6W4Ng
t+iPhOnHcW1PgsI9wsZEUSxAXQmMNByPBRgLoQUQqmuP66tQYYBmGDeFHfK1xpgohnRtTNhocbgW
tAgaYSyqobDH9NUQmyVcq40LG9qngmshtMdAUEMN6AqAveB1kQYWgT1YDwDWbjCHvkCgb49I7lQI
+vYKzMIOKCXmjrAStZ+JV6OQIF6tc+lMvNoiiHqot9jRx3WV8JqupjGuq17Ga6wOuMYqwmtBgNeg
ZlXWoMJrqYqrezMmSM3ClmrsZhvGiQ3rbdNV23cHe7KZJRCcuhiRAvmaoW2oS6VtaLINyXSoHoZo
5BrXFHUSMMSr1RZ6Ohq5xd3DeMxawuwbrMZyqlHKnlXus/bRqNYEo6ooa0MEVqw/MpJ7ypH2CXNc
A59Ak1yNjemzA2GBLO1W2GOxq1Ed2AHBmCE5JVpQoaMCCNmm43SlyUoLWT0R+2sUdDaHbCPhpjO5
MYPdaUNMWqZuqLrZTqeF98MMqGeXMDxCfYAWELIAjQrbBAT5Gw1RQlhDnWpcB2xqDD5TUBpDUQtl
jSNsWA3hwCTGjMGbCnFduECozzPhf+FAyWPo+EwrrhKpgIObCqY8SHxQkelDbVyoqYqrTcgGLCUj
tChotwf+Z2rGIVAYOYFC3wYO3RI9oC2mlRicCZ0gIooKxYtRJLxxfFocRInwxqm5FurUaOsR+bUR
gDEiMm+lic4R0shDzhHSQCUa1LUCqI5zmw7ZbbWXwPOL7Dvs4NhPoNM3sV7QIqZjq4P/C/4ATZEq
MUgdFsEFOBIzXEodMsHTsXmPixIOidAmBKjJoeFyHMc8TaD1GiohAZByQkCVRiUhIKnpui1hgdnR
ezSz0MJWHDEz0fzlGDJyxkRfjN1O3GBSAa8B+zMpx1XIDyxTGhO9Kq5BBiFhM66rOGRsxIEfc6fT
A1O7uMadDnWEoehvkodAL44IXClkBCVDOwboc3W+ZJD36Q81gqQ1RmVKgKgCDkcugH0ZuUUPJPDB
Q7iYIVSdiwZVhIozrsR1A4uJGB0ciw9K64Ok2AWGWk3Yx2CNkZWx0ShUBjIflWainpjVsD0GxLA3
wTYYajuAmskYbQu1bQepDStrYiPO2z7jEh2OknEf7VTazaZ0x1/eZAhGBBgsQJPWHqhkxBL6FJ4R
1HhmUKmzxMqjLGupApZWyNJMZMTSSGScSqwyUuhmUeX7K4u7aQLZAUy6ZTe3NyqRlkpLNCgPh5Hu
pVrQS6UwTGHQFTZSWE9hVWuyFYftvi8I+VoI7ry/3U4RBiBjD5rlQIPpl4GG1PquKSUNU3VsNDA6
zZD/2wSnsP5edIgDDSZzo33sV+DuxlDX/YrzxJCzsP+iwomLOncqJN1xvlij5Ujp+f4Vzmn9twmj
ABO+/C8sfLBFlyJc2Y+3cRwydmgiFjNxe3FYxf4jYThipQxGrXqONVLmN/wgw2oqTFmlakYZBg/M
MpGwfiGuwpvbDPVaazOcbtWzTOWY1cixIMvMHDNCZtAfQCHNKMfiHIPCaBbhzLuWsKuAQWEyDGa+
mlWQBcnz/CrO89qsRpNgzcoBKr+OzEQW4fxBMxXQvF4zC1k5YWZAM2HNjICnvmRYsWSch26ribsO
453u0PFLexcwO3mjynZF9tXGnodPB7q2sRViqPRy/73G3K4t7Fjdwo4VK0sP9G+DVhZ2a2FajTQr
DHlqFyZL9pBWDkovWfUGBwyl8HHIgy6YzMTRM8LlDcxzY2yOdWY0LbNwQeLoCRn8F+nFE8+iYS3D
66pxnDeCrzm0/GqB69aYKJhooq8S8WF2is5JpAIKNE1oDCXwWlivmgYUxkbPhwXJVQwDgKczbAA8
hiGsXwuSYQ1gH0PoWwsgOnSTWma7+BztnA+qW+0Rdat3hxi0h+0Re5j2yYe9olgi5qiNJLvvA5+Z
7AN7Q+oh86T56U4wpFezxdGQ/gss7WG5kPMjOWV+7i5zUT4/dxnnx9Iedj7I+ZGcMj/nGHNhPr/S
KOfHEmr+ac6P5JT52eeYC+ZP2PnO3P8EuMGwvh93u+cVbp599tr1l4ysHbxi1brRVRtGrrhyw6rB
D68ZuXz1qsGhc+dOsMssXDzAjyV64N8Ktdq+W11tPwnozfaP1DJ7r1ghd5ZOUP2l5YC2lW6Sd5fu
A7TGKcnNzjxAi51vyvc5jwKa654h3+leLFa4L7p/KR33W3DtcPd2udh9DJDrhvJEeTSgZe5j8lL3
FUDnuLvlGnk4oBVyoRyV5wMakUvkn8r3AzpLDssPy5WAjpQfl6fKLwH6pLxK3iT/BtCH5BcB3wmo
Kr8ut8uHAf2t/LL8rvwnunYnXHuC7rsf7vsPLL38sbxbNgFtBXmrhFrKP5Gh/GuFpfq8fEzeJrFU
m9WA3KEWAtqoXLlNnQjobvm8fFLZgL6vPLlTLQD0FnWOPFutAfQtdaJ8XL0LtHaEeps6RX0Arl2k
LpOb1GcB3aJOkg+q9wL6tPqI/Dt1DaBH1Br5ktpMn54Bn4LW5LVqVN6utgJ6WH1Ovqi+AehO9SH5
hLoK0H3qEfmMegnQQ+ob8gX1CKB/UxfLhqoC+nO1WX5N7UAdqNXyu+pqQD9Tm+S4ug7Qg+rr8nmF
GvqK+gf5gPoxoG+qB+Sj6llANe9wWfcWA/qe+ol8To0BelLdJwP1DKAfqn+Wu9XPAf2Xelz1qVcB
3aXulT9S/w7oacgvpvweVvdAmX8G6Cn1gmx5JUDf8UryJ948esZseMbbAb3kzVKu9zZAY55Ss7y3
4nPh0+fo019481XBOw802asidbx3DJbA65G7veMAParG5MveLCyfd5QMvCWAQu/t6mjv9wH9j3e0
GvCW0jOOg2cMA3rAmyef9c6lXE6GXC5Af/berfq99VhSbw2UFK1wp7dSPuF9Cp5b9o5QvncKas37
hHzeux7QK94GdZh3LaCfehfBEzfBfaZ3ijrW+124FninqaO8DwL6uXeajAg94F0Kz/0Masj7lIy9
mwG97P2ZUt6NgP7bW62khzba631CHQnPaLfHAfoR55cK9h+WFtk3iIvan22HfzeIm2EdKcSsOfST
G9v0iWRplv1Z933OizCGCfEmtVWtILRd3ASp7xAw/yp4nqBrOAK+y/4I9ctzMF3RAvlb9i0k328/
RPLj9osk/6rkFosg7yjNJ/l46d0kXymN4ufOQOnzJBeUbid5Xulx/NxZV9pFcotzOMmvOafQ5w86
F5Lc6WxE6VrOdfi5+2bnOyR/23mK5EonpM8/6c4meaN7Osma+wf0+dNulWTk3oDX5Wz3X0ie5j6D
1+UHZA/JTfJ4ur5NLiN5l1xN8odyM32+S34Vpfo1+SBeV4vkCyTPVw7J9epE+vwv1Hkw5qH+svpE
22wX385ZKzvDGFRb3CvtNe6V+k5t77bt8GeB/QVnqbNtYLtYZG9xTna2D+zQVuVPtg5sE4POVmeY
0JvsL8P/HT24/X3nqyXXeanLaPFTwKfq0SJ5risuhvmQ477DHaRD0o99lEaO9jiR+uM6yPe2yfIV
ezry/c2biyfNP/nUhYMXrtvH+PWsENo3cfw6C0oyqt5Kq5/287WfsxbmOEc6q4qC5Ge0/IqW39Ny
J0vXLnY7Wf5PIC9004Gz1H1HafCja9ePrhq8dP2GwX2U+ikgx2dGXUirfj1zOj4xxU4gc0R63n9k
33s3rbtk/Vo87z9SzP0dY3jCXLZjVpCmLlo/6D1zw2Uja4Vp/UDMHTYu2FdarO/cdlnPE/OG5xUW
bZzqaTfka+e93RocXDT/lMFzO+YPyd+WzhgN8aT3XP+SyWM0ForJfowzxW8UZhtvEa8rRkM/f9C+
oLBM7SgsQ1RcqXYUV2JURvEEjs4oLJsy+iCJxxiyrzF2G4sz0RejnEtpdBq5DJWuhdSZ2A3o8Si1
s3E6qZ3rIXUmdgP6O0rtVqeT2r0RUmdjNzZzarl5OqnlLZA6G7uxlVOrrdNJrW6H1FPEbhTuEZPF
bhwX7TzqPatWX7b+cj2jzU5lc5bWsRy9f8SxHCC32EuNi9VdxouTx3Kk+47JaUz2hKZ9apOe5GTO
d9Izn/QcKHM6lJ4YpadIE06YJpxBdZxRdTnByp5vdZx+5c/G8gdnuTO1Cadt7XO4jiO67Old9lhv
wnFf9hgwezyojw0zp4npEWP+2JGPIqc+kUKhDw4sFopFmdfVg3SeS3BBwIcQuEES0KY77pUsbeoj
C8CnN3nHHLHf1IccqKnqmD6goj3EMX0WggT0a1QiTYIx3lRzkYQU2hFoFrXQOA3NcCvcwtW7pC2d
aoi2qTFVeN5U4CMbNmGIB2IhMTBeiNsMId1KD+PjChcPyqAc+BBmeIZWoMMi9JMy7uhx3kgVbunx
k126raGL5VIWAXpExAyyp73ClnBC0Yf7dAaeViGpxLg10WACmQmFJ19IIH9RxoOuUih60f/8eIww
el8lYgyZCvRXGz04MmKOB+ipxCa6LUI/vjquM1Txo7GOHcAGCRahyIkobor+Fh21RRRZBC0iYAAt
hYGvg46w1k0dUQMNAUNssDgoDWgLfU0hQhYbWYDHHPyN4sl+Zw7oZw7op3lq1sRWi42liU2oZtST
c23AAWMLMdSaD8UBY3+DxCdSoxPyKDZrtMnotihgBhmfFqPKJ7IgOZoP/Bp3hHRsX/Nrwm8z3P9W
+ti+HCKzEhYgMzUDbwRmxFkmElbPsVrCJNipwqwC/V03Wj24NM4XA2m+yCkzcpXLM1OzciPHgqz6
VJhVrYqQlcPEJCJjBItMkpgLelu/ZiYM7ObXFBpWO0CMDkDhTmnkEzaZKodtlsOYQ9twgzvSUW46
MCofv0XBcRSZhzFX7bgIGEusAIfXaTctmw/rcb88gZGGTewO2jBIIfRM/QiD2EhRtY1qbVRvo4aQ
0ITAfTG4BJo+UR9DSzCwISRaqdPJDmiBKG6+GzgOktFpXtEbo0sTRc/uBXsaMVGMEugFgwqmGDzQ
q1IKFujFE6xKVbb43K4X9+k7qE8UAy96jQ5KJ2c5Wq65GL8Kg35PnsUHjkmKkMUHTkm5dBWqSpv6
RKN2VUgNKQ001WpAFapUK6jgcpioEGdsvT7Ol4Rq0agUgTkCPN8DXlI4BKFtIT/kFoYNgeeDdxI3
qSfEIBuKqxFGK+7Bbg39GmAV+jvsMbFd9ODQKNwxOtvpxYGyTgzaRG+AYygxC1iD/MPlltGLzRyG
TJjC+DHNrEJm0DuDIxh1OsM0/Ok3jVw0uvWaYqwnBltn4tEbHFpdjvfmQ6yDacalH+hQ6+nGqU87
5FrHqatDH3KdLnP0+qbCNjQSY5ZzVt2Plw2wT1RpvE+ZY3gwdAw8v1JVcZiMNZWqkYSOQb8FY1il
lh2VyvXs+KWSQDIa+SzNcByEGVqQY3ocqtBpvpFjIkpZo5NV2kzlWdDJfD0Z0CwZhXGKNymFgndQ
7oe60xrFCVRSamQoVgvaeTL6lxvUCSSjPxYJ+5X2SC3iRjKmY1xjJVRZFqdRjqD2NjOYhSkrE6Og
xzqGbehwSNA4dig6ArKOMZR1JhYWMwmHxO4G15kU+QbD90yXcwi6nEMd8FbCRTGG+3BgqaEo9Iex
jzimNQOoCUc5XjMYMRHuGgqacdcAqz1i3BnAuo5Y0I0pZjriFIdy+o8IBghbCcGIUzPKxBFjQ8oR
Cj+tcfhpFjtk35AjJx09bTEqB5vkSpCQznJ2r1k75DYJpM6rJkcoTFcT7E8MPf3niRCFkrQDqY10
McCToIRhrxXrYE+DB4oiTn/a70CkKwE/uxIIGVr5lUCdp/9+Mv232tP//ZjjHJzfpFBpMdslT2pT
S+vYyNU8p41UQ1prqSbzKtZLZ1R/0MU0GbO1G4jfzdY5L8g5S54kPuXqSXhholMerAbTjhevZBps
ZWJDLmcxOJNIqkx1SXydaqnVZAVZgmrCK45ejdG9SAxqH/VMd1bRbwxUGoI7Ogq/p/esQh2WX6eQ
e5rU7YWx/4CD/XXZmVdR92e8nXkV9Y35KmrW3We2OWe2OX/VtjmTF4X0i0GTzWW74kryHlZmkD0w
JN4ncVu8y1jIfJSdatQ6XxIrZwm9g4Qh0k3ek9Aw7AqDFDZSWE9hbZzftW0mgddjPBvVEIrcdbh5
HfKQz1W7d4+HeilZmNm9mtm9mtm9+v+0e3WoJ4b7WLQDSJfsZrpkz+xQlHlo3+fqnZ0V3V9PGC2D
37BuL+cz71RP2O+iBbxefyra4dIrU0UL+LDbNk5uu6vrAn7Sva9Dspb/Je93ZdWRU1ROhW3l5vU+
wSZ5e3XYMrXzlFte5XRWmHEo7WZt13v9e18lfOcw4DZxMPFrmH/MnNLPnNLPnNJPnG7M7FnM7Fn8
iuxZZJZ3Ouraby/2st9zQkv/EMfrkNu7G1Lgp45ShrT07TmR/p4uxZGeYaS/rgs5tjyKWGaOJe6F
btyn5QR+DVov2gw1pfhLyXqTlQJyk9q0okdK5j0BJg7xY2jIAR68VDC4GjlGL8ehQS9xMwePCS36
JiBIXsQsyxFk1yKKfZkVlTFEmih+l1jkY1x0Qo24gsHQ+D53ucF0jCPBG/S+f6RZnViQYRUMns2w
mmY1YtUxDr6lA4uomRI/zJIgSxpZUs+S2huIHIIv8Oj2Dnthmbq1uBK/67WwzF5ObxMtt+7hd7pJ
7vudbnqTyBuyqh3vsS/v+1d+T5ylvbz3ac6T5JTviffe2PEe+/KeBufHErjB+ZGcMj/z/o732Jeb
h3F+JKd+D33Ie7hw+P6+iV49Cr8Iof0m+v+2dy+AUVTnHsD3NedM5pwzIWCvlkeyQi/GCEpyESkv
UxHrAyE+oYpI5CFQ4YL4SFuKQBWFC9WKrVWQxvioVGMocn0AQkgTC5dXhFQRKUS8CeQmhiSoTQWa
+/++LGEJWcBLvQU6muF8OzvznZ3d/E5md2a/6Ra4NT4j8ACiXoEH4m8L/Iq+NR3Y4H4WqEJ0b/Aq
98ngGF+GORTMczsENyOaHhpiskMPIhKhCtPZivNl6E1WP11tDUeUbw3XpdY0RM9ai/Vyax2iHGua
LrAWIZpn5ehcqwDROGuXnm01IJpqleuFQiDqYtXpgaI1oktFZ32LuApRd9FV3yyu52gAotGIHDFM
p4ipiC4TA/UQcY8vQx0SY3QHMQvRfnGfbiOeQrRNzFb1YjGWC4lx+jtiNubtErmqQWxEVCNm6lYi
h5crwHK7ERWIVWq32InoC7FAf0us4OXWYLlPEG0SB1S1bIdooyhVn0kfovWiSlVKjegR2V69JPsg
2iDKVJW0EL0hO6itsi+iVbKd2il7I3pP1Klyia1UxbKTqpH9ES2S6VhiBKJ3ZIL6SKYimiBnqnmS
Ht/TMlO9JWcg+o1so1bLf0OUI/uoAjkM0RbZVtXJXoiekl3UMjkQ0Tw5QuXK6YjGygnqMTkP0cNy
qnpRLkQ0VK5XWbIS0U/l4+o5mcf5spDv14gWyClqhZyPaIp8VM2Xv0U0Xd6vsuUvEWXLiSpf/hzR
SjlZ7ZC/QDRLZquXZT6im+QarEXP1QhZgrU+R5Qhi9UkWYPoVlmkHpBlvNxWLLcf0e2yTP3Epufq
x3KZelaWIBotl+PZ3I5onMxTsyV+69QYuQn9VCPqKferoXYbRDcgy2TOcrfcrh6VXyEaJj9RU20/
91GpptgK0ZW2UKPszogutJPUNfbliC6x26vBNr1at8kN6Bu/7aqdnaZ62zci+p6dojLtaxFdZieo
ITa9HuNllZpj0yt9paxDPnoF75O16ik7AdHFdqIaZPdD1N7uo/rYw3jdXlj3NkTXod8fcr+97VR1
u31D1DeT/c88c/2n8DcGEmexxK6QeD1LrA5siHdZ4hOQuIQkujdA4mSWWBYa4los8U5IfIgkmrDV
z6STRNPOGm56s8T3ILGcJVZa04xiiVsgsY4lLoDEFSzxCUhcwhJXQ+IuljgNEhexxPGQOIclXgmJ
o1jiUEjMYondIDGDJGLeGMyDRN0DEm8libqTmK37s8T+kDiSJOoEkatTSaLuDYm3s8QdkHiQJML4
KhiHRH0OJHYniVpC4gUsMQcSC1hiqSjVPpb4NiRuY4lLIXELS9wnynQ8S1wNibtY4jxIzGWJqyFx
F0ucBYkvs8QxkDiLJf4eEt9niaMg8WGW2A8Sh7PEbEjMZ4l3QuJDLPERSHyJJf4GElezxCGQ+CBL
/CkkPscSb4fEn5BE5xAkdmCJ3SHxZpbYExKHssTvQWImS+wOiTezxAGQOJol9oDEW1liW0jsxRJT
IPFalnghJF5DEp1ySBQk0dkDiZIkot8i9EsSO8BQXzLkVEKiYontILE3S5SQeAFL7AuJd7BEBxJT
SKJzABLbscRvIculnKUBEpNIorMbEgMk0amCRE0SnU22cKpJorPFTnLqSISzzm7vVLDEMCSmk0Rn
uZ3mbCeJzgI7xVlBEp0iO8EpI4lOiaxyPieJyFyHzHgFnZWy1tlBEp137UTnzyTRWWL3cYpJovMf
di/nVZLovIR+i7jfXDvV2RgtMd2/egb+NmbEXwOJ41hiX0i8gyTGt4fEPixxLSTuZYlPQ+JbJNHt
D4kjWeKeUIUrWeJaSNzLEt+AxK0k0TxpLTZLSaLJhsR8kmietnLMWyTR/MzaZV4gieZHVrl5hiSa
GVadeZ4kmtGis3mEJJofiK7mRyTRZIoBZgZJNIPEMDORJJpbxEBzP0k0V4gx5i6SiOg+RJBo8FfQ
XEkSTRcxzgwkiSZJ5JrLSaLpKGZi2RwaPUSB6U0STSuxynQjiSZVLDA3kERkWYMs+O0yCeKASSWJ
RotS04UkYl4V5uH10ftkexNPEs25osxcRhL1V7KDaUsSdYNsZ5JIItaowxq0lUJ2Mp1Joq6W6cYl
iVguAcul0kgmZ+pykqh3yEx9kCQav2xjzieJer/sY9qQRH1AtjXtSKL+XHYx55BEvVeOMDZJRDQB
ESTqPXKqkSRRr5TrkRMS9Qfycf0lSdQ7ZZb+G0nEPVPQ23waN+Wjuo4k6k/l/SZIEnWlnGgUSdT1
crI5jyTqrTIbjwcS9Sq5BpnwXOk3ZQmyQ6JeIot1MUnUr8oivZ4k6t/KrfqPZEgvlmV6HUnUeXKZ
3kwSseXLseWQqItkni4jiTpfbtKlJBHr7td/JIn6RWQp5CzL5Xa9nSSi30/0ByRRL5SVeiVJ1Lm2
0BtJol5oJ2EeROhf2O3170miLpAb9G6SqH9mp+kXSKJ+3k7Ra0iiXmAn6BUkUb8uq/QmkogtqtPF
JFGvkLX6Y5KoF9uJ2I5+tC9o99HLSaJ+2e6l3yOJOgf9FnC/z9ip+p1oiU/EffeFcgiLfwwSX2GJ
EyHx5yzxFki8nyTGXxK8Kn4wSYxXwbz4i1jiCkj8mCS6T0LiUpLojrD6udNJojvQGu7eQxLdf7UW
uwNIovt9a5p7N0l0L7Zy3EEk0bWtXW4ySXR9VrkbJomusOrczixxJyT+jSXuFl3dAEssgsQylvgH
SPyUJa6DxAqWWASJZSxxFSTuZInrILGCJW6FxP0scREkrmKJhZD43yzxKUhcxhKfh8Q1LHERJK5i
iT+GxGdZ4l2QOJMlToXEhSzxXkh8kiSaeyBxLkscD4lzSKK5DhJ/SBJNBiROYonjIXEOS+wFibeR
RHMFJN5FEs1QSMwiifA401xOEs0lMtMMZomjIPFhkmgGQOJokmiuh8QJJBF9dEEfkGiSIfFqkogs
E5AFEqFwqrmAJe6R63GrkseCxzEW5NHYIrMwtkCi+Rc5xfQgieZc+ShGFEg034bE75JE0xoS01ji
IUjswBJrZLZpxRIr5Ro4JYmfyBKMGySxVhabBJZ4QBZhzCCJ5XIr+iZDf4LEL1hivVwG2SU8Li3H
uLSdozxEm3nM2IQxgyRuhsR9LLESWRRn2QCJVSzxfUisZYkfQeJfWeKbkPgBS8yFiI0s4h1I/Igl
fgiJf2GJSyFxC0t8DhLfZYnvQuKf7caRsUqXs8R1kFjBEt+ExA+aSfwVJL7JEudC4mss8UX0W8j9
Pg2Jb0VJpOo6R9eGCcc/YYWdsVb4uPV1lgaG4P1gD1+a87vAYP2l1a+pvg7dU25d7Avr8sCdHJ3v
LMe/zd6XOnsCheqioB2jDs4aX0v1dVKCd9jhQeGBmRNHhaNq2xzew1ZjkfO1mDlXNsuZMsMO3xRJ
1pTr8D6CqggU6q4xc73fQq5B4cEjR2dOPJLr8CinxyPX6zFz7TgmVxweF+cKN//0JEalmOB5gbed
VvGvxK4U080X87+RviH+K/xf+E6hUkxT/5HfoeA9wVq7OFhLkVtiF7slvo7BLHchVTwJZgVrT1jx
hD7haSXqdQ1NvuTgs8Hs6LovofWNuULrTyJXcugzrB1V90UkNq4tEk9mbZGOtaPqvsjJjWvLySez
tpyPtaPqvtiFjWvbhSeztl2OtU9Q98U/xBej7os9y79HXfXv944cN/FuvmxP9CsVqfQSyGus9IJ2
rgwF6uPeCD4co9KLd5701zmzwztP+sw8T9q7ZI93yR6fd8mes/iSPQGvKJBXFMg7I8s7I8s7I8ur
m+KdBt7Cz2l+uqxXbOEMO/n8rC628A8dgOqPPwD5aeCkX/7I+PNQaWT8aRp38k+Dccf7+on39ZOz
9Osn3lXwzsIbZ85V8MRXgY8OXwUv6pP/Y66CJ94IFMtQMNW7Ct4h7yp43lXwWjrKtjjWUTaru/+X
8ReGw3Qcma+tQGdlt3CkLXhj45E2tHODmYF6EftIW7O32N41FRq8ayo0eNdU8K6p4F1TwTt8coYc
PvEKQf4/vnv3CkF6hSC9E5y+gc9bz8ITnI56Z+EVVZjuFVXIPxuKKhzZ8fAKQXqFIE/155urAtm4
65PP75R5l4hPfDx4uIAfveWJ7EVNjxywPnr/6kDj7hgfUmnaQYuvj9p1kwdb2I87ag8vKT9y47gg
pjeLIzi+gcNMxz/mxDdKo9kcc5zpJA47H7WH3xA5cH/kbcHh486SPqCO+hNFb9SOjICneKQ52HTG
7t+lqL939s1ZdvaNV/fVq/t6etd9/af68Q69nMaHXlqoK2VvC9ba29wSXzg4KlgbHMXfOhylP6Sa
TXY2ty1/32581LcOk+My9ORQWo9u3Y70gCzOfY1ZuD1+FmRw3FBa92YZ7ITGDNyeMIN8NZSW1iyD
9XpjBm5PmMG6OoQE3Y45rnl0vSnfg03bPglrfW7vC/1gdOa9xz67/E3hhgY+7il9rfB/R3t+KD6x
wtcp6Q++Tom/Q/ufmOYg/jXaQrR033q0iWj3oP0T2gOY/oL448Y4cR/aGrQa7Wdov0Rbi+lcxJvR
JqHdgjaI9ttoy9BuQ9smkmcn2gsi8/xoO6DFvMRKtB0xLUGMXEmXof0U7Xlo96PdEemLprWIL0Lb
Ci36SaqLPB6B9hDaXZgqIusF0NqN6/HtTmgPoqV5/4O4LPLYD0S276+R7apu3IaknojfjuROQNs2
sj499lK0lZH4HH4c0d/BjrwC+Va6H8/9ayF/EM9d01QTFUem0HHuiznFynOiHCdxf9PjqT6FfJQn
1vr4fcCYctJT6Gss6+U5rfM0Osk+7R6Xl8fL84/K838ycQZtn5fHy/N185yyidN8+7w8Xp6vOx1j
4jR5XF6ev1+eY95HHl3zyy4MbQtmhbYdr+aX9V92tWzrXudLswrsctnRvelwzS++p7Xb3xeWre0v
OTrf2oJ/D79bbfy8ICy+E9cW01cxPon40Hd0HaxkcaOTaIcjBYyi6n1FPoUIiyXItyRWvoBoli9l
butjS2mfZH2t6f69oUmBDL4n8nwEH/PXhMYGrm2698YWHsfbuHFp0ycs+XgWanxjeUoOpfv3+jNb
6H+uL83J8K1V6f6efKubM9RXrHr6L22a3zdGT70iPVEvk3hKVq18a/13xeilZ9zVKjluSaSX9LgM
FY57JWp+y710j+olsi1OfdzV/pEtPpcN/wtvLsDcMFQc8DgwAABoVBt6zmHXwIYL53nfh2BtYkPD
uc2oppo3uAkql0Ud7/DlAAAAAAAAAAAAACICAADXAgAAuM5pAATijAD2LwAAAP54nOxcD7BcVXk/
d+/m3X375573SN7DUt7bzcM/L0bwJSQ2IrJQnglOqIZS2vpnHB6YkNAAaQQlo82u03FAGmewZRQd
auOIY6YKQqAZbOu4Vi1WoaAwIG0dtyCCqcAOkrz7du/e29/3fefu3n1/djc0gnR4eeed3/fde/5+
f86593w3T9YUfhKPJibUcCLMqjAAdbYka4va/5rU8B10h/qi+qDa9s5NfzilLFDvB7Xs/Jk9V11z
9XrVx08CKYVkfXPs4L6ed+9X+ziNo610qxdrh55OHDixqg8s0hd70+6ZXdvf2qUDY+qihG8dedF9
QU9a7Tson1KF4TOTm0f3JzcTch8e3e8+rCaGz3Nv2aAoT27eQLP2GTVAnbQIf16lwsdBnMP13qze
pAaVPbBp65VbPzyjlI1/ObVFnaaSSoVKDQ14OUVJTQ5fbt9mrzttPUp9DumzauKEN0o7J7yxj3be
+DgKT6l26eVZKb0821/p09F0rPSzpvSz/ZaOt73iQSm94sH+Sq/taHvkoJQeOdhv6XjbozdJ6dGb
+iu9Jt62udtyW3c/gpIfN3dDP1o6k1O71OSKFdb39IVbr/zQjqt3fHjH1XsKk5tXdWjRzeoEutm2
1Y0m33fCdluN/JkNbUs8p7r8puZUQodeXaXrSjlBqGoNlQIsNcOGSjfA88HzGRYBA1+lGqoeqnJT
pX1cBqwJzAP6TZUCLM2F4DUxKC9UlUANAdpBmKjSX1Vlhq3D0AuizG2qRDEMfZUohYGQpRDtJpww
FDIMyw2VDMOKUm6gEnbo11UyH1aFdMIaSPzFnAU0pPKcskNPqWygrGLgKbsYCFHyPGpUiLAGwgnL
KgdLscIKKPxVWVB2WJ5Fq1WVsWlmjqJ/NcE+cN5gD1gbXAW2Da4AWzWVJlw+ogAH4S2cF5S1i9EA
0BSjJNBQNxHhVmU1ObMlcyTTkuUx1RhbAYMtCpzySIAMNwBCFhnAM+eUZRl8FrBtcBFYA/NMlevK
ykdEFUQxIjC/VikwBBTGCiHsHBF+A2MNPUMFDRJOzVDQIsim2mQh5cOyT7KpCAngM5PvJRH6aAI6
kGP5eqBC6Bvdyo3RX1xsErvJjQhVQhepEZ/1BPVFdRMJELWc49tqpls5rsIjjQiEQvWkEhhO1lcD
tH5hVEKUoC8oKgQqUzqsCoH6VT6sNFTGV8tI/4phnTFpXykQjEoV6WuaNDiw2N4AS6FNakuwGF4X
VgXq8IGwUhfjg7VAIrA4Mpw5Ndgg/QyDObJRWIQnAJYioBhWBaBXAhwyBKdO0vY4t2ALA3NK+ZJd
Kxk0JkWqMIupPO6guwda+Nu2ik5LEeuJmVTc0hZYYNwy4xZrLLnDxOdZf9wxLHAZLWfS6WfmOaH5
LmqeA1vo3mLOb4FzXOA+Y6617W7bLjjmmNvOuu3AY2697epj7j9aEo5Vbi/Z7wAGUDjK2ZmSFY8q
pwHZVGYl90wezNIMYHIhWwG1CMAAyJwww2UxLDuMrAeiEJAPyejqpAlknTQzIc0MgWII4x6c42sw
f0IwTZo/j+UIlifV+4yoekz4LF30BeRJ5oOzUj1kdZSrF1AkHzd4VKoPGFH1LQRXhdtIZlAHgDz0
A5pFsAQIFUzP0oIRJqAMGUwHejJLPo0wlK2CjtEtQZiEy4LSY15s6g88GxPoHPTNECW6W0GxczJM
aGmi6DHlsIom8j5TVIrsAlo2h7rJ4+JCnYdPLtwOmEJnam2KukP+NyA1DMgOrFDlGlK3UNmG1A2h
ClFkcwKRaRhZtLAXwxXGadIFiDKCfhvW2rDCEKqgzvIitIGRUbiFmugcIY8q6zAtp1yN3x/GCp01
2CphzTp+RNiVyDHB613rUlO2Ay3CiRP5OEFqSe5Hz8GXtKG/KPTasNaG1TZEjSmBvvDIgbUhutxh
1sch79PFYGNk5z1VrMsm6SXDffm+KXF6ZxmnVzajq5ncj5xeOfJ11ZjTIwBLEu/nxHyeF+0h2j4P
1kPIWuj0dN9OrxZzeuTr0DaWI0J2zOv5AnBRgEOArCvKiybXMZputDpKiOcEGDjK3gctk4tsRi37
gkrcctrjZZVWR9NrX3pd4l7DgSmLLvvRiAMZcZFHTCsmXaZpkNkKZLaKMlvkyVRFNm9OtHnL8zQP
iv+imWephPPEExMYRBjJtEPGkLlRAaMQr0RdftWN/r92o7/leuccJUH6KlNXy1x6GKgJ3otJI09A
GPsl3qRB2I5FzzPsvIjC1kWVeN9ClCNUlSlbgwpYVoYiP+EJlRfKl3J5ftQoGQo7Kjus5AND1egB
xYmoagdVweOoIl2LKKpIqNIiFFmMCy9dwpMr2Q80dmmy1Cbz80jvGEj0v1+yokrVNllclDQ2R4Ol
J6qwNS30QBVRNXp+i4ae76R8zB/8vVA6wKObMtOpdBDatIUWymEqNELhJ7QWZQslwnRoH07bYhh2
XQ2QH28RJXoKJIUggp8BSVdIpzRvpVm/4PRIVXw1cETR41g/aotlWJV8Wtvoka1hQDECJQYYhVU3
wI6AswDoCOQNwAJckxUnH7YfoToeqUxeMitRqbpEXjm2vOVcqp15PspNezrKTT8cszLapp92KLsf
i5fOujzWU16sSZ6nRZZfkcj6Kz7juIP+Fz/aV1n8xmeO3gNVrKr4HihXxfIE017Mgp6IMgGTGyKi
yIRoFtQWWHwQORmixAfRNmch5UUK7hUrVqTgOqzAwootSoHSQWRCil2NoTyi7La3KraNTaiYkcap
SkQZ2ycq5go6yPJLS4ad3Yj5nAUDsDoG10nZLQ/UQXnx6dN+fGqxSIDKt3yOignBYZFE4sI6VazY
bQ/kFyuaBGsUQHa2dfYRtC8gSO99yuIe8j5tEer08ljeBdX5JYHyBFpNeds/x28RaONA7iYfhLLz
hffz0KhH7qHr+yFnliyzwTv/Ir2KHfTkSYHfwtKba34hAIVu8g6OPDC/r6U5pvaov7Rw0ryqYsBD
IZp2VNy1qrxgJropS20gDwdNXmqHAupjQFYU2KTbLQa/lzWMojCq7PqZ4QVkbCIXZtQC8djUEDFK
VWYoliozKmDkQ8UqMGwYA3l+ewz1YU6ZX5MHbU64BMczd7c4pYgzJIs4/K5pImLIC+04o2oYw8Tg
l+f9cCrzOPYinPI8jtPiDAmH5dHB0DHGMlr5OhgwO577hYxSjEGG0GZUIka5zSh5MUaxKit0m1FT
7Pt4SplBG604A56NTynajBAbv6pRwCEWeaXEM0Jypw0eGVDZjBi6p5wmDYztOWCbolGJFvGOL5A3
wk3SctoORiTZQonf7CXYqok2b9G4j1reBpcj2uVHDjkAod2nT0rKFEyG9rSoVXLf5NXFNhbt08j9
6lN8Ll0YPZDcPHrAfVgVhtclNw+v41Poddnn1AY1MbqL88XPOS83J5d05jx5YiH7yeTat0zFT0uH
16U/L7Vw3r0W1JBel1y7bl4NqXdIDZz3rMH5WXLt2nk1LKtJDZz3rGHZDUlUMLXg1DZW4hEQH2mN
fRdK3TT42uR7ts7sXji7+/HvpBsH3/qlX2xTjhrCv8KKF5LvG55O/jmufJGvF0CVRy5IflatXPGh
5D+oU8ZWA61I1tQp4y7SQ0jfR6riyu8jfwrpF0j3IV2G9EXw08gPI2WQjiANIY2Af6Ip/yjSuLmG
e8f+G/k9SK9DSiANI02AfzfynyGtNPffjnQu+DVpf/x3kDYh/RTpe0hn4Brd7yB9F2kZUgoJ9Y+t
QL4GqYn0n0iPIc2BT/UGpo0G0r2SjxFvrbm3Jv0fV+BT31+P9GskS+oYt8FPmXp+jvRaU241+P+O
fJWp41mkkHOZ7ZhUQjjvbdvUxMg7ku/HPStHT0rerFaO7EoeMnX+k7Q5hvkdLyB9BelsMz7M/RjV
/a9I+yCt6QHMxDhkN44ZH5tETr24A2mjGeX94JNUnkT6F6Q9fO/KE77p/JdaufxWZw61nJ4izrOp
9eDsTV2IO76DdBFKPo78YaQ3Iz2N9JzRh42mX2NIO5C+KfpA8zL2lJHtO41enIB0F/jvNr2gXt1i
6joHfKrjNiPj84x+kbxsI4tfmbF/AykHPunmD5EOordvyP0xev7p3NWgl+PaM8gvNnNP+vdtI0uU
Y53GPeP/uFAmE/zTio85b1l+9KZl+Y77TjIxEg7/nVr+vPP86E36iFq7/LBzePQW+E0pLVf26Wfg
4fY5dUYrl9fxN5J8ZI/npF6DdGgRS/8FiElj6VG77O1WXJV62C4UCl28xGPk/1txOinnR8vO2b1j
ZqeynR+x11i1Zfm23VddUdh65dbdl+0pXDKzc+bKS7d28zvkqT4WeaoVT6TSqYL56VbqlyAmYvFC
Jw5cuOeKS67aSfFCJ6pVnjXdq80bTGnq+arpgQsKb+8+cmpxfMkW0fP0e62dXco/GSsvs/Uutfrt
q61NPfqp4z4ZrTxk9eplNC88E/neMzHRMRPWH3W7Pz4KHsF09xG8AOLU+Iq64onMIbuwutsY5o96
1fusvnWh3zGXOsbsbJyvcdHqVhi5IPW7SI8uUc8X5tnR5MhHU55TKLAR9KlNrD8jH02v/83rD1q5
/ZWtPyMfzXzahq0em/5s69WnkXif8qut83v0KdPZp+xbus7qgh6N9tbo8U4p7Ox3BHHd6DaKRXQj
+/L7lg45TPeWw0SnHHJfThRW9+pThySme+tGh75CN959bLrhTr/surGY3+g2ikV0w33+ZdeN+X6j
lxxG43IY3ZBKJ7rvKahPt8Yl8Sbnmg/tuPKy3juRDk8+umGw1NOTvxhr/WpcImjlqUEsWetOm+p/
32L6l3n7i1ppemiMtayzf5lD6ULh1DXo3+SfXNFLthMx2U6OBLlK4tS1vWS1Kdbe6necYb9586pW
CdlXR2lfZ8R8OjU4OfT08PVqqYj5NWvVUj/WOdbrEmOJNer/EDHfat88EaTPT8/oA+kZQkN36wND
d6uJ9Pahj1FMdnp7embJmOyTWnKVGPmhgWrqYkpqMn1Desha15qPicydUl/mzj7qm8w8hNKnt0tn
61I6W++ndO5klF7bLu2eK6Xdc/sp7W5F6TXt0nqflNb7+imtb0fpqfma0xmdrppqiej03CWpb6c2
7rzmWtHZuKxMXLpVl7h05Puybxu81l2fTi4dl95xvqU7zrcG6io6Y+lyuqW7nW5Vvc5TLb/PU61j
PcWqvMhTLP8YT7EcE78zb6b6PQlceq7ak1ZcatJKx2nSeh4B1uZNnmlXm344fR/9BfFJe1mP/gYo
TP/XnBV/zef1Re8FCpmmmJ8jBnhH1GAg4ZFHI+Qf5bh+PhKZbcHAwGaoIKy0vI5WGC6FgDB3jiNE
bD+c4/Bg4tXqHD0MnkSb5+noRL76sHyOe6IjobycDsEszYHSnLz79mGPnmJD9Zgj0ValjrCrVjxW
FMrVCtmKBWhpAgOziqqgmCxH4iMIloJWm8QN2kdTVXN2RVwJxqJ5qDZE0ZtmSMQzw7SaZuh0ulST
6QBPpoh4nkc8eqsvM6iJ157i8mxMBG2xiKRqR0SGYSTDakt05dbd3tF4ZRGEUqfkOEF4lpGh6ZWR
oS0yZNHR9AgkIZtPBWhOPPPVAI2BP+Nptr7n0VGQd+yEL9+eUa5eprwos09CdRYIVQdxGbbD7mb5
jENAPjA6wWcgKf4shcAcq5oIsygKxFHn7XPKkjmINPHpZf7WyGelJAlqUlQAX2TaZM6cTJov0xOI
vgbefHOIG4mYztLC9I60DTGyTGOoxmz7sfBXv2J49SuGLv5fPuqiQRTYYTGcavDZOMEz2SEzPKvB
Z+Qc8ViW6MeF4YZ0eKkjwouHG/rmEykm+IA4jII7yqQ9YRRlUKVvnIJWlAGFvnkmsoncTiuyiU52
6ehRglHKFsfESWRTxaEvtgjbYbUVRWeFXtFE1CaxtaN4AHYCiwXXQpX8VrCBCSzmuH8Ta1xuXTSo
HYmc5wKEShynkKIvEJTPapFEAfrqS7rp6yjwD0PkL8cIl8KqFQUBkoJzfEJDDdh0TFAKfDNNHBNo
ogDzZDQ6igIs0qTZJsrGoa8qVBRlQ96EbNA3cuAz77iEWrKrzY8b5W/2YrKPqcQ8RYmpj1Eqo2a9
Y5B+Y5shigDh7/boKFoHfvuImnYEFdkZlKomqLsmed7k2pPc8SW3ozxotmKGOQ/buYkhJjdLU36s
eeqIiejtABz6wC2blpxwXjh6EC2HgfFSDQnsNdBvQ29RWGvDahuWzUw2wvYnuJ4vPJ++rTxGt5PC
AmQdJbEcb9B/H3hJrb7QM5dPUDn8Ze5V4receOm/Hu3yvoLebkwu+r7iXWoyu2bwPfymrPNNhct3
XKC2m3wmc3hwS/Ztg3cqK4ENX+cvHnzIojMUUwZrjTCF8xDO8kYsFCK3jJZV8h8RpfmLvoiSWJ8Y
VWtTxRpFhLWoivbbVKlsBzGKPimIUSqiBpXaSze3KJrXSoui7VY1TukOyql1UF6csjsoyxcK/gCd
tIMOKuyg0BlDBbTzrkTUXorhr8Yp7HwNVSLKi9orlmmf16IqvAk2FEWhW1jSQVFMN8VZ8Xc/RGmP
9/WGcvi7xYiyPd4JG8pqxWfRJ/IbmrJ0O/SpPH3GuEAj4r/ygU7jFZu3BtLNxg7j6vCiNrZFTWae
G/y2tWpRCzvFWNgp6oOZewdvhpX5i1mYmUbeFfqytfOjR3bzYUuz9QlMUWI+cdmXRZcC8BocnofH
G/rylcyxKhRvyxx6IMmaDRn+BObhSXbReJaR56om7Ruha1l+/GpAdStC6FqDdZWJYrXByslEqUyf
EtM3t9DakD6eQ2fSpPl4INkr0AM8S2ANcFwgnl8TrsAK4IBA+NYEsnlzs0j0nr4jPaPvGLpbFdLT
6Zn0NL8Rnx5KUcybvpbz7v9LyeTQpP4h/xcrrffI6Wk9pk5G+ZskT0+7a6Q+znvWl3uB/9uUWH25
jVKf5Onp7PukPs571pcdt9d01pfZJfVJjpF/QurjvGd96fPsqdMWvPnujPCzp1XszCRx69imnVdd
MrOzcPXWK3Zt3T1z9TW7txYu3T5z5WVb+f9lmS8XjjFSFKWUxL8t+rL0Pfq69E+AXp9+VG9Mz6ot
7i8zb9KDmfOBbs58yb0n8x2g7dmMe312NdD67Nfdi7IPAK3Kne2+M3ex2pL7Ve5v3GzuLvBGcgfd
9bkfA+VyvnuqezLQxtyP3W2554HOyx1xt7sjQFvcNe4u9wKgGXeD+3H3T4HOdafdS90PAp3ofsT9
PfezQH/p7nW/5H4B6APuZ4APAZXdr7n73fuA/s69xf2W+8/MOwTeI3zfd3Hfz6n37mPuPe4c0I3I
73AxSvcvXN/9W029+rT7Y/dOl3p1vR52D+g1QNfqnHuzPhXoHvew+xOdBvo3PeT+Uk8BvUGf527S
24Hu0qe6D+k/wKyN6jP0W/R7wXuP3uHu0Z8E+nt9uvsDfSHQJ/Tl7pf1DUD36+3uM/p6vno2rmLW
3L/Wu9yD+kag+/Sn3F/p24AO6Q+4j+i9QN/R97tP6GeAfqhvc/9H3w/0oL7Yreky0F/p692v6gM0
B/oy91v6OqCf6j1uU38O6Af6a+5hTTP0Ff0N9179GNDX9b3uA/opoMrQiFsdWg/0ff0f7tP/y96Z
gFdRZHv8Lumupruqu6PjyLDluiEiIjAMOmxxQd5TI6Cj4i5oQGUERURRGRNRcXmouI0K6IS4osOg
yJMRFAMDKgMiCioiQsRHkJeIIYhmICbzP6f73ts3JBA/F4Rpv0idc++tqu7q+tXSdeqUsx3SKucf
drXzOaQPnHn2NmctpDJnhaM7WyHNdubbHzmfQVqH9Oo4vaXO67jmTyF94pTbO1wL0hzXsle7R3Ie
rZFHL0hfui0c5XaHtN11nBbu0ZQvvv2Cv13vdnRibj+UpObUOoe5begK3Cx7m3sopHed7fZXbgu6
Pre5Xe0eC6nG7eW0ci+EtMVt5WS7PTmPQ5FHH0hvuUfaG91TOZWuSOVMqs9uf6eZexVdqXs5rpSe
wituvv2hexvyzXF/7eS63ajU3Bvt/3cnQapyr3H2cx+AtMY9FznegN/F3W7OIe7Z+Kza7eE0d8+H
tNbtYdey9JY7FPmOpxJyb7Pr3KcgfeWOcxy3GNJm9zLHdukZfeve6ByIPFI8ZvN/kdOtmDnS6mJO
jZwbCVoeTo08hXlkJGWBGOzb/LVHq4V5lzpLVqAPi0QOciY6A1gqijyJ2LMiGH/FXDfCn1EPeJo5
jNvlgymeIRD+3nyew3PMJRxeb1Zw+LClDAPhLKsjhyus/hxWWVfT9zLbup/DTtZMDvtZK+h7Odz6
msMJ8gAOX5Dd+Pt/yoEcbpJjKFRCPkbfq7ZyDocnyU84zJc1/P2tqjWHxao3hyXqYv5+nSrksFZN
pc/t1moBhz3U5/S5fZ6dxeEN9mH8+aN2Xw5n25dx+IF9J3//tT2NQmd/+5/0udPFLufwdEdyeJVz
FH9/r9MPfR6VX7A8PdvP/814WsERRsKZoEabl6vRkV1YiZoPyZ7y0eyiSBdzguwqi7KTPti8byZm
PxpJyImyD0sHmVPwb70W3Fwsp1lKftlAb7EG8jGR+laigzAekuoEleBF0utGcc+R6ifS9XE40n2p
sXQj39RLt/1Txm87dj2mc2Lg8F30XxsjEb9uUv91Iq7kaufoDDuBTEvbg+WBcogR4XC8Hz7rh2/7
4SYvVKbR0MoyWSaUN1QGsqc6wUqMuvKqq4ckhl51za7sLz6Bclig10Vc5zeB1fEm2NKc8uPb0hyR
uiK2pYl1GbO7HKZm3oPbSyQSXTp2S5zaVJuLyCr3i2bHNm5z0TnS2H/R4yMtY62jh0d+kM2Fn3/C
PDPW13ku1pckI995zsgnKwujg2dtEevbZGuLdubd0W3RgPdBtGycinV1E1JpZz2A2AELDbRrHFuO
aUpsOQmxAxYaaNU4tipsSmxVjNhBC407vdj2nU2JbT+P2EELjYlebGdiU2I7MxF7NxYasdcjjVlo
HFq7qfkZQy674qoR/rg1OGDNeNK+xYZ2k2exgXCC2TM6yJkdrdidJ8FY6EwwdCYYOhMMnQmGzgTD
Zfi9ZRm+fu8V+mEI/TDsS34Ygn+mtyRPb8WTYq0v/ouag5RYnRbRMpEXxNzqumhaKkxJJSmpNCVV
RmwghOpLJiRAn9VcMiCpYbc3pJI/H/JKlOOp9Io9Sv0gP3QeV2h1VKVZpZpNe/qjdaySLYCWQ851
WCUTAc1Jq3gCmmBHRPYOb3VOi9fspOaySuYVWrSeyutjGWpOCfn6KkCnn5Wp1f14ms12sJThblXv
6gr4VlJqLqu1qVvhYkir1b7qFwMVoZMuFSpg8vTkFSGN2LRcGi9FnB3cK5HnBvKYQLpF/kHJyIUe
IOmCjINQ81E7WY9zS0imNGw9E4nuqMuiZo3qNcRCtHfUYhIXWdQ1kgdQWsHRqKMsZQ1MaOR3s4Q1
Aa2S64fyyNAI8wi5G22Wy+6Y6BGShtYZFSFayiuV0dymoxH6VNrHfCoF5jcF3jOMJh9mTsZT/R5b
CqhNdNJWPTmepQ4ZiKHmFxQ6vps4NE0FhdGkgRjaLfJuVhLslXJKg/2XkzQX455P+Br1gxihVWdo
fj9UwGv20QwtUpvWKutrBSnNydSq62u5/mDA15K9MA3xGlVx4fVUrx1qWC1ha4CAb7doQKXbAufJ
3j+nkhuBZO9Pl0TtSqqnjtRVJvt0sl4sqHGCWl3alrGUHPfVJntq1mrSmucXlE0bS8k4wzd6RImL
uqTRYw6530u6cxN0mUmjR2puCnyXK05103y4hU3Oj9zk7GmzNvLlFyejHs98NOqwgY8nk2sjGvjI
7Z4To+ScwXO55NuO+g6Y/FmD73zJnydgXsdadUOa42m+XSm7TqJ/WCEzYJFUyK40XhuwFiaQMpTG
XK1Kfr4BH6g0bEm5Sv3ZlIwrSCr1r7PhO0sZ1ibNpTOLJkOp8b04keL5qqpJlnTSgjdlLh1NTwa8
QVDKSSRarTrfpDPqdRQGDX9SOx3SM4Hc4EygxhNF5kyg1Bv+5yaH/yI1/P8eY5yf5y95UenLTF15
8m5K0vdYmXHnGaWRLiG/1NIlmVnE/tSZir+6gUcTeGwpQHIbetYZtSCjsmQqyTql/EF4bOdK+XMB
k7IKL8j0h1wf5JygjMoUSd4y30uyrvNd+sUkqoMKFRN9Iv3ZGP+WlCjzURpozgr8fQEFlRGvoWMj
e95NVeMb35eyYT0P6r5F3/+jC9+3yoYbTr9PfxtuON07N5wGq3v4mjN8zbmvveYMjxDYF48Q+Pn/
9vhUMha+vQrfXoVvr/6T3l7t6YHhLibtENJT9nh6yh54Q5Hjde27nL17lZWqvz9gFFFvH3VqOh/Y
Ob3T+y6ewPvzT4ffcPkzU4cn8DUNvcbJeN3V4AS+0Xdfe2Qu/xO/7woWR0ZBZRRhqnAzy32nZ5L5
vOo9y/Rz3u0rr5z0qDBQofxqlqp6P/zd1y/8JKLgX7hKH67Sh6v0Ow83wncW4TuLfeSdRWB651td
56Yme0FvJjz1r6H+usbjXdWw4advpewfolNZ63vj8g8Kqan1nXKRnusd1Zvj63TFGppxPlxYkbMz
jZ4ZHzviuR7TkjMFxzvERKPegbK0PT2rmiLX0NcAuZoWXgrIuJp0sl6uq/FO+fF01Jgawf5+EN2g
JHNqkdwOVqktE7U5ZCLNKnkMq80lu+ikGq0rIGNo2rWdU+mp2z1L8Ere1V/ra6W1/rnMKa2AjGcD
WomvlbBWuN0zvuUFi9p/pRU6GDitVAeVyqBSGlRK9iJlD7jpaGineqyv86KRT75bY33NPN5NlCde
93Zuc7jrndu8k8htJwrr7VbP05d5u8G90MzT1nlpcrjb3eBacb3d6nlZlV56Xgg96qXH4W7Tiy+s
t1s9L76flx6Hu99t3s5dGjvg++43L2xO7g5S+807xc52BsSug9Q9dp1zXuzPtDc6ttT+MlYB6Zp4
X/uB+NDIAPVdfIbdOv4upMKsgaoo63pIetYm1VZrFhkgl2m95WbtIkgl2kWyVLsZ0iRtmpyjLYZU
rN0sF2hPQLpHK5bTtQWQrtDWybu0OkhjtTI5RdchddCqZJ6+H6Tf6W3lWXpfSF31o+SZ+mksnQRp
CCRTv0C218dCOkbPkwP1KyMDrO/0obK1Ph7SVv1aub/+EKRV+l1WtT4Nv8vSr5CH6nfhs3X6dKtO
fwdSpT5Ounox/24Bfrce0gJ9nrVeXwtpmz5ZHqDP5d/Nx+8+g7RM32FtFi0hvaOXWl+KCKQleoVV
LiSk20Ur62nRE9JSfYNVITRIL4vW1grRC9I80dJaK3pAelOvssoE7tJaLg6xKsWJkJ4Qx+EXgyC9
KrKtj0VnSMPFOOseQdf3iBhszRa3QPqL2N96Q/wWUrHoaS0QF0B6X7SwqkR3SA+JDtYskQfpHjHI
mi4KIV0uhlt3insg3SbGWk+JKZDOEUusMaIc0p/EfdbjYganNwbpPQppshhlzRUPQhol7rAeFM9C
KhSjrSLxMKQiMcIqEfdCek2MtNaI+yGNF0XWM6IE0h/EfMSishokViLW15AGiOXW1aIS0tlikXWd
2MC/W4HfbYV0vthg3WRQWd0oZlmTxEpIQ8QclOZqSFeIGdZdArXOGiqWIZ/NkI4VW61zjP0hnY5U
RnIql4nV1h1iO6QLxGfWWCPKeZRbowwLUh9Dt/KNtpCOMHKsk41cSEcbraz+Bj2t88RS5I3abrU0
ulg9jDMgHW+0twYbp0A6xsi2Bhr0PIaJCutug550H1GF9OgJXiu2WA8Z2ZA6Gm2sfkZvSK2MnlZP
4wKO2x1xz4N0KvL9I+fbw+hsnW+cHth/HH3ssdM+B39DQeJ4JvEokHgak7g5ttSxmcSJIPFFItE+
HSSOZBI3ZA20NSbxYpBYQCSqhNZbHUckqpbaRaoHk/gmSCxjEsu1m5XFJL4PEquYxMkgcS6TOBEk
vsgkvgES1zGJN4PEJ5jEYSDxbiaxD0jMZxLPAYljmMROIHEAkYjPhuIzkCi7gcSziUR5iH6XPJFJ
PBEkXkokymx9uuxMJMoeIPF8JnENSKwhEsH4PDAOEuWvQGJXIlEKkHg4k1gMEhcwiaV6qYwwiX8H
iauYxJkg8X0m8St9g3SYxDdA4jom8R6QOJ1JfAMkrmMSx4PEZ5jEoSBxPJP4Ekh8j0nMB4m3MYm9
QeJFTGIRSCxhEi8GiQVM4u0g8Wkm8S8g8Q0mcSBIvJ5J/BNIfJxJPB8k3kQkmt+BxNZMYleQeCaT
eCxIPIdJPB4kDmYSu4LEM5nEk0DiECaxG0g8m0lsARK7M4ntQeIpTOIRIPFkItEsA4k6kWhuBImC
SES+i5AvkdgaDPUihsxykGgxiS1BYg8mUYDEw5nEXiDxQibRBIntiURzB0hsySQegFR+x6nUgcQc
ItFcDxJjRKJZARIlkWguM3RzM5Fovm/kmFVEhLnYaGVuYhITIPE4ItGcY3QxVxOJ5mSjvTmXSDQX
GdnmBiLRXCkqzK+JRKRchZTxBM3XxBZzDZFovm60MT8lEs0XjZ7mciLR/B+ju/kCkWg+jXwXcb7T
jc7mO0ESj4u+cQv6xgHOySDxCiaxF0i8kEh0WoHEnkzi2yDxCybxEZA4m0i0TwSJlzKJG7M22YJJ
fBskfsEkvgwSVxCJ6gFtmppJJKoikFhCJKpHtGI1m0hUt2rr1JNEorpBK1OPEYnqFq1KTSUS1RC9
rbqdSFTn6kepG4hENVg/Sd1CJKp++gVqBJGoztLz1GgiUZ2gD1WXEImQroUEEhV6QdWHSFQd9CtU
HpGocvTpKpdIVAfr4/DbYmo99AWqB5GoXH2e6kQkqs76ZHU6kYhU5iMV1C6Vre9QnYlEJfVS1YFI
xGcV+AzPR34lWimHSFQH6hvUMUSi3C5aqxZEoqwTLVUOkYgYVYhBd6mLQ1RbIlFuFscpm0jE77Lx
u87UkolxsoxIlGvEYFlDJKqo2F8dRCTKraKn2p9IlDtEC9WSSJRfiw7qV0Si/EIMUgaRCGk4JJAo
N4qxShCJ8jWxBGmCRPmhuE9+QyTKtWKMrCUS8c0o5PYgtZviDllFJMrPxWgVJxJluRihLCJRVouR
qjmRKFeIIlwPSJTzxHykhLKSr4iVSB0kyhfFcrmcSJQviEVyCZEonxUr5FvEkJwmNsjFRKKcIWbJ
d4lE3Pkc3DlIlIvEDLmBSJQlYpksJRIRd6t8i0iUTyGVhZzKHLFariYSke9n8kMiUU4R5fI1IlFO
N3T5DpEopxg5+AxEyPuNVvIlIlEuEEvleiJR3mp0kU8SiXKq0V7OJxLlZCNbziUS5d9EhVxGJOKO
quRyIlHOFVvkJ0SinGa0wX30prGg0VPOIRLlM0Z3+SaRKIuR7wLO9zGjs3w1SKJ/UtQA506Q+ByT
OAIk3sskngUSRxOJztHxvk5/ItGx4jOcI5nEuSDxEyLRfgAkziQS7UFab7uQSLTztIvsK4lE+zBt
mn0SkWj/l3azfRmRaHfUiu1+RKJtaOvsdkSiHdHK7ASRaOtald2WSVwLEmuZxPX6UXaMSVwEEjcw
if8AiZ8ziYtB4iYmcRFI3MAkzgOJa5nExSBxE5O4AiRuZRKfAInzmMSFIPH/mMSHQOIsJnEqSJzP
JD4BEucxiTeCxElM4iUgcRyTOBYkTmESrwGJDxCJ6kqQOIFJHAYS7yYS1akg8Y9EohoAEq9mEoeB
xLuZxO4g8TwiUZ0AEi8hEtU5IHEMkQgex6lcIlEdLQar/kxiPki8jUhUJ4HEIUSiOg0kDicSkUcH
5AESVTuQ+N9EIlIZjlRAIigcqw5nEjeKJdDKuS24D23BDGpbxBi0LSBR/VqMUt2IRHWguAMtCkhU
vwGJvycS1X4gsQuT+B1IbM0kVooi5TKJ5WI+OCUSPxMr0W4QiVvEcpXNJO4Qi9BmEIllYgXyJoY+
AInbmMRqMQtkr+R2aQ7apdUszYD0LrcZy9BmEInvgsSvmMRypGJxKktBYgWT+B5I3MIkfgwS/8Uk
vgISP2QSp4OId5iIV0Hix0ziRyDxWyZxJkh8n0l8HCS+ziS+DhI/NbyWsUKWMYmLQeImJvEVkPhh
PRL/DBJfYRIngMS/MolPId+FnO8jIHF2gETyoVPvrEVnopYwL9cSu/SiMzM2EPPBbpEu5vOx/vIb
rXfKiw59U6Z1jCRkWexilg4y5+DfevNSc2NsoXVk3GjE2838SENedNrHLzQS/RJ5g0fkJwIebJIj
bOtypPnXRtN8rV6a7W8xEn/wE0ullRwjWJtiC+VRjab1XgNp9Uv0v3TI4BHptJKtnByGtP7WaFpr
dkqrGa6L00rUf3vSiKeYePPY303Xea5xTzGdIo3+d2lkYPSE6LbID/AUk8rfr0PxK+NbjOXxLSTZ
K43ldJJwfIw9hTyexMfEt+zW44l3Mk+1rKT/I+3ik+JFQb8vWUu8tLKWNCGtdllfInbA74vexout
t2lKbP04xA74fREjvdhiZFNiiwcRO+D3xVjoxTYWNiW2UYbYu/H7Eh0YacTvizE+utHqe9U1l9KB
XHQ4T/BJ+Z5eYjM8Ty8IJ4isWHWzl+O3NeLpJbST/j6WHaGd9N5pJx0ezBMezBMJD+bZhw/miYVO
gUKnQKFFVmiRFVpkhX5TQjPwBv5+4eayobOFvcz4fJ92trBHG6DqXTdAUWo4qfL77U9Bqd/+pNqd
kl9AuxNuPwm3n+yj20/Cs+72QWXvOetO3x77OHnWXeDN/05n3ekvx5aLrHjn8Ky778Kz7sKz7hpa
ZZvW2Cqb1jX6sHNEIkHryHy2AlllN7DSFj/DW2lDOCE+OFatN77SVm+KHZ6pUBeeqVAXnqkQnqkQ
nqkQLp/sJcsnoSPIn3H2HjqCDB1BhgZOP8H71n3QwCljZhE6VSgMnSqU7AtOFdIDj9ARZOgI8of+
/XReIL2hTwnPlHlIxIaPNUkHfjTl8UdRhf6Cdeb4aoc3HOMlldQAzakODN1ETQPjuIwRXk6Jr+wS
iMJ6sg/HT7DMtOs1J1ZKg9jstM7UhGXnjBF+nb9wn54WJNedBb2gDnRRNFFLt4A/cKU5nrLY/VGc
+ofWN/uY9U3o9zX0+/rL9vv6H/UXLr38gpdeGvArZayKbzFW2SsjiXh+fEs8n3cd5suPyGeTUcRh
w/vthgV2HbZrNkCOzOrSrVOndA5IxbzWS4XDXaeCFEw7q0vXeikY2V4KHO42BfFC1r/bOb/QpKI4
jp97vepVY6kV1SA924pkQQ1pZINAGIQVI1kv6y2b12k4lambe9tjxB6CXnqst4gIX4I9Su1B6qEx
iAZFBWPlGm32h7Vasb733qO5qfvTggxEfn5+nt+939/vnOsRvOLP6VyjoL2vKijcUEHrESDQVva7
5up+U2SoOPcYzvoiLggXJd9A+eoq/xReWVF+99QTMx7N4g1hp22WtNgfkRbbXfAB7Br8m+A4KMee
gDbwHfgMXIZ9hf9C9W0LYB7cAX4AF8GPsL3wn4J2cBLUgPvBGXAK3MV0XoGH2RgHHgAxZpsDm2Fp
+NCynwCnwX3gZ/AlyyVbFv4R0Awij/0Tq0cH/gRfw2bZeTwoqucpr1vAH6A89h7+DKt9mc3vG5vX
vDoHuwv+GNO2gI3sfLn2N+Ac83crdZT+B5tdgYzWzWHt7wmcBmtXtHyJz0xYJ1bVqulspLGJeLGe
+W3oyTrVzsf7AZ8pmzZhC8fWdWpaR90nt2qurrpOXedf6fzRnviP5lfXqetsVWfbe6LG51fXqets
1cr2RI3UVdf5ezpl3yNX9/wSx4UpTUqYWq/nl/axOK9vbDhHnNqH4lt9c8OFQs8vJWJt6CRUbxUX
Fa9JO4nnwrdV9X4B1R00NMK+V7kT8Zys7oPl0HUbbSJlDYxK+n2xuxBUl4Zeupoer1uj1zpqLW+l
vbn+WlyK5PgJi6skcluJsLVBPM9nLU4cGVOO7CisjRLJWFoJ5TNkSfGauBE8V6xZPMRqNnM9Zi/s
OtnDXyEOnnDi+dOhPrn3t7ODngmHk/EEJhCKRmg0QIPRIbUluNzoKeyL+I9Fle5hQcmXoIFwMkV7
o8mwnw5I8WQ4QUMRmgj+nnnlSqysEjl/62hXItQv0UHfwLCcQgoEpN5EaFCiveFQvy8h0bgUiYcw
EhqmgWgy4pdz+Gg4ioM9Pn9nlxMDCalPLflopa5mazuajXA5IcZ7lQhbZc1VLi8E+bPFaHeF2sfw
or14TyuD912eBBVzCG4ux/kq5nYavSRrcnPqFW4z9pAJk4trL46fqpKpo3C9kCGmmMNkJlnucpUs
LoPH5DCkWRa3wWuihjsl45WzHC/JwuZiXDJ4uN7KWSyX+JTVy+fULJYgP2L18NPF8bkqWU6Wz8VK
+RTnr7hHVn4BfK6ZuDBUHPCDGwAA4knzoyaPyDBFzWw3fsr4I1JaDjll93U5pH128ngrXRjmfwAA
AAAAAAAAAACmAQAA+QAAACjHUQC8QDAAQRsAAAD+eJy821dsVVt6wPF1zjE29TIZeklgRhRTHJE7
oRdnpBGmM4oU0cvVhCtMMSZzMwrVBo00I3qRkkmoNsw8RMCivwGmj9YDvb1hykd5iqk+NsY73z7f
n4vvBW6IFMXY/n3r+HDK3nv98Qslj1z8UZP4k/uLZNTcRfXOJf/OvuKPnD+36JcZytw/uq9HF/x9
P5fQ1XRdpQr+6aviuV+6z/lI6ldj/Uqc+MnkP/+P997t1mW+/kqfq+m3ryJHH6Gx6+p+kSjK/n2i
KJ4AAP//7wAAAAAA////////GAAAAAABAAAABQAAIAEgAQAAAAAABQAAQAJAAgAAAAAABQAAYANg
AwAAAAAABQAAgASABAAAAAAPAAsEDAQAAA8AAPAEBAAAAAAG8IgAAAAGPAAAEAAAADkAAAAPAAAA
AQAAAAcAAAACAAAABAAAAAMAAAAHAAAABAAAAAQAAAAFAAAABAAAAAYAAAAIAAAABwAAAAUAAAAI
AAAABQAAAAkAAAAIAAAACgAAAAQAAAALAAAACAAAAAwAAAAGAAAADQAAAAgAAAAOAAAAAgAAAA8A
AAAGAAAALwEB8BgDAABCAAfwJAAAAAMEOWtjRC5cr75Je4Wmj4xP6/8A3AEAAAQAAAAAAAAAAADW
IEIAB/AkAAAAAwQbHIPlwKnM6n7xBR8EU5Dj/wDyMgAAAQAAANwBAAAAANYgQgAH8CQAAAADBKAC
g2+kg/9D31Shu1xzK67/AConAAABAAAAzjQAAAAA1iBCAAfwJAAAAAMEhK7VMToCFFo3lXCVmUHo
wf8AiCAAAAEAAAD4WwAAAADWIEIAB/AkAAAAAwS/q0VgbnDpBjdUz3QrzdXX/wBUJwAAAQAAAIB8
AAAAANYgQgAH8CQAAAADBJKYT6NTGbAIrB7+v6WBR7//AGxbAAABAAAA1KMAAAAA1iBCAAfwJAAA
AAMEE1lRGVUsdoX6ecJzqaQNWv8AlyMAAAEAAABA/wAAAADWIEIAB/AkAAAAAwQjwG4wdYO8Rvr/
CLdUJ/FK/wAofAAAAQAAANciAQAAANYgQgAH8CQAAAADBLwDAaIe0gTlRrek/kd1wWn/APGiAAAB
AAAA/54BAAAA1iBCAAfwJAAAAAMEegFUQ5Nx3HrszqJ3yPSWSv8AmwEAAAQAAADwQQIAAADWIEIA
B/AkAAAAAwTx9Ss37TWUbVzVEGM3I7wE/wAoDwAAAQAAAItDAgAAANYgQgAH8CQAAAADBNCboZnw
ZLzv/Fl/fSwxSW3/AMsVAAABAAAAs1ICAAAA1iBCAAfwJAAAAAMEDt+w04rgMDo845Zy1CC58f8A
hA8AAAEAAAB+aAIAAADWIEIAB/AkAAAAAwQ6NhRmsP+dzxyOZtdQ4j6O/wCIDQAAAQAAAAJ4AgAA
ANYgQgAH8CQAAAADBJ3jV1Akv6gSTBWpVFSOkpr/AEgdAAABAAAAioUCAAAA1iBCAAfwJAAAAAME
qx8lI7gEHa9PiPrba2su6f8AQw4AAAEAAADSogIAAADWIEIAB/AkAAAAAwQ+FF1OtRvClUsZ1Y2y
IxVt/wCZJQAAAQAAABWxAgAAANYgQgAH8CQAAAADBGJDw7nNqKaaN7gJKpdFHe//AEAwAAABAAAA
rtYCAAAA1iBjAAvwJAAAAIEBBAAACIMBAAAACL8BEAAQAMABAQAACP8BCAAIAAECAgAACCAAGvEI
AAAA/wAAAP+AAABAAB7xEAAAAAQAAAj/gAAAAgAACPcAABAfAPAPHAAAAAAA8wMUAAAAAgAAAAAA
AAAAAAAAAAAAgAAAAAAPANAH8wEAAB8AFAQcAAAAAAAVBBQAAAC6HXXsAMqaOzJOzckAypo7AQEB
AQ8A+gNnAAAAAAD+AwMAAAAAAQAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAAAAAAAAsNL/vwAAdACA
H3oAAAAAALDS/79g+///QP7//wAAAABwAPsDCAAAAAAAAABwCAAAcAD7AwgAAAABAAAAQAsAAB8A
BwQ8AAAAAAD9AzQAAAAhAAAAZAAAACEAAABkAAAAUJYNAQIAAAAA0/+/AAAAAGcAAAAg1v+/AAAA
AAAAAAAAAdLIHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAABQlg0BAgAAAADT/78AAAAA
ZwAAACDW/78AAAAAAAAAAAAB0sgfAP8DFAAAAAIAAAQMAAAAAAAAAAAAAAACAAAAHwAIBDwAAAAA
AP0DNAAAAEIAAABkAAAAQgAAAGQAAABQlg0BAgAAAADT/78AAAAAFAAAACDW/78AAAAAAAAAAAAA
0sgPAIgTcAAAAA8AihNoAAAAAAC6DxQAAABfAF8AXwBQAFAAVAAyADAAMAAxAAAAixNEAAAADwCI
FzwAAAAAAIkXNAAAAAAAAAAAAAAAAAAAAFgCAAAAAQEAAQEAAAEBAQABAAAAAAAAAGjPAAAAAAAA
AAAAAIACAeA/ANkPDAAAAAAA2g8EAAAAAAAlAA8A8A+xDwAAAADzAxQAAAADAAAAAAAAAAIAAAAA
AQAAAAAAAAAAnw8EAAAABgAAAAAAqA9jAAAASW50ZXJwcmV0YXRpb24gb2YgbW9kZWwgcmVzdWx0
cyB0aGF0IHNob3cgY2hhbmdlcyBpbgsgdGhlIGVmZmVjdGl2ZSBjbGltYXRlIHNlbnNpdGl2aXR5
IHdpdGggdGltZS4LAAChDxQAAABkAAAAAAAAAAAAZAAAAAEAAAABAAAAqg8UAAAAYwAAAAYAAAAJ
CAAAAQAAAAAAAAAQAJ8PBAAAAAUAAAAAAKgPaAAAAEFsdGVybmF0aXZlIHRpdGxlOiBJcyB0aGUg
Y2xpbWF0ZSBzZW5zaXRpdml0eSBkZWFkPw0NUy4gQy4gQi4gUmFwZXIsIEFsZnJlZCBXZWdlbmVy
IEluc3RpdHV0ZSwgR2VybWFueQ0NAAChDyYAAABpAAAAAAAAAAAANAAAAAIAAAACAAEAAAABAAAA
AQA0AAAAAAAAAAAAqg9IAAAAPQAAAAYAAAAJCAAABgAAAAcAAAADAAkIAAAIAAAABgAAAAkIAAAI
AAAABwAAAAMACQgAABUAAAAGAAAACQgAAAEAAAAAAAAAAADzAxQAAAAEAAAAAAAAAAIAAAACAQAA
AAAAAAAAnw8EAAAAAAAAAAAAqA8fAAAARGVmaW5pdGlvbiBmb3Igc2xhYiBvY2VhbiBBR0NNcwAA
oQ8cAAAAIAAAAAAAAAAAAB8AAAAAAAIAJAABAAAAAAAAAAAAqg8SAAAAGQAAAAAAAAAHAAAAAQAA
AAMAEACfDwQAAAABAAAAAACgDwIDAABUAGgAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBzAGkA
dABpAHYAaQB0AHkAIABpAHMAIABkAGUAZgBpAG4AZQBkACAAYQBzACAAdABoAGUAIABlAHEAdQBp
AGwAaQBiAHIAaQB1AG0AIAB3AGEAcgBtAGkAbgBnACAAZgBvAHIAIABhACAAZABvAHUAYgBsAGkA
bgBnACAAbwBmACAAdABoAGUAIABjAG8AbgBjAGUAbgB0AHIAYQB0AGkAbwBuACAAbwBmACAAQwBP
ADIALAAgAGUAeABwAHIAZQBzAHMAZQBkACAAYQBzAA0ADQBE8FQAMgB4ACAAPQAgAETwUQAyAHgA
IAAvACAAbPAsAA0ADQAgACAAIAAgAHcAaABlAHIAZQAgAETwUQAyAHgAIABpAHMAIAB0AGgAZQAg
AGQAbwB1AGIAbABlAGQAIABDAE8AMgAgAGYAbwByAGMAaQBuAGcAIAAoAFcAbQAtADIAKQAgAGEA
bgBkACAAbPAgAGkAcwAgAHQAaABlACAAZgBlAGUAZABiAGEAYwBrACAAcABhAHIAYQBtAGUAdABl
AHIAIAAoAFcAbQAtADIALwBLACkALgAgAA0AQgB1AHQAIAB0AGgAZQBzAGUAIABtAGkAeABlAGQA
IABsAGEAeQBlAHIAIABvAGMAZQBhAG4AIABtAG8AZABlAGwAcwAgAGEAcgBlACAAbgBvAHQAIAB0
AGgAZQAgAG8AbgBlAHMAIAB1AHMAZQBkACAAZgBvAHIAIAB0AHIAYQBuAHMAaQBlAG4AdAAgAHMA
aQBtAHUAbABhAHQAaQBvAG4AcwAgAGEAbgBkACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsAcwAv
AHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAgAG0AYQB5ACAAYgBlACAAZABpAGYAZgBlAHIAZQBuAHQA
IAAoAHMAZQBlACAAQgBvAGUAcgAgAGEAbgBkACAAWQB1ACAAMgAwADAAMwBhACkALgAgAAAAoQ9e
AQAAeAAAAAAAABAAAFoAEQAAAAAAARgAAAAAAQBaAAEAAAAAAAAYAAABAFoAXAAAAAAAARAAAAAA
WgCcAAAAAAAAEAAAWgBnAAAAAAACABgAAQAAAAAACgAYAOf/EAAAAAAAAgAYAAEAAAAAAIIAAQAY
AAEAAAAAAAIAGAACAAAAAAAKABgA5/8DAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAAAgAYAAMA
AAAAAAoAGADn/wIAAAAAAAIAGAABAAAAAACCAAEAGAANAAAAAAACABgAAQAAAAAAggABABgAAQAA
AAAAAgAYAAIAAAAAAAoAGADn/xIAAAAAAAIAGAABAAAAAAAKABgA5/8MAAAAAAACABgAAgAAAAAA
CgAYAB4ABgAAAAAAAgAYAAEAAAAAAIIAAQAYAB4AAAAAAAIAGAACAAAAAAAKABgAHgCgAAAAAAAC
ABgAAgAAAAAAAAAAAKoPLgAAAIoAAAAGAAAACQgAAAQAAAAHAAAAAAAJCAAA8wAAAAYAAAAJCAAA
AQAAAAAAAAAAAPMDFAAAAAcAAAAAAAAAAgAAAAMBAAAAAAAAAACfDwQAAAAAAAAAAACoDyUAAABF
ZmZlY3RpdmUgY2xpbWF0ZSBzZW5zaXRpdml0eSBkZWZpbmVkAAChDxQAAAAmAAAAAAAAAAAAJgAA
AAAAAgAkABAAnw8EAAAAAQAAAAAAoA+KBAAATQB1AHIAcABoAHkAIAAoADEAOQA5ADUAKQAgAGQA
ZQBmAGkAbgBlAGQAIAB0AGgAZQAgABggZQBmAGYAZQBjAHQAaQB2AGUAIABjAGwAaQBtAGEAdABl
ACAAcwBlAG4AcwBpAHQAaQB2AGkAdAB5ABkgLAAgAGQAZQBuAG8AdABlAGQAIABE8FQAMgB4AGUA
ZgBmACwAIABhAHMAIAB0AGgAZQAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHIAZQBzAHAAbwBu
AHMAZQAgAHQAbwAgAGEAIABkAG8AdQBiAGwAaQBuAGcAIABvAGYAIABDAE8AMgAgAHcAaABpAGMA
aAAgAHcAbwB1AGwAZAAgAG8AYwBjAHUAcgAgAGkAZgAgAHQAaABlACAAQQBPAEcAQwBNACAAdwBh
AHMAIAByAHUAbgAgAHQAbwAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcAaQB0AGgAIABmAGUA
ZQBkAGIAYQBjAGsAIABzAHQAcgBlAG4AZwB0AGgAcwAsACAAcgBlAGEAbABpAHMAZQBkACAAYQB0
ACAAYQAgAHAAYQByAHQAaQBjAHUAbABhAHIAIAB0AGkAbQBlACwAIABoAGUAbABkACAAZgBpAHgA
ZQBkAC4AIABUAGgAZQAgAGUAcQB1AGEAdABpAG8AbgAgAGYAbwByACAAdABoAGUAIABmAGUAZQBk
AGIAYQBjAGsAIABwAGEAcgBhAG0AZQB0AGUAcgAgAHQAaABlAG4AIABpAG4AYwBsAHUAZABlAHMA
IABhACAAaABlAGEAdAAgAGYAbAB1AHgAIABiAGUAbABvAHcAIAB0AGgAZQAgAGEAdABtAG8AcwBw
AGgAZQByAGUAIABkAGUAbgBvAHQAZQBkACAARPBGACwADQANAGzwIAA9ACAAKABE8FEAIAAtACAA
RPBGACkAIAAvACAARPBUAA0ADQAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAYQBuAGQAIAB0
AGgAZQAgAGUAZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkA
dgBpAHQAeQAgAGMAYQBuACAAYgBlACAAZQB4AHAAcgBlAHMAcwBlAGQAIABhAHMADQANAETwVAAy
AHgAZQBmAGYAIAA9ACAARPBRADIAeAAgAC4AIABE8FQAIAAvACAAKABE8FEAIAAtACAARPBGACkA
LgANAA0AVABoAGUAIABlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBz
AGkAdABpAHYAaQB0AHkAIABpAHMAIAB0AGgAdQBzACAAYQAgAGgAeQBwAG8AdABoAGUAdABpAGMA
YQBsACAAYwBvAG4AYwBlAHAAdAAgAGUAdgBlAG4AIAB3AGkAdABoAGkAbgAgAHQAaABlACAAcgBl
AGEAbABtACAAbwBmACAAYwBsAGkAbQBhAHQAZQAgAG0AbwBkAGUAbABsAGkAbgBnAAAAoQ/wAQAA
WwEAAAAAABAAAFoAEwAAAAAAARgAAAAAAQBaAAEAAAAAAAAYAAABAFoASAAAAAAAARAAAAAAWgAB
AAAAAAAAEAAAWgAhAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBsAAAAAAAAEAAAWgBDAAAA
AAACABQAAQAAAAAAggABABQAAQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeADEAAAAA
AAIAFAABAAAAAAAKABQA5//aAAAAAAACABQAAQAAAAAAggABABQABAAAAAAAAgAUAAEAAAAAAIIA
AQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQAAgAAAAAAAgAU
AAEAAAAAAAoAFADn/wIAAAAAAAIAFAABAAAAAACCAAEAFABMAAAAAAACABQAAQAAAAAAggABABQA
AQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeAAMAAAAAAAIAFAABAAAAAACCAAEAFAAB
AAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAAAgAUAAEAAAAAAIIAAQAUAAUAAAAAAAIAFAABAAAA
AACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQAcQAAAAAAAgAUAAAAqg8uAAAAbwEAAAYAAAAJ
CAAADgAAAAcAAAAAAAkIAADIAAAABgAAAAkIAAABAAAAAAAAAAAA8wMUAAAACAAAAAQAAAACAAAA
BAEAAAAAAAAAAJ8PBAAAAAAAAAAAAKoPCgAAAAEAAAABAAAAAAAQAJ8PBAAAAAEAAAAAAKoPCgAA
AAEAAAABAAAAAAAAAPMDFAAAAAUAAAAEAAAAAAAAAAEBAAAAAAAAAADzAxQAAAAJAAAABAAAAAAA
AAAFAQAAAAAAAAAA8wMUAAAACgAAAAQAAAAAAAAABgEAAAAAAAAAAPMDFAAAAAsAAAAEAAAAAAAA
AAcBAAAAAAAAAADzAxQAAAAMAAAABAAAAAAAAAAIAQAAAAAAAAAA8wMUAAAADQAAAAQAAAAAAAAA
CQEAAAAAAAAAAPMDFAAAAA4AAAAEAAAAAAAAAAoBAAAAAAAAAADzAxQAAAAPAAAABAAAAAAAAAAL
AQAAAAAAAAAA8wMUAAAAEQAAAAQAAAAAAAAADQEAAAAAAAAAAPMDFAAAABAAAAAAAAAAAAAAAAwB
AAAAAAAAAADqAwAAAAAPAO4DSAMAAAIA7wMYAAAAEAAAAAAAAAAAAAAAAAAAgAAAAAAHAAADDwAM
BPgCAAAPAALw8AIAAKAACPAIAAAAAwAAAAMoAAAPAAPwiAIAAA8ABPAoAAAAAQAJ8BAAAAAgAQAA
AAAAAAAAAAAAAAAAAgAK8AgAAAAAKAAABQAAAA8ABPAkAQAAsgQK8AgAAAACKAAAAAoAAEMAC/D8
AAAAfwCAAIAABEEKAAAABcHkAAAABgEBAAAADgBmAGkAZwAyAHQAaQB0AGwAZQAuAFAASQBDAFQA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUA
DABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAACQAAAAgBZcAw8ABPAkAQAAsgQK8AgA
AAADKAAAAAoAAEMAC/D8AAAAfwCAAIAABEELAAAABcHkAAAABgEBAAAACwBmAGkAZwAyAC4AMQAu
AFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAw
ADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAACQAyABsBOE
DQ8ABPBIAAAAEgAK8AgAAAABKAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHevWgA
vwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMzmQAA
mZkAmcwAAA8A7gN0BAAAAgDvAxgAAAAQAAAAAAAAAAAAAAAAAACAAAAAAAcAAAMPAAwEJAQAAA8A
AvAcBAAAsAAI8AgAAAAEAAAABywAAA8AA/C0AwAADwAE8CgAAAABAAnwEAAAAAAAAAB8AAAAAAAA
AAAAAAACAArwCAAAAAAsAAAFAAAADwAE8CQBAACyBArwCAAAAAIsAAAACgAAQwAL8PwAAAB/AIAA
gAAEQQoAAAAFweQAAAAGAQEAAAAOAGYAaQBnADIAdABpAHQAbABlAC4AUABJAEMAVAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBj
AGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
QgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAAPAAAACAFrwDDwAE8CQBAACyBArwCAAAAAMsAAAA
CgAAQwAL8PwAAAB/AIAAgAAEQQwAAAAFweQAAAAGAQEAAAALAGYAaQBnADIALgAyAC4AUABJAEMA
VAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQA
NwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAACAEAADADCQODwAE8CQB
AACyBArwCAAAAAcsAAAACgAAQwAL8PwAAAB/AIAAgAAEQQ0AAAAFweQAAAAGAQEAAAAOAEwAYQB5
AG8AdQB0ADIALQAxAC4AUABJAEMAVAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAA
AHAFFwyAFtQKDwAE8EgAAAASAArwCAAAAAEsAAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6f
iwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC7
4OMAMzOZAACZmQCZzAAADwDuA3QEAAACAO8DGAAAABAAAAAAAAAAAAAAAAAAAIAAAAAABwAAAw8A
DAQkBAAADwAC8BwEAADAAAjwCAAAAAQAAAAFMAAADwAD8LQDAAAPAATwKAAAAAEACfAQAAAAAAAA
AAAAAAAAAAAAAAAAAAIACvAIAAAAADAAAAUAAAAPAATwJAEAALIECvAIAAAAAjAAAAAKAABDAAvw
/AAAAH8AgACAAARBCgAAAAXB5AAAAAYBAQAAAA4AZgBpAGcAMgB0AGkAdABsAGUALgBQAEkAQwBU
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABF
AAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAA8AAAAIAWvAMPAATwJAEAALIECvAI
AAAAAzAAAAAKAABDAAvw/AAAAH8AgACAAARBDgAAAAXB5AAAAAYBAQAAAAsAZgBpAGcAMgAuADMA
LgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
MAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAAkAMAAJAM
jg0PAATwJAEAALIECvAIAAAABTAAAAAKAABDAAvw/AAAAH8AgACAAARBDwAAAAXB5AAAAAYBAQAA
AA4ATABhAHkAbwB1AHQAMgAtADIALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAMAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAA
AAAAEPAIAAAA0AUwDIAWaA8PAATwSAAAABIACvAIAAAAATAAAAAMAACDAAvwMAAAAIEBAAAACIMB
BQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACA
gIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAO4D2gQAAAIA7wMYAAAAEAAAAAAAAAAAAAAAAAAAgAAA
AAAHAAADDwAMBIoEAAAPAALwggQAANAACPAIAAAABQAAAAc0AAAPAAPwGgQAAA8ABPAoAAAAAQAJ
8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgAAAAANAAABQAAAA8ABPAkAQAAsgQK8AgAAAACNAAA
AAoAAEMAC/D8AAAAfwCAAIAABEEKAAAABcHkAAAABgEBAAAADgBmAGkAZwAyAHQAaQB0AGwAZQAu
AFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABE
ADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAAAgAQAAgBbsAw8ABPAk
AQAAsgQK8AgAAAAENAAAAAoAAEMAC/D8AAAAfwCAAIAABEEQAAAABcHkAAAABgEBAAAACwBmAGkA
ZwAyAC4ANAAuAFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgA
AABgA6D/QA4uCw8ABPBeAAAAQgEK8AgAAAAFNAAAAAoAAJMAC/A2AAAAhQACAAAAhwABAAAARAEE
AAAAfwEAAAEAvwEAABAAwAEBAAAIywFqSgAA/wEYABgAAQICAAAIAAAQ8AgAAADABkAOQA7ACQ8A
BPAkAQAAsgQK8AgAAAAHNAAAAAoAAEMAC/D8AAAAfwCAAIAABEERAAAABcHkAAAABgEBAAAADgBM
AGEAeQBvAHUAdAAyAC0AMwAuAFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ
8AgAAADQCPAMgBa7EA8ABPBIAAAAEgAK8AgAAAABNAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAI
kwGOn4sAlAHevWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAA
AAAAu+DjADMzmQAAmZkAmcwAAA8A7gPcAgAAAgDvAxgAAAAQAAAAAAAAAAAAAAAAAACAAAAAAAcA
AAMPAAwEjAIAAA8AAvCEAgAA8AAI8AgAAAAEAAAABTwAAA8AA/AcAgAADwAE8CgAAAABAAnwEAAA
AAAAAAAAAAAAAAAAAAAAAAACAArwCAAAAAA8AAAFAAAADwAE8CQBAACyBArwCAAAAAM8AAAACgAA
QwAL8PwAAAB/AIAAgAAEQRIAAAAFweQAAAAGAQEAAAAMAEwAYQB5AG8AdQB0ADIALgBQAEkAQwBU
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5
ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAAAAAAACtDOAQDwAE8FgAAABC
AQrwCAAAAAQ8AAAACgAAgwAL8DAAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAQEA
AAj/ARgAGAABAgIAAAgAABDwCAAAAPAGkAyQDEAIDwAE8FgAAABCAQrwCAAAAAU8AAAACgAAgwAL
8DAAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAQEAAAj/ARgAGAABAgIAAAgAABDw
CAAAAOANQAtAC8APDwAE8EgAAAASAArwCAAAAAE8AAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiT
AY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAA
AAC74OMAMzOZAACZmQCZzAAADwDuA/AAAAACAO8DGAAAABAAAAAAAAAAAAAAAAAAAIAAAAAABwAA
Aw8ADASgAAAADwAC8JgAAADgAAjwCAAAAAEAAAABOAAADwAD8DAAAAAPAATwKAAAAAEACfAQAAAA
AAAAAHwAAAAAAAAAAAAAAAIACvAIAAAAADgAAAUAAAAPAATwSAAAABIACvAIAAAAATgAAAAMAACD
AAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA
8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAAAHIXJAAAAAEAEACmOgAADABg
AFBSAACgVQAAHFoAAJheAABeZgAAemMAAAAA9Q8cAAAADQEAACAFAAOCOgAAVmcAAAEAAAARAAAA
AQAAAA8A6AP0FwAAAQDpAygAAACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAAAAAAAAAAAAEAAAAA
AAABDwDyA2IBAAAvAMgPDAAAADAA0g8EAAAAAAAAAA8A1QeYAGRlIFRpdGxlcwADAAAADgAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKd0AIyK/7+Q0nQAAAABAAQAEAC3
D0QAAABTAHkAbQBiAG8AbAAAACBLADAP0gAEAAB/AOBpfwCgB38AoAf/vyDW/7+Q0nQAAAAIAQCn
dACMiv+/kNJ0AAAAAgAEAAAApA8KAAAAgABgAAAA/////wAApQ8MAAAAAAAACC4AAAACAAAAAACp
DwoAAAAHAAAAAgAJBAAAQACjD24AAAAFAP/9PwAAACIgAABkAAAAAAAAAGQAAAAAAAAAAABAAgAA
AAACAAAA///vAAAAAAD///////8YAAAAAAEAAAAFAAAgASABAAAAAAAFAABAAkACAAAAAAAFAABg
A2ADAAAAAAAFAACABIAEAAAAAA8ACwSQBAAADwAA8IgEAAAAAAbwiAAAAAJAAAAQAAAARAAAAA8A
AAABAAAABwAAAAMAAAAEAAAABAAAAAcAAAANAAAABAAAAA4AAAAEAAAADwAAAAgAAAAFAAAABQAA
AAIAAAAFAAAABgAAAAgAAAAHAAAABAAAAAgAAAAIAAAACQAAAAYAAAAKAAAACAAAAAwAAAAQAAAA
CwAAAAcAAABfAQHwnAMAAEIAB/AkAAAAAwQ5a2NELlyvvkl7haaPjE/r/wDcAQAABAAAAAAAAAAA
ANYgQgAH8CQAAAADBBscg+XAqczqfvEFHwRTkOP/APIyAAABAAAA3AEAAAAA1iBCAAfwJAAAAAME
oAKDb6SD/0PfVKG7XHMrrv8AKicAAAEAAADONAAAAADWIEIAB/AkAAAAAwSErtUxOgIUWjeVcJWZ
QejB/wCIIAAAAQAAAPhbAAAAANYgQgAH8CQAAAADBL+rRWBucOkGN1TPdCvN1df/AFQnAAABAAAA
gHwAAAAA1iBCAAfwJAAAAAMEkphPo1MZsAisHv6/pYFHv/8AbFsAAAEAAADUowAAAADWIEIAB/Ak
AAAAAwQTWVEZVSx2hfp5wnOppA1a/wCXIwAAAQAAAED/AAAAANYgQgAH8CQAAAADBCPAbjB1g7xG
+v8It1Qn8Ur/ACh8AAABAAAA1yIBAAAA1iBCAAfwJAAAAAMEvAMBoh7SBOVGt6T+R3XBaf8A8aIA
AAEAAAD/ngEAAADWIEIAB/AkAAAAAwR6AVRDk3HceuzOonfI9JZK/wCbAQAABAAAAPBBAgAAANYg
QgAH8CQAAAADBPH1KzftNZRtXNUQYzcjvAT/ACgPAAABAAAAi0MCAAAA1iBCAAfwJAAAAAME0Juh
mfBkvO/8WX99LDFJbf8AyxUAAAEAAACzUgIAAADWIEIAB/AkAAAAAwQO37DTiuAwOjzjlnLUILnx
/wCEDwAAAQAAAH5oAgAAANYgQgAH8CQAAAADBDo2FGaw/53PHI5m11DiPo7/AIgNAAABAAAAAngC
AAAA1iBCAAfwJAAAAAMEneNXUCS/qBJMFalUVI6Smv8ASB0AAAEAAACKhQIAAADWIEIAB/AkAAAA
AwSrHyUjuAQdr0+I+ttray7p/wBDDgAAAQAAANKiAgAAANYgQgAH8CQAAAADBD4UXU61G8KVSxnV
jbIjFW3/AJklAAABAAAAFbECAAAA1iBCAAfwJAAAAAMEYkPDuc2oppo3uAkql0Ud7/8AQDAAAAEA
AACu1gIAAADWIAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAANYgQgAH
8CQAAAADBFJaDjll93U5pH128ngrXRj/AIsbAAABAAAA7gYDAAAA1iBCAAfwJAAAAAMEoig2Jk33
QJHuMaGg+MElff8AqQEAAAEAAAB5IgMAAADWIGMAC/AkAAAAgQEEAAAIgwEAAAAIvwEQABAAwAEB
AAAI/wEIAAgAAQICAAAIIAAa8QgAAAD/AAAA/4AAAEAAHvEQAAAA//////8AAAACAAAI9wAAEB8A
8A8cAAAAAADzAxQAAAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AfzAQAAHwAUBBwAAAAAABUEFAAA
ALoddewAypo7Mk7NyQDKmjsBAQEBDwD6A2cAAAAAAP4DgQAAAIIAAACDAAAAhAAAAIUAAACGAAAA
hwAAAIgAAACJAAAAigAAAIsAAACMAAAAjQAAAI4AAACPAAAAkAAAAJEAAACSAAAAkwAAAJQAAACV
AAAAlgAAAJcAAACYAAAAmQAAAJoAAACbAAAAnAAAAJ0AAACeAAAAnwAAAKAAAAChAAAAogAAAKMA
AACkAAAApQAAAKYAAACnAAAAqAAAAKkAAACqAAAAqwAAAKwAAACtAAAArgAAAK8AAACwAAAAsQAA
ALIAAACzAAAAtAAAALUAAAC2AAAAtwAAALgAAAC5AAAAugAAALsAAAC8AAAAvQAAAL4AAAC/AAAA
wAAAAMEAAADCAAAAwwAAAMQAAADFAAAAxgAAAMcAAADIAAAAyQAAAMoAAADLAAAAzAAAAM0AAADO
AAAAzwAAANAAAADRAAAA0gAAANMAAADVAAAARAEAANYAAADXAAAA2AAAANkAAADaAAAA2wAAANwA
AADdAAAA3gAAAN8AAADgAAAA4QAAAOIAAADjAAAA5AAAAOUAAADmAAAA5wAAAOgAAADpAAAA6gAA
AOsAAADsAAAA7QAAAO4AAADvAAAA8AAAAPEAAADyAAAA8wAAAPQAAAD1AAAA9gAAAPcAAAD4AAAA
+QAAAPoAAAD7AAAA/AAAAP0AAAD+AAAA/wAAAAABAAABAAAAAgAAAFYAAAAEAAAAIAAAAAYAAAAH
AAAACAAAAAkAAAAKAAAACwAAAAwAAAANAAAADgAAAA8AAAAQAAAAEQAAABIAAAATAAAAFAAAABUA
AAAWAAAAFwAAABgAAAAZAAAAGgAAABsAAAAcAAAAHQAAAB4AAAAfAAAAAwAAACEAAAAiAAAAIwAA
ACQAAAAlAAAAJgAAACcAAAAoAAAAKQAAACoAAAArAAAALAAAAC0AAAAuAAAALwAAADAAAAAxAAAA
MgAAADMAAAA0AAAANQAAADYAAAA3AAAAOAAAADkAAAA6AAAAOwAAADwAAAA9AAAAPgAAAD8AAABA
AAAAQQAAAEIAAABDAAAARAAAAEUAAABGAAAARwAAAEgAAABJAAAASgAAAEsAAABMAAAATQAAAE4A
AABPAAAAUAAAAFEAAABSAAAAUwAAAFQAAABVAAAAVwAAANQAAABYAAAAWQAAAFoAAABbAAAAXAAA
AF0AAABeAAAAXwAAAGAAAABhAAAAYgAAAGMAAABkAAAAZQAAAGYAAABnAAAAaAAAAGkAAABqAAAA
awAAAGwAAABtAAAAbgAAAG8AAABwAAAAcQAAAHIAAABzAAAAdAAAAHUAAAB2AAAAdwAAAHgAAAB5
AAAAegAAAHsAAAB8AAAAfQAAAH4AAAB/AAAAgAAAAAMAAAAAAQAAAP0DNAAAAGQAAABkAAAAZAAA
AGQAAAAAAAAAsNL/vwAAdACAH3oAAAAAALDS/79g+///cP3//wAAAABwAPsDCAAAAAAAAABwCAAA
cAD7AwgAAAABAAAAQAsAAB8ABwQ8AAAAAAD9AzQAAAAhAAAAZAAAACEAAABkAAAAUJYNAQIAAAAA
0/+/AAAAAGcAAAAg1v+/AAAAAAAAAAAAAdLIHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQA
AABQlg0BAgAAAADT/78AAAAAZwAAACDW/78AAAAAAAAAAAAB0sgfAP8DFAAAAAIAAAQMAAAAAAAA
AAAAAAACAAAAHwAIBDwAAAAAAP0DNAAAAEIAAABkAAAAQgAAAGQAAABQlg0BAgAAAADT/78AAAAA
FAAAACDW/78AAAAAAAAAAAAA0sgPAIgTcAAAAA8AihNoAAAAAAC6DxQAAABfAF8AXwBQAFAAVAAy
ADAAMAAxAAAAixNEAAAADwCIFzwAAAAAAIkXNAAAAAAAAAAAAAAAAAAAAFgCAAAAAQEAAQEAAAEB
AQABAAAAAAAAAGjPAAAAAAAAAAAAAIACAeA/ANkPDAAAAAAA2g8EAAAAAAAlAA8A8A9/DwAAAADz
AxQAAAADAAAAAAAAAAIAAAAAAQAAAAAAAAAAnw8EAAAABgAAAAAAqA9jAAAASW50ZXJwcmV0YXRp
b24gb2YgbW9kZWwgcmVzdWx0cyB0aGF0IHNob3cgY2hhbmdlcyBpbgsgdGhlIGVmZmVjdGl2ZSBj
bGltYXRlIHNlbnNpdGl2aXR5IHdpdGggdGltZS4LAAChDxQAAABkAAAAAAAAAAAAZAAAAAEAAAAB
AAAAqg8UAAAAYwAAAAYAAAAJCAAAAQAAAAAAAAAQAJ8PBAAAAAUAAAAAAKgPaAAAAEFsdGVybmF0
aXZlIHRpdGxlOiBJcyB0aGUgY2xpbWF0ZSBzZW5zaXRpdml0eSBkZWFkPw0NUy4gQy4gQi4gUmFw
ZXIsIEFsZnJlZCBXZWdlbmVyIEluc3RpdHV0ZSwgR2VybWFueQ0NAAChDyYAAABpAAAAAAAAAAAA
NAAAAAIAAAACAAEAAAABAAAAAQA0AAAAAAAAAAAAqg9IAAAAPgAAAAYAAAAJCAAABQAAAAcAAAAD
AAkIAAAJAAAABgAAAAkIAAAIAAAABwAAAAMACQgAABQAAAAGAAAACQgAAAEAAAAAAAAAAADzAxQA
AAAEAAAAAAAAAAIAAAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8fAAAARGVmaW5pdGlvbiBmb3Ig
c2xhYiBvY2VhbiBBR0NNcwAAoQ8cAAAAIAAAAAAAAAAAAB8AAAAAAAIAJAABAAAAAAAAAAAAqg8S
AAAAGQAAAAAAAAAHAAAAAQAAAAMAEACfDwQAAAABAAAAAACgDwIDAABUAGgAZQAgAGMAbABpAG0A
YQB0AGUAIABzAGUAbgBzAGkAdABpAHYAaQB0AHkAIABpAHMAIABkAGUAZgBpAG4AZQBkACAAYQBz
ACAAdABoAGUAIABlAHEAdQBpAGwAaQBiAHIAaQB1AG0AIAB3AGEAcgBtAGkAbgBnACAAZgBvAHIA
IABhACAAZABvAHUAYgBsAGkAbgBnACAAbwBmACAAdABoAGUAIABjAG8AbgBjAGUAbgB0AHIAYQB0
AGkAbwBuACAAbwBmACAAQwBPADIALAAgAGUAeABwAHIAZQBzAHMAZQBkACAAYQBzAA0ADQBE8FQA
MgB4ACAAPQAgAETwUQAyAHgAIAAvACAAbPAsAA0ADQAgACAAIAAgAHcAaABlAHIAZQAgAETwUQAy
AHgAIABpAHMAIAB0AGgAZQAgAGQAbwB1AGIAbABlAGQAIABDAE8AMgAgAGYAbwByAGMAaQBuAGcA
IAAoAFcAbQAtADIAKQAgAGEAbgBkACAAbPAgAGkAcwAgAHQAaABlACAAZgBlAGUAZABiAGEAYwBr
ACAAcABhAHIAYQBtAGUAdABlAHIAIAAoAFcAbdatFMG1LfVDlYb80SW76bZRqCI7T/DDUrZ0iS5L
RSSwiFBLpa794qdBtP1gERGp7iL4FFuhH+RRu9nJy+SN55x77/x5mffyRmJMw+yGzPnlzZy559xz
fuecyUsCXwqk+pAkVA/evo0vhlJwcMPrt6V62Kh1Ui8FFwmuvi7V90hC9bEEPAWn4YZBLIDgQHBA
WKHogQjxN3Ybq0VkQCSMgztgJbeR0FCGSPNhYXhKL6oAX0HEg18ErgdojQAsDoJNAQ/PZhDVE9JM
CFHDDQhZFJ+GExLCqzApIMQ2QDfSLbzQJfORv0WPECymkyBcDpJvD2Owh0nAIzaxKXVL1NiUumFT
JXAplwCMb6q9iOUgJfskj2EswFZqMUzETiL6JEIosPsCLc2QpAIuNxitW8iosg5jOSVN4WgyVOiG
krkHNWv3QDQUTBCgehe/tCXbgRhYaeCkAUYm0o+9AVySiGGuGCRiJxHbiQgaa1IM5deQwBIRlpzJ
7F04jkIx0BUJJ2BuV3ZIeyaPxH3HJOndp0ivpUzrqGOoSa+lua6dIj0UIJMk+1kpzgt0A5FwHmQP
Snw76dkjk14nRXrIdXBvqEUoiRTrhVKAF6VgoYCppY+uOtopjCfyzBWSOUEw14l94M5IkVv6zqGU
PLrzWEA1FUujWnUoV+3RqoHAGMeXQ21xT1rsksVYLvFldIP0Vk96y5XeQiZjvuzcLN25OeTmuuQv
9DztStS3PakNgy3Ue5rZY9hzFQIqIN6LsVxyaMmh/7+4s9ZxI0M23mXVQzgJdKR8AZyGTIAy9EvU
pMFmWxyHGSIvRNC6MI/6FkSWRG1CwgbUo71SCHkikMiRKJTXOTRneApBRyUi3+kp1MHpxNKonUE+
zKIMY00jVCSRl4MwYw4BS3swtmL+QMQOhl4CnT4YFICw/lGhz7x2At1cqHIOjcVxKordgtOURh0c
3rTpThaF4D/ge4nsHsxtTLmT2b1IYAstkUUoUptC41mMhERyMy3sw7EthsTuMhN5PAYejoAYEAho
AMRYwZiyqZWm+ALSw1AJmXmL4Sw2SthCGWZeiLUN57VNJbha8EgAK3hXCUIL1jbB1oKjBCjAHVlx
nCgZoTIjlTp6qhJ57QFHv9gxJpd29ujoo7qfrY9qHZaqjEKtU0Sy++FUOrtypsej25FHB4ssPR+R
9Vdyxq4Loxc/7Ks4Pe7ZwIdAPm9L7oHg8nkgZezFOMSJDCaQkYYQuARkZEHYgiw5CEkGkeQgbHO2
o0AHeOD6XAe4HfmQYW6MGCC7p1OIEdUoFCASCVu5SbJJlErSNPI1UrmPKEUFGdjaWxhll5HinG0G
8IxxWSRiBsqgIO0+O0y7FooEICfmHJbaBIu2RG8X1CnXFwkDha5v48aqAJCdbZc4AvsCFPGhT0vS
gxNii9DFJ8fyQVCXHhKwQIp8Sz7t36CnCNg4IN04vUh2vsB+Adw0QHrY6eFQWV7L8voeLK97+VEy
f8n8B5D5y4H+wA30qe88ezKcuB44nMzkYXaZboOHDCA0d+D3oOxN6a1N0oMeAIeaULa9lq36Asgk
r8V1XwBZhuXMT+ec005np91RiPLaUgizHEp8kEEqyzy4eZvxDGK9BHX6kRcjO4uCfuQqqlNIcwx+
820ghIX3QWyGBkEkmUwx5ymIZkE51NwGa8eSrbkNlxS1NX9hVxV1NGNZUFK90E6jKOppHmpjp9bT
PEQoTJB8zkpVus1s+o4WFaw2NFW6fjvYb+n6beEycYep+GFvAnuP/aMdFCnamcnYzkzGBcJy0Fzc
DrLzcDjiPFx0/vX/y/k3LDj/WurJf5+nRn2GMNhXidPcQU7zdslpOz486PQ5T93XVuuwRn5o0Es7
bR88NJAf+/wJa5KZBsTSOlq620IBX+E7YPweDQIo2yjLORTih2YQJCOIKZzuZJPNIwKy2hgKyWpj
CIlkfYHAIBTkIVuiUHYLOAbRJwIBNhUadLDdUMCF29B7tTJgUPPUoGRIdTVeK9X87BnIrECD/nXm
W0agk+q3sq7JAPAktxXAEsVVv4zvxcH36oRJ1Yp3AapWiE8eOvGgCYUQEfYeXPYekOGbcevsJa2z
m26dQyla2da5LftlV/fLVtwvu6P0y3v8UQ6e5eB50AbP8o0R5RsjWPnGiPI5yr59jlJ2oGUHum87
0LIlLFvCA9ISWgID799s3MIj3Bhoec/laLg81mOVqJUr+rHodRKxR2L+j9g4WrC1YGlBaIGTAHXP
C5Rgo2CGDA//u+pXbsY+2oyS80vOP4Ccn/zunzX2LP09yqZ5mS+blxuPsSa7ly+ze0Gags8zbIZN
mV+i4/Dfz4Z/XW3aqjWmePKT3KCh9lOpgY7DNcDVtSv8RPrqqiOvpuOOV1fr/Hj6ar4qr6bjjlfz
b/Nj/T+Dnjr7DZCvxLaehyterD48Mb8wNzu/0Dy3MLu80tzm1TX4/wEmXn8d1DTNs3yVfxwsmeR/
BG9M8j+DV9dAuz77NKz0gnmRv8RO88PVcf5Q9R6Q/NpV3qm9BtKvG0f4u42Hs9qj6BH8yfimOMpX
jaOo3biG2o2f9WnfbtGbAO6ILXqATYsH+Xf4Q0N8kL5i2niweqjA2b+q/aDA2b9r3J06u8/iF15A
i/kHwZ8/IX/+kyyeKGTxNL+niLX81ULWmoWsPTrY2tb7owijR0zxVXE3WitOorVippi14lNFrBWf
LWKtmC9irXh0sLVwSQWypSl+BNaeJ2vvIGvN/lwRz/AL4peYK+Kx6ri4hLkieO2qOI65YrzTOCKm
+nPl+ecZ/9bfQHsDcsWgyPk6ZaLfr90IQPs0ZeK/quPGXZSJj0MmXqZMfBEy8S/92i/XP3HtrUXg
z8dh7e+jtVsUl68V2ynmFdqp44V26kOF4vKtYVnIGO3U98DaVbJ2lnbqdMG4/Hkha18uZG2rUFye
H24tsewNsNYklv0r7e3NbXH5G4icWxg5xjsQl1MYOcZva1eNTYrLVxtHjPW8uPzkk6xpvA1x+TJp
v5KrfScL6oX4+/eFGO0XhSJnI9eXye+IwX/HjLB+v9Uav8ROGO/WZ6yL499Xvz1GvvL0+HdZ03q6
/gBJk6ICn+NqKk7WF8XJsQZ4/Gh9TSzWbw6o8HNqTfre1KeI+bGpanNlbm4uXmNSSa+D5uugeYI9
Cmf+qX4NLMnX/WSu7j+MTZmoe+UpltYuq1Zlsr5YmdTaKyeHaJ/P0165X2pfOZPWrqtE5TnQ/lys
/foQ7U/kan9J+mXlXKJbc3JlC3Rvoccr/6ivVe8a6PFWn+aPLMOCF+a+lvSFMRNXl+qL1SXUWf0i
6Lw0UOdSns6vLs6fTXRq/q3eAJ03tA+qW0N88JU8H1QD8sG5p86kd0+ynXmqvmie0rrNpSG6V/J0
m4uk+/zcuaxujAzzFdD9CvrC/GF9zXxjoC9+vM0XVnPlG0vnnkj/3SPNKdbh+qJ1WK/YOjVkxc/k
rdj6NMUbqt8+Nag8Zl+u/Z1PNj7KTrBHajf5hxsf03lMr9zZOAzd2p21t0maZAvwOb+/vshS/TV7
s9Y99JnPf+4LJ5qzy7Nnv7lyZqV/Bc+y6D/vPVioMFQc8KEBAABTO7Mi0hMxykFY6nbMQozYoig2
Jk33QJHuMaGg+MElfUICAAAAAAAAAAAAAC4DAACJAAAACL6dAHyMGgBfAQAAAP54nI1PPU8CQRB9
d0cQVEzosDFLhwkiucTKRqUACpXYanNwe3IJ3JG7hWhlpzHR2BC/GqDxFxhjjCYUtJb+Hc65lVAZ
dCZvM7NvZ95bdQdhXGo5JNVgEcEYULd+EEaktNySxQAmrHLxIA+FuiPqtKJntOob+E+ohBhB+Ugf
vv35uo8riRXSmp+6mJNcHu+40KKpEnQ840xbSlWIiVFKRh2ntsDUMW5klcaIzgFuEQ1tK+E/HhEL
XsnOnlS6RxZxaNEid3jHADTKBIbIIQIEQEbporfOLYvXhN3hrNawm4bgzOeOb9ONLU6ZIZiocybs
JmeuxQr7tPeBcPeL8ic12YlyAue0/yu5qegzJsir8jSdGIaOkt04M912tWE7x7MnF0aTyYz6gt62
7Uinhd1yRWf8pMU98uwIn7V9WsVMbtkO/cp1mM4yxIq2V+UmW2M11xGe21idqvVxLRF8A6SyeBoA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALcPRAAAAFQAaQBtAGUAcwAAAAAAIEsAMA/SAAQAAH8A
4Gl/AKAHfwCgB/+/INb/v5DSdAAAAAgBAKd0AIyK/7+Q0nQAAAAAAAQAEAC3D0QAAABTAHkAbQBi
AG8AbAAAACBLADAP0gAEAAB/AOBpfwCgB38AoAf/vyDW/7+Q0nQAAAAIAQCndACMiv+/kNJ0AAAA
AgAEAAAApA8KAAAAgABgAAAA/////wAApQ8MAAAAAAAACC4AAAACAAAAAACpDwoAAAAHAAAAAgAJ
BAAAQACjD24AAAAFAP/9PwAAACIgAABkAAAAAAAAAGQAAAAAAAAAAABAAgAAAAACAAAA///vAAAA
AAD///////8YAAAAAAEAAAAFAAAgASABAAAAAAAFAABAAkACAAAAAAAFAABgA2ADAAAAAAAFAACA
BIAEAAAAAA8ACwSQBAAADwAA8IgEAAAAAAbwiAAAAAJAAAAQAAAAQgAAAA8AAAABAAAABwAAAAMA
AAAEAAAABAAAAAcAAAANAAAABAAAAA4AAAAEAAAADwAAAAgAAAAFAAAABQAAAAYAAAAFAAAABwAA
AAgAAAAIAAAABAAAAAkAAAAIAAAACgAAAAYAAAALAAAACAAAAAwAAAAPAAAAAgAAAAYAAABfAQHw
nAMAAEIAB/AkAAAAAwQ5a2NELlyvvkl7haaPjE/r/wDcAQAABAAAAAAAAAAAANYgQgAH8CQAAAAD
BBscg+XAqczqfvEFHwRTkOP/APIyAAABAAAA3AEAAAAA1iBCAAfwJAAAAAMEoAKDb6SD/0PfVKG7
XHMrrv8AKicAAAEAAADONAAAAADWIEIAB/AkAAAAAwSErtUxOgIUWjeVcJWZQejB/wCIIAAAAQAA
APhbAAAAANYgQgAH8CQAAAADBL+rRWBucOkGN1TPdCvN1df/AFQnAAABAAAAgHwAAAAA1iBCAAfw
JAAAAAMEkphPo1MZsAisHv6/pYFHv/8AbFsAAAEAAADUowAAAADWIEIAB/AkAAAAAwQTWVEZVSx2
hfp5wnOppA1a/wCXIwAAAQAAAED/AAAAANYgQgAH8CQAAAADBCPAbjB1g7xG+v8It1Qn8Ur/ACh8
AAABAAAA1yIBAAAA1iBCAAfwJAAAAAMEvAMBoh7SBOVGt6T+R3XBaf8A8aIAAAEAAAD/ngEAAADW
IEIAB/AkAAAAAwR6AVRDk3HceuzOonfI9JZK/wCbAQAABAAAAPBBAgAAANYgQgAH8CQAAAADBPH1
KzftNZRtXNUQYzcjvAT/ACgPAAABAAAAi0MCAAAA1iBCAAfwJAAAAAME0JuhmfBkvO/8WX99LDFJ
bf8AyxUAAAEAAACzUgIAAADWIEIAB/AkAAAAAwQO37DTiuAwOjzjlnLUILnx/wCEDwAAAQAAAH5o
AgAAANYgQgAH8CQAAAADBDo2FGaw/53PHI5m11DiPo7/AIgNAAABAAAAAngCAAAA1iBCAAfwJAAA
AAMEneNXUCS/qBJMFalUVI6Smv8ASB0AAAEAAACKhQIAAADWIEIAB/AkAAAAAwSrHyUjuAQdr0+I
+ttray7p/wBDDgAAAQAAANKiAgAAANYgQgAH8CQAAAADBD4UXU61G8KVSxnVjbIjFW3/AJklAAAB
AAAAFbECAAAA1iBCAAfwJAAAAAMEYkPDuc2oppo3uAkql0Ud7/8AQDAAAAEAAACu1gIAAADWIAIA
B/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAAAAAAAAAAANYgQgAH8CQAAAADBFJaDjll
93U5pH128ngrXRj/AIsbAAABAAAA7gYDAAAA1iBCAAfwJAAAAAMEoig2Jk33QJHuMaGg+MElff8A
qQEAAAEAAAB5IgMAAADWIGMAC/AkAAAAgQEEAAAIgwEAAAAIvwEQABAAwAEBAAAI/wEIAAgAAQIC
AAAIIAAa8QgAAAD/AAAA/4AAAEAAHvEQAAAA//////8AAAACAAAI9wAAEB8A8A8cAAAAAADzAxQA
AAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AfzAQAAHwAUBBwAAAAAABUEFAAAALoddewAypo7Mk7N
yQDKmjsBAQEBDwD6A2cAAAAAAP4DAwAAAAABAAAA/QM0AAAAZAAAAGQAAABkAAAAZAAAAAAAAACw
0v+/AAB0AIAfegAAAAAAsNL/v8D7//9w/f//AAAAAHAA+wMIAAAAAAAAAHAIAABwAPsDCAAAAAEA
AABACwAAHwAHBDwAAAAAAP0DNAAAACEAAABkAAAAIQAAAGQAAABQlg0BAgAAAADT/78AAAAAZwAA
ACDW/78AAAAAAAAAAAAB0sgfABMEPAAAAAAA/QM0AAAAZAAAAGQAAABkAAAAZAAAAFCWDQECAAAA
ANP/vwAAAABnAAAAINb/vwAAAAAAAAAAAAHSyB8A/wMUAAAAAgAABAwAAAAAAAAAAAAAAAIAAAAf
AAgEPAAAAAAA/QM0AAAAQgAAAGQAAABCAAAAZAAAAFCWDQECAAAAANP/vwAAAAAUAAAAINb/vwAA
AAAAAAAAAADSyA8AiBNwAAAADwCKE2gAAAAAALoPFAAAAF8AXwBfAFAAUABUADIAMAAwADEAAACL
E0QAAAAPAIgXPAAAAAAAiRc0AAAAAAAAAAAAAAAAAAAAWAIAAAABAQABAQAAAQEBAAEAAAAAAAAA
aM8AAAAAAAAAAAAAgAIB4D8A2Q8MAAAAAADaDwQAAAAAACUADwDwD38PAAAAAPMDFAAAAAMAAAAA
AAAAAgAAAAABAAAAAAAAAACfDwQAAAAGAAAAAACoD2MAAABJbnRlcnByZXRhdGlvbiBvZiBtb2Rl
bCByZXN1bHRzIHRoYXQgc2hvdyBjaGFuZ2VzIGluCyB0aGUgZWZmZWN0aXZlIGNsaW1hdGUgc2Vu
c2l0aXZpdHkgd2l0aCB0aW1lLgsAAKEPFAAAAGQAAAAAAAAAAABkAAAAAQAAAAEAAACqDxQAAABj
AAAABgAAAAkIAAABAAAAAAAAABAAnw8EAAAABQAAAAAAqA9oAAAAQWx0ZXJuYXRpdmUgdGl0bGU6
IElzIHRoZSBjbGltYXRlIHNlbnNpdGl2aXR5IGRlYWQ/DQ1TLiBDLiBCLiBSYXBlciwgQWxmcmVk
IFdlZ2VuZXIgSW5zdGl0dXRlLCBHZXJtYW55DQ0AAKEPJgAAAGkAAAAAAAAAAAA0AAAAAgAAAAIA
AQAAAAEAAAABADQAAAAAAAAAAACqD0gAAAA+AAAABgAAAAkIAAAFAAAABwAAAAMACQgAAAkAAAAG
AAAACQgAAAgAAAAHAAAAAwAJCAAAFAAAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAAAAQAAAAAAAAA
AgAAAAIBAAAAAAAAAACfDwQAAAAAAAAAAACoDx8AAABEZWZpbml0aW9uIGZvciBzbGFiIG9jZWFu
IEFHQ01zAAChDxwAAAAgAAAAAAAAAAAAHwAAAAAAAgAkAAEAAAAAAAAAAACqDxIAAAAZAAAAAAAA
AAcAAAABAAAAAwAQAJ8PBAAAAAEAAAAAAKAPAgMAAFQAaABlACAAYwBsAGkAbQBhAHQAZQAgAHMA
ZQBuAHMAaQB0AGkAdgBpAHQAeQAgAGkAcwAgAGQAZQBmAGkAbgBlAGQAIABhAHMAIAB0AGgAZQAg
AGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcAYQByAG0AaQBuAGcAIABmAG8AcgAgAGEAIABkAG8A
dQBiAGwAaQBuAGcAIABvAGYAIAB0AGgAZQAgAGMAbwBuAGMAZQBuAHQAcgBhAHQAaQBvAG4AIABv
AGYAIABDAE8AMgAsACAAZQB4AHAAcgBlAHMAcwBlAGQAIABhAHMADQANAETwVAAyAHgAIAA9ACAA
RPBRADIAeAAgAC8AIABs8CwADQANACAAIAAgACAAdwBoAGUAcgBlACAARPBRADIAeAAgAGkAcwAg
AHQAaABlACAAZABvAHUAYgBsAGUAZAAgAEMATwAyACAAZgBvAHIAYwBpAG4AZwAgACgAVwBtAC0A
MgApACAAYQBuAGQAIABs8CAAaQBzACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsAIABwAGEAcgBh
AG0AZQB0AGUAcgAgACgAVwBtAC0AMgAvAEsAKQAuACAADQBCAHUAdAAgAHQAaABlAHMAZQAgAG0A
aQB4AGUAZAAgAGwAYQB5AGUAcgAgAG8AYwBlAGEAbgAgAG0AbwBkAGUAbABzACAAYQByAGUAIABu
AG8AdAAgAHQAaABlACAAbwBuAGUAcwAgAHUAcwBlAGQAIABmAG8AcgAgAHQAcgBhAG4AcwBpAGUA
bgB0ACAAcwBpAG0AdQBsAGEAdABpAG8AbgBzACAAYQBuAGQAIAB0AGgAZQAgAGYAZQBlAGQAYgBh
AGMAawBzAC8AcwBlAG4AcwBpAHQAaQB2AGkAdAB5ACAAbQBhAHkAIABiAGUAIABkAGkAZgBmAGUA
cgBlAG4AdAAgACgAcwBlAGUAIABCAG8AZQByACAAYQBuAGQAIABZAHUAIAAyADAAMAAzAGEAKQAu
ACAAAAChD2ABAAB4AAAAAAAAEAAAWgARAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBcAAAA
AAABEAAAAABaAJwAAAAAAAAQAABaAGcAAAAAAAIAGAABAAAAAAAKABgA5/8QAAAAAAACABgAAQAA
AAAAggABABgAAQAAAAAAAgAYAAIAAAAAAAoAGADn/wMAAAAAAAIAGAABAAAAAACCAAEAGAABAAAA
AAACABgAAwAAAAAACgAYAOf/AgAAAAAAAgAYAAEAAAAAAIIAAQAYAA0AAAAAAAIAGAABAAAAAACC
AAEAGAABAAAAAAACABgAAgAAAAAACgAYAOf/EgAAAAAAAgAYAAEAAAAAAAoAGADn/wwAAAAAAAIA
GAACAAAAAAAKABgAHgAGAAAAAAACABgAAQAAAAAAggABABgAHgAAAAAAAgAYAAIAAAAAAAoAGAAe
AKAAAAAAAAIAGAACAAAAAAACACAAAACqDxQAAACBAQAABgAAAAkIAAABAAAAAAAAAAAA8wMUAAAA
BwAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAAAKgPJQAAAEVmZmVjdGl2ZSBjbGltYXRl
IHNlbnNpdGl2aXR5IGRlZmluZWQAAKEPFAAAACYAAAAAAAAAAAAmAAAAAAACACQAEACfDwQAAAAB
AAAAAACgD4oEAABNAHUAcgBwAGgAeQAgACgAMQA5ADkANQApACAAZABlAGYAaQBuAGUAZAAgAHQA
aABlACAAGCBlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBzAGkAdABp
AHYAaQB0AHkAGSAsACAAZABlAG4AbwB0AGUAZAAgAETwVAAyAHgAZQBmAGYALAAgAGEAcwAgAHQA
aABlACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAcgBlAHMAcABvAG4AcwBlACAAdABvACAAYQAg
AGQAbwB1AGIAbABpAG4AZwAgAG8AZgAgAEMATwAyACAAdwBoAGkAYwBoACAAdwBvAHUAbABkACAA
bwBjAGMAdQByACAAaQBmACAAdABoAGUAIABBAE8ARwBDAE0AIAB3AGEAcwAgAHIAdQBuACAAdABv
ACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAdwBpAHQAaAAgAGYAZQBlAGQAYgBhAGMAawAgAHMA
dAByAGUAbgBnAHQAaABzACwAIAByAGUAYQBsAGkAcwBlAGQAIABhAHQAIABhACAAcABhAHIAdABp
AGMAdQBsAGEAcgAgAHQAaQBtAGUALAAgAGgAZQBsAGQAIABmAGkAeABlAGQALgAgAFQAaABlACAA
ZQBxAHUAYQB0AGkAbwBuACAAZgBvAHIAIAB0AGgAZQAgAGYAZQBlAGQAYgBhAGMAawAgAHAAYQBy
AGEAbQBlAHQAZQByACAAdABoAGUAbgAgAGkAbgBjAGwAdQBkAGUAcwAgAGEAIABoAGUAYQB0ACAA
ZgBsAHUAeAAgAGIAZQBsAG8AdwAgAHQAaABlACAAYQB0AG0AbwBzAHAAaABlAHIAZQAgAGQAZQBu
AG8AdABlAGQAIABE8EYALAANAA0AbPAgAD0AIAAoAETwUQAgAC0AIABE8EYAKQAgAC8AIABE8FQA
DQANACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABhAG4AZAAgAHQAaABlACAAZQBmAGYAZQBj
AHQAaQB2AGUAIABjAGwAaQBtAGEAdABlACAAcwBlAG4AcwBpAHQAaQB2AGkAdAB5ACAAYwBhAG4A
IABiAGUAIABlAHgAcAByAGUAcwBzAGUAZAAgAGEAcwANAA0ARPBUADIAeABlAGYAZgAgAD0AIABE
8FEAMgB4ACAALgAgAETwVAAgAC8AIAAoAETwUQAgAC0AIABE8EYAKQAuAA0ADQBUAGgAZQAgAGUA
ZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAg
AGkAcwAgAHQAaAB1AHMAIABhACAAaAB5AHAAbwB0AGgAZQB0AGkAYwBhAGwAIABjAG8AbgBjAGUA
cAB0ACAAZQB2AGUAbgAgAHcAaQB0AGgAaQBuACAAdABoAGUAIAByAGUAYQBsAG0AIABvAGYAIABj
AGwAaQBtAGEAdABlACAAbQBvAGQAZQBsAGwAaQBuAGcAAAChD/ABAABbAQAAAAAAEAAAWgATAAAA
AAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBIAAAAAAABEAAAAABaAAEAAAAAAAAQAABaACEAAAAA
AAEYAAAAAAEAWgABAAAAAAAAGAAAAQBaAGwAAAAAAAAQAABaAEMAAAAAAAIAFAABAAAAAACCAAEA
FAABAAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAACgAUAB4AMQAAAAAAAgAUAAEAAAAAAAoAFADn
/9oAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQABAAAAAAAAgAUAAEA
AAAAAIIAAQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFAACAAAAAAACABQAAQAAAAAACgAUAOf/AgAA
AAAAAgAUAAEAAAAAAIIAAQAUAEwAAAAAAAIAFAABAAAAAACCAAEAFAABAAAAAAACABQAAgAAAAAA
CgAUAOf/AwAAAAAACgAUAB4AAwAAAAAAAgAUAAEAAAAAAIIAAQAUAAEAAAAAAAIAFAACAAAAAAAK
ABQA5/8DAAAAAAACABQAAQAAAAAAggABABQABQAAAAAAAgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIA
FAABAAAAAACCAAEAFABxAAAAAAACABQAAACqDxQAAABFAgAABgAAAAkIAAABAAAAAAAAAAAA8wMU
AAAACAAAAAQAAAACAAAABAEAAAAAAAAAAJ8PBAAAAAAAAAAAAKoPCgAAAAEAAAABAAAAAAAQAJ8P
BAAAAAEAAAAAAKoPCgAAAAEAAAABAAAAAAAAAPMDFAAAAAUAAAAEAAAAAAAAAAEBAAAAAAAAAADz
AxQAAAAJAAAABAAAAAAAAAAFAQAAAAAAAAAA8wMUAAAACgAAAAQAAAAAAAAABgEAAAAAAAAAAPMD
FAAAAAsAAAAEAAAAAAAAAAcBAAAAAAAAAADzAxQAAAAMAAAABAAAAAAAAAAIAQAAAAAAAAAA8wMU
AAAADQAAAAQAAAAAAAAACQEAAAAAAAAAAPMDFAAAAA4AAAAEAAAAAAAAAAoBAAAAAAAAAADzAxQA
AAAPAAAABAAAAAAAAAALAQAAAAAAAAAA8wMUAAAAEQAAAAQAAAAAAAAADQEAAAAAAAAAAPMDFAAA
ABAAAAAEAAAAAAAAAAwBAAAAAAAAAADqAwAAAAAPAO4DBQcAAAIA7wMYAAAAEAAAAAAAAAAAAAAA
AAAAgAAAAAAHAAADDwAMBLUGAAAPAALwrQYAAMAACPAIAAAACgAAAA44AAAPAAPwRQYAAA8ABPAo
AAAAAQAJ8BAAAAAAAAAAfAAAAAAAAAAAAAAAAgAK8AgAAAAAOAAABQAAAA8ABPAkAQAAsgQK8AgA
AAADOAAAAAoAAEMAC/D8AAAAfwCAAIAABEEUAAAABcHkAAAABgEBAAAACgBDAE0ASQBQADIALgBQ
AEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAw
ADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAAAQAnACABI+
Cw8ABPDVAAAAogwK8AgAAAAEOAAAAAoAAKMAC/A8AAAAgADAHn8AhQACAAAAhwAGAAAAvwACAAIA
gQEEAAAIgwEAAAAIvwEAABAAwAEBAAAI/wEAAAgAAQICAAAIAAAQ8AgAAACQAEACABSwAQ8ADfBp
AAAAAACfDwQAAAAEAAAAAACoDzEAAABEZWZpbml0aW9uIHVzZWQgZm9yIHRoZSBUQVIgd2l0aCB0
aGUgTUFHSUNDIG1vZGVsAAChDxwAAAAyAAAAAAAAAAAAMQAAAAEAAAABAAEAAAAAAAAADwAE8CQB
AACyBArwCAAAAAg4AAAACgAAQwAL8PwAAAB/AIAAgAAEQRUAAAAFweQAAAAGAQEAAAAPAGMAYQBw
AHQAaQBvAG4AZABlAGYALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAA
AKALAABAF4oPDwAE8F4AAABCAQrwCAAAAAk4AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQA
AAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAACAE0BHQEQAGDwAE
8F4AAABCAQrwCAAAAAo4AACACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAA
EADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAACAEoBHQESAEDwAE8F4AAABCAQrwCAAA
AAs4AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpK
AAD/ARgAGAABAgIAAAgAABDwCAAAAAAGoBHQEQAGDwAE8F4AAABCAQrwCAAAAAw4AAAACgAAkwAL
8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIA
AAgAABDwCAAAABAF0BEAEhAFDwAE8IoAAACiDArwCAAAAA04AAAACgAAowAL8DwAAACAAFAVfAWF
AAIAAACHAAYAAAC/AAIAAgCBAQQAAAiDAQAAAAi/AQAAEADAAQEAAAj/AQAACAABAgIAAAgAABDw
CAAAAAYFBg56DiYGDwAN8B4AAAAAAJ8PBAAAAAQAAAAAAKoPCgAAAAEAAAABAAAAAAAPAATwrgAA
AKIMCvAIAAAADjgAAAAKAACTAAvwNgAAAIAA8BR8BYUAAgAAAIcABgAAAL8AAgACAIEB/wAAAL8B
AAAQAMAB/wAAAP8BCAAIAAECAgAACAAAEPAIAAAA8AMAEvQV/AUPAA3wSAAAAAAAnw8EAAAABAAA
AAAAqA8WAAAAUmFuZ2UgdXNlZA0xLjcgLSA0LjIgSwAAoQ8WAAAAFwAAAAAAAAAAABcAAAAAAAQA
/wAA/g8ABPBIAAAAEgAK8AgAAAABOAAAAAwAAIMAC/AwAAAAgQEAAAAIgwEFAAAIkwGOn4sAlAHe
vWgAvwESABIA/wEAAAgABAMJAAAAPwMBAAEAEADwByAAAAD///8AAAAAAICAgAAAAAAAu+DjADMz
mQAAmZkAmcwAAAAAchcQAAAAAQAQAKZnAAAQABAAon8AAAAA9Q8cAAAADAEAACAFAAOCZwAAr4YA
AAEAAAARAAAAAQAAAA8A6AP0FwAAAQDpAygAAACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAAAAAA
AAAAAAEAAAAAAAABDwDyA2IBAAAvAMgPDAAAADAA0g8EAAAAAAAAAA8A1QeYAAAAAAC3D0QAAABU
AGkAbQBlAHMAAAAAACBLADAP0gAEAAB/AOBpfwCgB38AoAf/vyDW/7+Q0nQAAAAIAQCndACMiv+/
kNJ0AAAAAAAEABAAtw9EAAAAUwB5AG0AYgBvAGwAAAAgSwAwD9IABAAAfwDgaX8AoAd/AKAH/78g
1v+/kNJ0AAAACAEAp3QAjIr/v5DSdAAAAAIABAAAAKQPCgAAAIAAYAAAAP////8AAKUPDAAAAAAA
AAguAAAALQAyAC8ASwApAC4AIAANAEIAdQB0ACAAdABoAGUAcwBlACAAbQBpAHgAZQBkACAAbABh
AHkAZQByACAAbwBjAGUAYQBuACAAbQBvAGQAZQBsAHMAIABhAHIAZQAgAG4AbwB0ACAAdABoAGUA
IABvAG4AZQBzACAAdQBzAGUAZAAgAGYAbwByACAAdAByAGEAbgBzAGkAZQBuAHQAIABzAGkAbQB1
AGwAYQB0AGkAbwBuAHMAIABhAG4AZAAgAHQAaABlACAAZgBlAGUAZABiAGEAYwBrAHMALwBzAGUA
bgBzAGkAdABpAHYAaQB0AHkAIABtAGEAeQAgAGIAZQAgAGQAaQBmAGYAZQByAGUAbgB0ACAAKABz
AGUAZQAgAEIAbwBlAHIAIABhAG4AZAAgAFkAdQAgADIAMAAwADMAYQApAC4AIAAAAKEPYAEAAHgA
AAAAAAAQAABaABEAAAAAAAEYAAAAAAEAWgABAAAAAAAAGAAAAQBaAFwAAAAAAAEQAAAAAFoAnAAA
AAAAABAAAFoAZwAAAAAAAgAYAAEAAAAAAAoAGADn/xAAAAAAAAIAGAABAAAAAACCAAEAGAABAAAA
AAACABgAAgAAAAAACgAYAOf/AwAAAAAAAgAYAAEAAAAAAIIAAQAYAAEAAAAAAAIAGAADAAAAAAAK
ABgA5wACAAAAAACpDwoAAAAHAAAAAgAJBAAAQACjD24AAAAFAP/9PwAAACIgAABkAAAAAAAAAGQA
AAAAAAAAAABAAgAAAAACAAAA///vAAAAAAD///////8YAAAAAAEAAAAFAAAgASABAAAAAAAFAABA
AkACAAAAAAAFAABgA2ADAAAAAAAFAACABIAEAAAAAA8ACwSQBAAADwAA8IgEAAAAAAbwiAAAAAJA
AAAQAAAARAAAAA8AAAABAAAABwAAAAMAAAAEAAAABAAAAAcAAAANAAAABAAAAA4AAAAEAAAADwAA
AAgAAAAFAAAABQAAAAYAAAAFAAAABwAAAAgAAAAIAAAABAAAAAkAAAAIAAAACgAAAAYAAAALAAAA
CAAAAAwAAAAQAAAAAgAAAAcAAABfAQHwnAMAAEIAB/AkAAAAAwQ5a2NELlyvvkl7haaPjE/r/wDc
AQAABAAAAAAAAAAAANYgQgAH8CQAAAADBBscg+XAqczqfvEFHwRTkOP/APIyAAABAAAA3AEAAAAA
1iBCAAfwJAAAAAMEoAKDb6SD/0PfVKG7XHMrrv8AKicAAAEAAADONAAAAADWIEIAB/AkAAAAAwSE
rtUxOgIUWjeVcJWZQejB/wCIIAAAAQAAAPhbAAAAANYgQgAH8CQAAAADBL+rRWBucOkGN1TPdCvN
1df/AFQnAAABAAAAgHwAAAAA1iBCAAfwJAAAAAMEkphPo1MZsAisHv6/pYFHv/8AbFsAAAEAAADU
owAAAADWIEIAB/AkAAAAAwQTWVEZVSx2hfp5wnOppA1a/wCXIwAAAQAAAED/AAAAANYgQgAH8CQA
AAADBCPAbjB1g7xG+v8It1Qn8Ur/ACh8AAABAAAA1yIBAAAA1iBCAAfwJAAAAAMEvAMBoh7SBOVG
t6T+R3XBaf8A8aIAAAEAAAD/ngEAAADWIEIAB/AkAAAAAwR6AVRDk3HceuzOonfI9JZK/wCbAQAA
BAAAAPBBAgAAANYgQgAH8CQAAAADBPH1KzftNZRtXNUQYzcjvAT/ACgPAAABAAAAi0MCAAAA1iBC
AAfwJAAAAAME0JuhmfBkvO/8WX99LDFJbf8AyxUAAAEAAACzUgIAAADWIEIAB/AkAAAAAwQO37DT
iuAwOjzjlnLUILnx/wCEDwAAAQAAAH5oAgAAANYgQgAH8CQAAAADBDo2FGaw/53PHI5m11DiPo7/
AIgNAAABAAAAAngCAAAA1iBCAAfwJAAAAAMEneNXUCS/qBJMFalUVI6Smv8ASB0AAAEAAACKhQIA
AADWIEIAB/AkAAAAAwSrHyUjuAQdr0+I+ttray7p/wBDDgAAAQAAANKiAgAAANYgQgAH8CQAAAAD
BD4UXU61G8KVSxnVjbIjFW3/AJklAAABAAAAFbECAAAA1iBCAAfwJAAAAAMEYkPDuc2oppo3uAkq
l0Ud7/8AQDAAAAEAAACu1gIAAADWIAIAB/AkAAAAAAAAAAAAAAAAAAAAAAAAAAAA/wAAAAAAAAAA
AAAAAAAAANYgQgAH8CQAAAADBFJaDjll93U5pH128ngrXRj/AIsbAAABAAAA7gYDAAAA1iBCAAfw
JAAAAAMEoig2Jk33QJHuMaGg+MElff8AqQEAAAEAAAB5IgMAAADWIGMAC/AkAAAAgQEEAAAIgwEA
AAAIvwEQABAAwAEBAAAI/wEIAAgAAQICAAAIIAAa8QgAAAD/AAAA/4AAAEAAHvEQAAAA//////8A
AAACAAAI9wAAEB8A8A8cAAAAAADzAxQAAAACAAAAAAAAAAAAAAAAAACAAAAAAA8A0AfzAQAAHwAU
BBwAAAAAABUEFAAAALoddewAypo7Mk7NyQDKmjsBAQEBDwD6A2cAAAAAAP4DAwAAAAABAAAA/QM0
AAAAZAAAAGQAAABkAAAAZAAAAAAAAACw0v+/AAB0AIAfegAAAAAAsNL/v8D7//9w/f//AAAAAHAA
+wMIAAAAAAAAAHAIAABwAPsDCAAAAAEAAABACwAAHwAHBDwAAAAAAP0DNAAAACEAAABkAAAAIQAA
AGQAAABQlg0BAgAAAADT/78AAAAAZwAAACDW/78AAAAAAAAAAAAB0sgfABMEPAAAAAAA/QM0AAAA
ZAAAAGQAAABkAAAAZAAAAFCWDQECAAAAANP/vwAAAABnAAAAINb/vwAAAAAAAAAAAAHSyB8A/wMU
AAAAAgAABAwAAAAAAAAAAAAAAAIAAAAfAAgEPAAAAAAA/QM0AAAAQgAAAGQAAABCAAAAZAAAAFCW
DQECAAAAANP/vwAAAAAUAAAAINb/vwAAAAAAAAAAAADSyA8AiBNwAAAADwCKE2gAAAAAALoPFAAA
AF8AXwBfAFAAUABUADIAMAAwADEAAACLE0QAAAAPAIgXPAAAAAAAiRc0AAAAAAAAAAAAAAAAAAAA
WAIAAAABAQABAQAAAQEBAAEAAAAAAAAAaM8AAAAAAAAAAAAAgAIB4D8A2Q8MAAAAAADaDwQAAAAA
ACUADwDwD38PAAAAAPMDFAAAAAMAAAAAAAAAAgAAAAABAAAAAAAAAACfDwQAAAAGAAAAAACoD2MA
AABJbnRlcnByZXRhdGlvbiBvZiBtb2RlbCByZXN1bHRzIHRoYXQgc2hvdyBjaGFuZ2VzIGluCyB0
aGUgZWZmZWN0aXZlIGNsaW1hdGUgc2Vuc2l0aXZpdHkgd2l0aCB0aW1lLgsAAKEPFAAAAGQAAAAA
AAAAAABkAAAAAQAAAAEAAACqDxQAAABjAAAABgAAAAkIAAABAAAAAAAAABAAnw8EAAAABQAAAAAA
qA9oAAAAQWx0ZXJuYXRpdmUgdGl0bGU6IElzIHRoZSBjbGltYXRlIHNlbnNpdGl2aXR5IGRlYWQ/
DQ1TLiBDLiBCLiBSYXBlciwgQWxmcmVkIFdlZ2VuZXIgSW5zdGl0dXRlLCBHZXJtYW55DQ0AAKEP
JgAAAGkAAAAAAAAAAAA0AAAAAgAAAAIAAQAAAAEAAAABADQAAAAAAAAAAACqD0gAAAA+AAAABgAA
AAkIAAAFAAAABwAAAAMACQgAAAkAAAAGAAAACQgAAAgAAAAHAAAAAwAJCAAAFAAAAAYAAAAJCAAA
AQAAAAAAAAAAAPMDFAAAAAQAAAAAAAAAAgAAAAIBAAAAAAAAAACfDwQAAAAAAAAAAACoDx8AAABE
ZWZpbml0aW9uIGZvciBzbGFiIG9jZWFuIEFHQ01zAAChDxwAAAAgAAAAAAAAAAAAHwAAAAAAAgAk
AAEAAAAAAAAAAACqDxIAAAAZAAAAAAAAAAcAAAABAAAAAwAQAJ8PBAAAAAEAAAAAAKAPAgMAAFQA
aABlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAgAGkAcwAgAGQAZQBm
AGkAbgBlAGQAIABhAHMAIAB0AGgAZQAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcAYQByAG0A
aQBuAGcAIABmAG8AcgAgAGEAIABkAG8AdQBiAGwAaQBuAGcAIABvAGYAIAB0AGgAZQAgAGMAbwBu
AGMAZQBuAHQAcgBhAHQAaQBvAG4AIABvAGYAIABDAE8AMgAsACAAZQB4AHAAcgBlAHMAcwBlAGQA
IABhAHMADQANAETwVAAyAHgAIAA9ACAARPBRADIAeAAgAC8AIABs8CwADQANACAAIAAgACAAdwBo
AGUAcgBlACAARPBRADIAeAAgAGkAcwAgAHQAaABlACAAZABvAHUAYgBsAGUAZAAgAEMATwAyACAA
ZgBvAHIAYwBpAG4AZwAgACgAVwBtAC0AMgApACAAYQBuAGQAIABs8CAAaQBzACAAdABoAGUAIABm
AGUAZQBkAGIAYQBjAGsAIABwAGEAcgBhAG0AZQB0AGUAcgAgACgAVwBtAC0AMgAvAEsAKQAuACAA
DQBCAHUAdAAgAHQAaABlAHMAZQAgAG0AaQB4AGUAZAAgAGwAYQB5AGUAcgAgAG8AYwBlAGEAbgAg
AG0AbwBkAGUAbABzACAAYQByAGUAIABuAG8AdAAgAHQAaABlACAAbwBuAGUAcwAgAHUAcwBlAGQA
IABmAG8AcgAgAHQAcgBhAG4AcwBpAGUAbgB0ACAAcwBpAG0AdQBsAGEAdABpAG8AbgBzACAAYQBu
AGQAIAB0AGgAZQAgAGYAZQBlAGQAYgBhAGMAawBzAC8AcwBlAG4AcwBpAHQAaQB2AGkAdAB5ACAA
bQBhAHkAIABiAGUAIABkAGkAZgBmAGUAcgBlAG4AdAAgACgAcwBlAGUAIABCAG8AZQByACAAYQBu
AGQAIABZAHUAIAAyADAAMAAzAGEAKQAuACAAAAChD2ABAAB4AAAAAAAAEAAAWgARAAAAAAABGAAA
AAABAFoAAQAAAAAAABgAAAEAWgBcAAAAAAABEAAAAABaAJwAAAAAAAAQAABaAGcAAAAAAAIAGAAB
AAAAAAAKABgA5/8QAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAAAgAYAAIAAAAAAAoAGADn/wMA
AAAAAAIAGAABAAAAAACCAAEAGAABAAAAAAACABgAAwAAAAAACgAYAOf/AgAAAAAAAgAYAAEAAAAA
AIIAAQAYAA0AAAAAAAIAGAABAAAAAACCAAEAGAABAAAAAAACABgAAgAAAAAACgAYAOf/EgAAAAAA
AgAYAAEAAAAAAAoAGADn/wwAAAAAAAIAGAACAAAAAAAKABgAHgAGAAAAAAACABgAAQAAAAAAggAB
ABgAHgAAAAAAAgAYAAIAAAAAAAoAGAAeAKAAAAAAAAIAGAACAAAAAAACACAAAACqDxQAAACBAQAA
BgAAAAkIAAABAAAAAAAAAAAA8wMUAAAABwAAAAAAAAACAAAAAwEAAAAAAAAAAJ8PBAAAAAAAAAAA
AKgPJQAAAEVmZmVjdGl2ZSBjbGltYXRlIHNlbnNpdGl2aXR5IGRlZmluZWQAAKEPFAAAACYAAAAA
AAAAAAAmAAAAAAACACQAEACfDwQAAAABAAAAAACgD4oEAABNAHUAcgBwAGgAeQAgACgAMQA5ADkA
NQApACAAZABlAGYAaQBuAGUAZAAgAHQAaABlACAAGCBlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABp
AG0AYQB0AGUAIABzAGUAbgBzAGkAdABpAHYAaQB0AHkAGSAsACAAZABlAG4AbwB0AGUAZAAgAETw
VAAyAHgAZQBmAGYALAAgAGEAcwAgAHQAaABlACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAcgBl
AHMAcABvAG4AcwBlACAAdABvACAAYQAgAGQAbwB1AGIAbABpAG4AZwAgAG8AZgAgAEMATwAyACAA
dwBoAGkAYwBoACAAdwBvAHUAbABkACAAbwBjAGMAdQByACAAaQBmACAAdABoAGUAIABBAE8ARwBD
AE0AIAB3AGEAcwAgAHIAdQBuACAAdABvACAAZQBxAHUAaQBsAGkAYgByAGkAdQBtACAAdwBpAHQA
aAAgAGYAZQBlAGQAYgBhAGMAawAgAHMAdAByAGUAbgBnAHQAaABzACwAIAByAGUAYQBsAGkAcwBl
AGQAIABhAHQAIABhACAAcABhAHIAdABpAGMAdQBsAGEAcgAgAHQAaQBtAGUALAAgAGgAZQBsAGQA
IABmAGkAeABlAGQALgAgAFQAaABlACAAZQBxAHUAYQB0AGkAbwBuACAAZgBvAHIAIAB0AGgAZQAg
AGYAZQBlAGQAYgBhAGMAawAgAHAAYQByAGEAbQBlAHQAZQByACAAdABoAGUAbgAgAGkAbgBjAGwA
dQBkAGUAcwAgAGEAIABoAGUAYQB0ACAAZgBsAHUAeAAgAGIAZQBsAG8AdwAgAHQAaABlACAAYQB0
AG0AbwBzAHAAaABlAHIAZQAgAGQAZQBuAG8AdABlAGQAIABE8EYALAANAA0AbPAgAD0AIAAoAETw
UQAgAC0AIABE8EYAKQAgAC8AIABE8FQADQANACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABh
AG4AZAAgAHQAaABlACAAZQBmAGYAZQBjAHQAaQB2AGUAIABjAGwAaQBtAGEAdABlACAAcwBlAG4A
cwBpAHQAaQB2AGkAdAB5ACAAYwBhAG4AIABiAGUAIABlAHgAcAByAGUAcwBzAGUAZAAgAGEAcwAN
AA0ARPBUADIAeABlAGYAZgAgAD0AIABE8FEAMgB4ACAALgAgAETwVAAgAC8AIAAoAETwUQAgAC0A
IABE8EYAKQAuAA0ADQBUAGgAZQAgAGUAZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAg
AHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAgAGkAcwAgAHQAaAB1AHMAIABhACAAaAB5AHAAbwB0AGgA
ZQB0AGkAYwBhAGwAIABjAG8AbgBjAGUAcAB0ACAAZQB2AGUAbgAgAHcAaQB0AGgAaQBuACAAdABo
AGUAIAByAGUAYQBsAG0AIABvAGYAIABjAGwAaQBtAGEAdABlACAAbQBvAGQAZQBsAGwAaQBuAGcA
AAChD/ABAABbAQAAAAAAEAAAWgATAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBIAAAAAAAB
EAAAAABaAAEAAAAAAAAQAABaACEAAAAAAAEYAAAAAAEAWgABAAAAAAAAGAAAAQBaAGwAAAAAAAAQ
AABaAEMAAAAAAAIAFAABAAAAAACCAAEAFAABAAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAACgAU
AB4AMQAAAAAAAgAUAAEAAAAAAAoAFADn/9oAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQA
AQAAAAAAggABABQABAAAAAAAAgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFAAC
AAAAAAACABQAAQAAAAAACgAUAOf/AgAAAAAAAgAUAAEAAAAAAIIAAQAUAEwAAAAAAAIAFAABAAAA
AACCAAEAFAABAAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAACgAUAB4AAwAAAAAAAgAUAAEAAAAA
AIIAAQAUAAEAAAAAAAIAFAACAAAAAAAKABQA5/8DAAAAAAACABQAAQAAAAAAggABABQABQAAAAAA
AgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFABxAAAAAAACABQAAACqDxQAAABF
AgAABgAAAAkIAAABAAAAAAAAAAAA8wMUAAAACAAAAAQAAAACAAAABAEAAAAAAAAAAJ8PBAAAAAAA
AAAAAKoPCgAAAAEAAAABAAAAAAAQAJ8PBAAAAAEAAAAAAKoPCgAAAAEAAAABAAAAAAAAAPMDFAAA
AAUAAAAEAAAAAAAAAAEBAAAAAAAAAADzAxQAAAAJAAAABAAAAAAAAAAFAQAAAAAAAAAA8wMUAAAA
CgAAAAQAAAAAAAAABgEAAAAAAAAAAPMDFAAAAAsAAAAEAAAAAAAAAAcBAAAAAAAAAADzAxQAAAAM
AAAABAAAAAAAAAAIAQAAAAAAAAAA8wMUAAAADQAAAAQAAAAAAAAACQEAAAAAAAAAAPMDFAAAAA4A
AAAEAAAAAAAAAAoBAAAAAAAAAADzAxQAAAAPAAAABAAAAAAAAAALAQAAAAAAAAAA8wMUAAAAEQAA
AAQAAAAAAAAADQEAAAAAAAAAAPMDFAAAABAAAAAEAAAAAAAAAAwBAAAAAAAAAADqAwAAAAAPAO4D
JAQAAAIA7wMYAAAAEAAAAAAAAAAAAAAAAAAAgAAAAAAHAAADDwAMBNQDAAAPAALwzAMAACAACPAI
AAAABQAAAAY8AAAPAAPwZAMAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAAAAAAAAAAAAAAAAAAgAK8AgA
AAAAPAAABQAAAA8ABPAkAQAAsgQK8AgAAAADPAAAAAoAAEMAC/D8AAAAfwCAAIAABEESAAAABcHk
AAAABgEBAAAADABMAGEAeQBvAHUAdAAyAC4AUABJAEMAVAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMA
aAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBB
AEUARAA6AAAAAAAQ8AgAAAAAAAAArQzgEA8ABPBYAAAAQgEK8AgAAAAEPAAAAAoAAIMAC/AwAAAA
hQACAAAAhwABAAAARAEEAAAAfwEAAAEAvwEAABAAwAEBAAAI/wEYABgAAQICAAAIAAAQ8AgAAADw
BpAMkAxACA8ABPBYAAAAQgEK8AgAAAAFPAAAAAoAAIMAC/AwAAAAhQACAAAAhwABAAAARAEEAAAA
fwEAAAEAvwEAABAAwAEBAAAI/wEYABgAAQICAAAIAAAQ8AgAAADgDUALQAvADw8ABPBAAQAAogwK
8AgAAAAGPAAAAAoAAKMAC/A8AAAAgADA/4EEhQACAAAAhwAGAAAAvwACAAIAgQEEAAAIgwEAAAAI
vwEAABAAwAH/AAAA/wEIAAgAAQICAAAIAAAQ8AgAAAAQBSAN4hXOCQ8ADfDUAAAAAACfDwQAAAAE
AAAAAACoD1wAAABGb3IgdXNlIGluIA10aGUgUG9saWN5bWFrZXJzIFN1bW1hcnkNbWF5YmUgdGhl
IFRDUiBpcyBhDWJldHRlciBtZXRyaWMgZm9yIG1vZGVsIA1Db21wYXJpc29uLgAAoQ8WAAAAXQAA
AAAAAAAAAF0AAAAAAAQA/wAA/gAAqg8+AAAACAAAAAAAAAACAAAAAQAAAAMAAQAAAAAAAAABAAAA
AQAAAAAAQwAAAAAAAAACAAAAAQAAAAMADAAAAAAAAAAPAATwSAAAABIACvAIAAAAATwAAAAMAACD
AAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1oAL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA
8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kAAJmZAJnMAAAPAO4D3wcAAAIA7wMYAAAAEAAA
AAAAAAAAAAAAAAAAgAAAAAAHAAADDwAMBI8HAAAPAALwhwcAAMAACPAIAAAACwAAAA84AAAPAAPw
HwcAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAfAAAAAAAAAAAAAAAAgAK8AgAAAAAOAAABQAAAA8ABPAk
AQAAsgQK8AgAAAADOAAAAAoAAEMAC/D8AAAAfwCAAIAABEEUAAAABcHkAAAABgEBAAAACgBDAE0A
SQBQADIALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEAYwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgAEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgA
AAAQAnACABI+Cw8ABPDVAAAAogwK8AgAAAAEOAAAAAoAAKMAC/A8AAAAgADAHn8AhQACAAAAhwAG
AAAAvwACAAIAgQEEAAAIgwEAAAAIvwEAABAAwAEBAAAI/wEAAAgAAQICAAAIAAAQ8AgAAACQAEAC
ABSwAQ8ADfBpAAAAAACfDwQAAAAEAAAAAACoDzEAAABEZWZpbml0aW9uIHVzZWQgZm9yIHRoZSBU
QVIgd2l0aCB0aGUgTUFHSUNDIG1vZGVsAAChDxwAAAAyAAAAAAAAAAAAMQAAAAEAAAABAAEAAAAA
AAAADwAE8CQBAACyBArwCAAAAAg4AAAACgAAQwAL8PwAAAB/AIAAgAAEQRUAAAAFweQAAAAGAQEA
AAAPAGMAYQBwAHQAaQBvAG4AZABlAGYALgBQAEkAQwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5ADQARQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABE
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoA
AAAAABDwCAAAAKALAABAF4oPDwAE8F4AAABCAQrwCAAAAAk4AAAACgAAkwAL8DYAAACFAAIAAACH
AAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAACAE
0BHQEQAGDwAE8F4AAABCAQrwCAAAAAo4AACACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/
AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAACAEoBHQESAEDwAE8F4A
AABCAQrwCAAAAAs4AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADA
Af8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAAAAGoBHQEQAGDwAE8F4AAABCAQrwCAAAAAw4
AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/
ARgAGAABAgIAAAgAABDwCAAAABAF0BEAEhAFDwAE8IoAAACiDArwCAAAAA04AAAACgAAowAL8DwA
AACAAFAVfAWFAAIAAACHAAYAAAC/AAIAAgCBAQQAAAiDAQAAAAi/AQAAEADAAQEAAAj/AQAACAAB
AgIAAAgAABDwCAAAAAYFBg56DiYGDwAN8B4AAAAAAJ8PBAAAAAQAAAAAAKoPCgAAAAEAAAABAAAA
AAAPAATwrgAAAKIMCvAIAAAADjgAAAAKAACTAAvwNgAAAIAA8BR8BYUAAgAAAIcABgAAAL8AAgAC
AIEB/wAAAL8BAAAQAMAB/wAAAP8BCAAIAAECAgAACAAAEPAIAAAA8AMAEvQV/AUPAA3wSAAAAAAA
nw8EAAAABAAAAAAAqA8WAAAAUmFuZ2UgdXNlZA0xLjcgLSA0LjIgSwAAoQ8WAAAAFwAAAAAAAAAA
ABcAAAAAAAQA/wAA/g8ABPDSAAAAogwK8AgAAAAPOAAAAAoAAKMAC/A8AAAAgABwJfYGhQACAAAA
hwAGAAAAvwACAAIAgQEEAAAIgwEAAAAIvwEAABAAwAH/AAAA/wEIAAgAAQICAAAIAAAQ8AgAAAAA
D/AD6RAmEA8ADfBmAAAAAACfDwQAAAAEAAAAAACoDywAAABJcyB0aGlzIGFuIGFwcHJvcHJpYXRl
IHByYWN0aWNhbCBkZWZpbml0aW9uPwAAoQ8eAAAALQAAAAAAAAAAACwAAAAAAAQA/wAA/gEAAAAA
AAAADwAE8EgAAAASAArwCAAAAAE4AAAADAAAgwAL8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69
aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAHIAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZ
AACZmQCZzAAAAAByFxQAAAABABAA64YAABAAIAATowAA554AAAAA9Q8cAAAADAEAACAFAAPHhgAA
+qoAAAEAAAARAAAAAQAAAA8A6AP0FwAAAQDpAygAAACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAA
AAAAAAAAAAEAAAAAAAABDwDyA2IBAAAvAMgPDAAAADAA0g8EAAAAAAAAAA8A1QeYAAAAAAC3D0QA
AABUAGkAbQBlAHMAAAAAACBLADAP0gAEAAB/AOBpfwCgB38AoAf/vyDW/7+Q0nQAAAAIAQCndACM
iv+/kNJ0AAAAAAAEABAAtw9EAAAAUwB5AG0AYgBvAGwAAAAgSwAwD9IABAAAfwDgaX8AoAd/AKAH
/78g1v+/kNJ0AAAACAEAp3QAjIr/v5DSdAAAAAIABAAAAKQPCgAAAIAAYAAAAP////8AAKUPDAAA
AAAAAAguAAAAAgAAAAAAqQ8KAAAABwAAAAIACQQAAEAAow9uAAAABQD//T8AAAAiIAAAZAAAAAAA
AABkAAAAAAAAAAAAQAIAAAAAAgAAAP//7wAAAAAA////////GAAAAAABAAAABQAAIAEgAQAAAAAA
BQAAQAJAAgAAAAAABQAAYANgAwAAAAAABQAAgASABAAAAAAPAAsEkAQAAA8AAPCIBAAAAAAG8IgA
AAACQAAAEAAAAEQAAAAPAAAAAQAAAAcAAAADAAAABAAAAAQAAAAHAAAADQAAAAQAAAAOAAAABAAA
AA8AAAAIAAAABQAAAAUAAAAGAAAABQAAAAcAAAAIAAAACAAAAAQAAAAJAAAACAAAAAoAAAAGAAAA
CwAAAAgAAAAMAAAAEAAAAAIAAAAHAAAAXwEB8JwDAABCAAfwJAAAAAMEOWtjRC5cr75Je4Wmj4xP
6/8A3AEAAAQAAAAAAAAAAADWIEIAB/AkAAAAAwQbHIPlwKnM6n7xBR8EU5Dj/wDyMgAAAQAAANwB
AAAAANYgQgAH8CQAAAADBKACg2+kg/9D31Shu1xzK67/AConAAABAAAAzjQAAAAA1iBCAAfwJAAA
AAMEhK7VMToCFFo3lXCVmUHowf8AiCAAAAEAAAD4WwAAAADWIEIAB/AkAAAAAwS/q0VgbnDpBjdU
z3QrzdXX/wBUJwAAAQAAAIB8AAAAANYgQgAH8CQAAAADBJKYT6NTGbAIrB7+v6WBR7//AGxbAAAB
AAAA1KMAAAAA1iBCAAfwJAAAAAMEE1lRGVUsdoX6ecJzqaQNWv8AlyMAAAEAAABA/wAAAADWIEIA
B/AkAAAAAwQjwG4wdYO8Rvr/CLdUJ/FK/wAofAAAAQAAANciAQAAANYgQgAH8CQAAAADBLwDAaIe
0gTlRrek/kd1wWn/APGiAAABAAAA/54BAAAA1iBCAAfwJAAAAAMEegFUQ5Nx3HrszqJ3yPSWSv8A
mwEAAAQAAADwQQIAAADWIEIAB/AkAAAAAwTx9Ss37TWUbVzVEGM3I7wE/wAoDwAAAQAAAItDAgAA
ANYgQgAH8CQAAAADBNCboZnwZLzv/Fl/fSwxSW3/AMsVAAABAAAAs1ICAAAA1iBCAAfwJAAAAAME
Dt+w04rgMDo845Zy1CC58f8AhA8AAAEAAAB+aAIAAADWIEIAB/AkAAAAAwQ6NhRmsP+dzxyOZtdQ
4j6O/wCIDQAAAQAAAAJ4AgAAANYgQgAH8CQAAAADBJ3jV1Akv6gSTBWpVFSOkpr/AEgdAAABAAAA
ioUCAAAA1iBCAAfwJAAAAAMEqx8lI7gEHa9PiPrba2su6f8AQw4AAAEAAADSogIAAADWIEIAB/Ak
AAAAAwQ+FF1OtRvClUsZ1Y2yIxVt/wCZJQAAAQAAABWxAgAAANYgQgAH8CQAAAADBGJDw7nNqKaa
N7gJKpdFHe//AEAwAAABAAAArtYCAAAA1iACAAfwJAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAA
AAAAAAAAAAAAAADWIEIAB/AkAAAAAwRSWg45Zfd1OaR9dvJ4K10Y/wCLGwAAAQAAAO4GAwAAANYg
QgAH8CQAAAADBKIoNiZN90CR7jGhoPjBJX3/AKkBAAABAAAAeSIDAAAA1iBjAAvwJAAAAIEBBAAA
CIMBAAAACL8BEAAQAMABAQAACP8BCAAIAAECAgAACCAAGvEIAAAA/wAAAP+AAABAAB7xEAAAAP//
////AAAAAgAACPcAABAfAPAPHAAAAAAA8wMUAAAAAgAAAAAAAAAAAAAAAAAAgAAAAAAPANAH8wEA
AB8AFAQcAAAAAAAVBBQAAAC6HXXsAMqaOzJOzckAypo7AQEBAQ8A+gNnAAAAAAD+AwMAAAAAAQAA
AP0DNAAAAGQAAABkAAAAZAAAAGQAAAAAAAAAsNL/vwAAdACAH3oAAAAAALDS/78w+///cP3//wAA
AABwAPsDCAAAAAAAAABwCAAAcAD7AwgAAAABAAAAQAsAAB8ABwQ8AAAAAAD9AzQAAAAhAAAAZAAA
ACEAAABkAAAAUJYNAQIAAAAA0/+/AAAAAGcAAAAg1v+/AAAAAAAAAAAAAdLIHwATBDwAAAAAAP0D
NAAAAGQAAABkAAAAZAAAAGQAAABQlg0BAgAAAADT/78AAAAAZwAAACDW/78AAAAAAAAAAAAB0sgf
AP8DFAAAAAIAAAQMAAAAAAAAAAAAAAACAAAAHwAIBDwAAAAAAP0DNAAAAEIAAABkAAAAQgAAAGQA
AABQlg0BAgAAAADT/78AAAAAFAAAACDW/78AAAAAAAAAAAAA0sgPAIgTcAAAAA8AihNoAAAAAAC6
DxQAAABfAF8AXwBQAFAAVAAyADAAMAAxAAAAixNEAAAADwCIFzwAAAAAAIkXNAAAAAAAAAAAAAAA
AAAAAFgCAAAAAQEAAQEAAAEBAQABAAAAAAAAAGjPAAAAAAAAAAAAAIACAeA/ANkPDAAAAAAA2g8E
AAAAAAAlAA8A8A9/DwAAAADzAxQAAAADAAAAAAAAAAIAAAAAAQAAAAAAAAAAnw8EAAAABgAAAAAA
qA9jAAAASW50ZXJwcmV0YXRpb24gb2YgbW9kZWwgcmVzdWx0cyB0aGF0IHNob3cgY2hhbmdlcyBp
bgsgdGhlIGVmZmVjdGl2ZSBjbGltYXRlIHNlbnNpdGl2aXR5IHdpdGggdGltZS4LAAChDxQAAABk
AAAAAAAAAAAAZAAAAAEAAAABAAAAqg8UAAAAYwAAAAYAAAAJCAAAAQAAAAAAAAAQAJ8PBAAAAAUA
AAAAAKgPaAAAAEFsdGVybmF0aXZlIHRpdGxlOiBJcyB0aGUgY2xpbWF0ZSBzZW5zaXRpdml0eSBk
ZWFkPw0NUy4gQy4gQi4gUmFwZXIsIEFsZnJlZCBXZWdlbmVyIEluc3RpdHV0ZSwgR2VybWFueQ0N
AAChDyYAAABpAAAAAAAAAAAANAAAAAIAAAACAAEAAAABAAAAAQA0AAAAAAAAAAAAqg9IAAAAPgAA
AAYAAAAJCAAABQAAAAcAAAADAAkIAAAJAAAABgAAAAkIAAAIAAAABwAAAAMACQgAABQAAAAGAAAA
CQgAAAEAAAAAAAAAAADzAxQAAAAEAAAAAAAAAAIAAAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8f
AAAARGVmaW5pdGlvbiBmb3Igc2xhYiBvY2VhbiBBR0NNcwAAoQ8cAAAAIAAAAAAAAAAAAB8AAAAA
AAIAJAABAAAAAAAAAAAAqg8SAAAAGQAAAAAAAAAHAAAAAQAAAAMAEACfDwQAAAABAAAAAACgDwID
AABUAGgAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBzAGkAdABpAHYAaQB0AHkAIABpAHMAIABk
AGUAZgBpAG4AZQBkACAAYQBzACAAdABoAGUAIABlAHEAdQBpAGwAaQBiAHIAaQB1AG0AIAB3AGEA
cgBtAGkAbgBnACAAZgBvAHIAIABhACAAZABvAHUAYgBsAGkAbgBnACAAbwBmACAAdABoAGUAIABj
AG8AbgBjAGUAbgB0AHIAYQB0AGkAbwBuACAAbwBmACAAQwBPADIALAAgAGUAeABwAHIAZQBzAHMA
ZQBkACAAYQBzAA0ADQBE8FQAMgB4ACAAPQAgAETwUQAyAHgAIAAvACAAbPAsAA0ADQAgACAAIAAg
AHcAaABlAHIAZQAgAETwUQAyAHgAIABpAHMAIAB0AGgAZQAgAGQAbwB1AGIAbABlAGQAIABDAE8A
MgAgAGYAbwByAGMAaQBuAGcAIAAoAFcAbQAtADIAKQAgAGEAbgBkACAAbPAgAGkAcwAgAHQAaABl
ACAAZgBlAGUAZABiAGEAYwBrACAAcABhAHIAYQBtAGUAdABlAHIAIAAoAFcAbQAtADIALwBLACkA
LgAgAA0AQgB1AHQAIAB0AGgAZQBzAGUAIABtAGkAeABlAGQAIABsAGEAeQBlAHIAIABvAGMAZQBh
AG4AIABtAG8AZABlAGwAcwAgAGEAcgBlACAAbgBvAHQAIAB0AGgAZQAgAG8AbgBlAHMAIAB1AHMA
ZQBkACAAZgBvAHIAIAB0AHIAYQBuAHMAaQBlAG4AdAAgAHMAaQBtAHUAbABhAHQAaQBvAG4AcwAg
AGEAbgBkACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsAcwAvAHMAZQBuAHMAaQB0AGkAdgBpAHQA
eQAgAG0AYQB5ACAAYgBlACAAZABpAGYAZgBlAHIAZQBuAHQAIAAoAHMAZQBlACAAQgBvAGUAcgAg
AGEAbgBkACAAWQB1ACAAMgAwADAAMwBhACkALgAgAAAAoQ9gAQAAeAAAAAAAABAAAFoAEQAAAAAA
ARgAAAAAAQBaAAEAAAAAAAAYAAABAFoAXAAAAAAAARAAAAAAWgCcAAAAAAAAEAAAWgBnAAAAAAAC
ABgAAQAAAAAACgAYAOf/EAAAAAAAAgAYAAEAAAAAAIIAAQAYAAEAAAAAAAIAGAACAAAAAAAKABgA
5/8DAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAAAgAYAAMAAAAAAAoAGADn/wIAAAAAAAIAGAAB
AAAAAACCAAEAGAANAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAAAgAYAAIAAAAAAAoAGADn/xIA
AAAAAAIAGAABAAAAAAAKABgA5/8MAAAAAAACABgAAgAAAAAACgAYAB4ABgAAAAAAAgAYAAEAAAAA
AIIAAQAYAB4AAAAAAAIAGAACAAAAAAAKABgAHgCgAAAAAAACABgAAgAAAAAAAgAgAAAAqg8UAAAA
gQEAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAAAAcAAAAAAAAAAgAAAAMBAAAAAAAAAACfDwQAAAAA
AAAAAACoDyUAAABFZmZlY3RpdmUgY2xpbWF0ZSBzZW5zaXRpdml0eSBkZWZpbmVkAAChDxQAAAAm
AAAAAAAAAAAAJgAAAAAAAgAkABAAnw8EAAAAAQAAAAAAoA+KBAAATQB1AHIAcABoAHkAIAAoADEA
OQA5ADUAKQAgAGQAZQBmAGkAbgBlAGQAIAB0AGgAZQAgABggZQBmAGYAZQBjAHQAaQB2AGUAIABj
AGwAaQBtAGEAdABlACAAcwBlAG4AcwBpAHQAaQB2AGkAdAB5ABkgLAAgAGQAZQBuAG8AdABlAGQA
IABE8FQAMgB4AGUAZgBmACwAIABhAHMAIAB0AGgAZQAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAg
AHIAZQBzAHAAbwBuAHMAZQAgAHQAbwAgAGEAIABkAG8AdQBiAGwAaQBuAGcAIABvAGYAIABDAE8A
MgAgAHcAaABpAGMAaAAgAHcAbwB1AGwAZAAgAG8AYwBjAHUAcgAgAGkAZgAgAHQAaABlACAAQQBP
AEcAQwBNACAAdwBhAHMAIAByAHUAbgAgAHQAbwAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcA
aQB0AGgAIABmAGUAZQBkAGIAYQBjAGsAIABzAHQAcgBlAG4AZwB0AGgAcwAsACAAcgBlAGEAbABp
AHMAZQBkACAAYQB0ACAAYQAgAHAAYQByAHQAaQBjAHUAbABhAHIAIAB0AGkAbQBlACwAIABoAGUA
bABkACAAZgBpAHgAZQBkAC4AIABUAGgAZQAgAGUAcQB1AGEAdABpAG8AbgAgAGYAbwByACAAdABo
AGUAIABmAGUAZQBkAGIAYQBjAGsAIABwAGEAcgBhAG0AZQB0AGUAcgAgAHQAaABlAG4AIABpAG4A
YwBsAHUAZABlAHMAIABhACAAaABlAGEAdAAgAGYAbAB1AHgAIABiAGUAbABvAHcAIAB0AGgAZQAg
AGEAdABtAG8AcwBwAGgAZQByAGUAIABkAGUAbgBvAHQAZQBkACAARPBGACwADQANAGzwIAA9ACAA
KABE8FEAIAAtACAARPBGACkAIAAvACAARPBUAA0ADQAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAYQBuAGQAIAB0AGgAZQAgAGUAZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMA
ZQBuAHMAaQB0AGkAdgBpAHQAeQAgAGMAYQBuACAAYgBlACAAZQB4AHAAcgBlAHMAcwBlAGQAIABh
AHMADQANAETwVAAyAHgAZQBmAGYAIAA9ACAARPBRADIAeAAgAC4AIABE8FQAIAAvACAAKABE8FEA
IAAtACAARPBGACkALgANAA0AVABoAGUAIABlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0
AGUAIABzAGUAbgBzAGkAdABpAHYAaQB0AHkAIABpAHMAIAB0AGgAdQBzACAAYQAgAGgAeQBwAG8A
dABoAGUAdABpAGMAYQBsACAAYwBvAG4AYwBlAHAAdAAgAGUAdgBlAG4AIAB3AGkAdABoAGkAbgAg
AHQAaABlACAAcgBlAGEAbABtACAAbwBmACAAYwBsAGkAbQBhAHQAZQAgAG0AbwBkAGUAbABsAGkA
bgBnAAAAoQ/wAQAAWwEAAAAAABAAAFoAEwAAAAAAARgAAAAAAQBaAAEAAAAAAAAYAAABAFoASAAA
AAAAARAAAAAAWgABAAAAAAAAEAAAWgAhAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBsAAAA
AAAAEAAAWgBDAAAAAAACABQAAQAAAAAAggABABQAAQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAA
AAoAFAAeADEAAAAAAAIAFAABAAAAAAAKABQA5//aAAAAAAACABQAAQAAAAAAggABABQABAAAAAAA
AgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggAB
ABQAAgAAAAAAAgAUAAEAAAAAAAoAFADn/wIAAAAAAAIAFAABAAAAAACCAAEAFABMAAAAAAACABQA
AQAAAAAAggABABQAAQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeAAMAAAAAAAIAFAAB
AAAAAACCAAEAFAABAAAAAAACABQAAgAAAAAACgAUAOf/AwAAAAAAAgAUAAEAAAAAAIIAAQAUAAUA
AAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQAcQAAAAAAAgAUAAAAqg8U
AAAARQIAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAAAAgAAAAEAAAAAgAAAAQBAAAAAAAAAACfDwQA
AAAAAAAAAACqDwoAAAABAAAAAQAAAAAAEACfDwQAAAABAAAAAACqDwoAAAABAAAAAQAAAAAAAADz
AxQAAAAFAAAABAAAAAAAAAABAQAAAAAAAAAA8wMUAAAACQAAAAQAAAAAAAAABQEAAAAAAAAAAPMD
FAAAAAoAAAAEAAAAAAAAAAYBAAAAAAAAAADzAxQAAAALAAAABAAAAAAAAAAHAQAAAAAAAAAA8wMU
AAAADAAAAAQAAAAAAAAACAEAAAAAAAAAAPMDFAAAAA0AAAAEAAAAAAAAAAkBAAAAAAAAAADzAxQA
AAAOAAAABAAAAAAAAAAKAQAAAAAAAAAA8wMUAAAADwAAAAQAAAAAAAAACwEAAAAAAAAAAPMDFAAA
ABEAAAAEAAAAAAAAAA0BAAAAAAAAAADzAxQAAAAQAAAABAAAAAAAAAAMAQAAAAAAAAAA6gMAAAAA
AAByFwgAAAABABAAOqsAAAAA9Q8cAAAABgEAACAFAAMWqwAANsMAAAEAAAARAAAAAQAAAA8A6AP0
FwAAAQDpAygAAACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAAAAAAAAAAAAEAAAAAAAABDwDyA2IB
AAAvAMgPDAAAADAA0g8EAAAAAAAAAA8A1QeYAAAAAAC3D0QAAABUAGkAbQBlAHMAAAAAACBLADAP
0gAEAAB/AOBpfwCgB38AoAf/vyDW/7+Q0nQAAAAIAQBSAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAUA//////////8DAAAAEI2B
ZJtPzxGG6gCqALkp6AAAAAAAAAAAAAAAAIDQ7B6JbcQBXwEAAEAEAAAAAAAAUABpAGMAdAB1AHIA
ZQBzAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABIAAgH/
////BQAAAP////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFAAAAIiQDAAAA
AABQAG8AdwBlAHIAUABvAGkAbgB0ACAARABvAGMAdQBtAGUAbgB0AAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAKAACAf////8EAAAA/////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAACYBAADc/wAAAAAAAAUAUwB1AG0AbQBhAHIAeQBJAG4AZgBvAHIAbQBhAHQAaQBvAG4AAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAoAAIBAQAAAAIAAAD/////AAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAARQEAAPAzAAAAAAAAAQIAAAICAAADAgAABAIAAAUCAAAGAgAABwIA
AAgCAAAJAgAACgIAAAsCAAAMAgAADQIAAA4CAAAPAgAAEAIAABECAAASAgAAEwIAABQCAAAVAgAA
FgIAABcCAAAYAgAAGQIAANwBAAAdAgAA/f////3////+/////v///9sBAAD9////IgIAACMCAAAk
AgAAJQIAACYCAAAnAgAAKAIAACkCAAAqAgAAKwIAACwCAAAtAgAALgIAAC8CAAAwAgAAMQIAADIC
AAAzAgAANAIAADUCAAA2AgAANwIAAP7/////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
//////////////////////////////////////+BAQAAggEAAIMBAACEAQAAhQEAAIYBAACHAQAA
iAEAAIkBAACKAQAAiwEAAIwBAACNAQAAjgEAAI8BAACQAQAAkQEAAJIBAACTAQAAlAEAAJUBAACW
AQAAlwEAAJgBAACZAQAAmgEAAJsBAACcAQAAnQEAAJ4BAACfAQAAoAEAAKEBAACiAQAAowEAAKQB
AAClAQAApgEAAKcBAACoAQAAqQEAAKoBAACrAQAArAEAAK0BAACuAQAArwEAALABAACxAQAAsgEA
ALMBAAC0AQAAtQEAALYBAAC3AQAAuAEAALkBAAC6AQAAuwEAALwBAAC9AQAAvgEAAL8BAADAAQAA
wQEAAMIBAADDAQAAxAEAAAAAAADGAQAAxwEAAMgBAADJAQAAygEAAMsBAADMAQAAzQEAAM4BAADP
AQAA0AEAANEBAADSAQAA0wEAANQBAADVAQAA1gEAANcBAADYAQAA2QEAANoBAADrAQAA/v///90B
AADeAQAA4QEAAP3////9////4gEAAOMBAAD7AQAA5QEAAOYBAADnAQAA6AEAAOkBAADqAQAA/v//
/+wBAADtAQAA7gEAAO8BAADwAQAA8QEAAPIBAADzAQAA9AEAAPUBAAD2AQAA9wEAAPgBAAD5AQAA
+gEAAPwBAAAhAgAA/QEAAP4BAAD/AQAAAAIAAAUARABvAGMAdQBtAGUAbgB0AFMAdQBtAG0AYQBy
AHkASQBuAGYAbwByAG0AYQB0AGkAbwBuAAAAAAAAAAAAAAA4AAIA////////////////AAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANQDAAAAAAAAQwB1AHIAcgBlAG4AdAAg
AFUAcwBlAHIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABoAAgD/////
//////////8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAKgAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAP///////////////wAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA////////////////AAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAIAAAADAAAABAAAAAUAAAAGAAAABwAAAAgA
AAAJAAAACgAAAAsAAAAMAAAADgAAAP7///8PAAAAEAAAAP7/////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
////////////////////////////////////////////////////////////////////////////
//////////////////////////////////9vciBzbGFiIG9jZWFuIEFHQ01zACYAAABFZmZlY3Rp
dmUgY2xpbWF0ZSBzZW5zaXRpdml0eSBkZWZpbmVkABgAAABQb3dlclBvaW50IFByZXNlbnRhdGlv
bgAYAAAAUG93ZXJQb2ludCBQcmVzZW50YXRpb24AGAAAAFBvd2VyUG9pbnQgUHJlc2VudGF0aW9u
ABgAAABQb3dlclBvaW50IFByZXNlbnRhdGlvbgAYAAAAUG93ZXJQb2ludCBQcmVzZW50YXRpb24A
GAAAAFBvd2VyUG9pbnQgUHJlc2VudGF0aW9uABgAAABQb3dlclBvaW50IFByZXNlbnRhdGlvbgAY
AAAAUG93ZXJQb2ludCBQcmVzZW50YXRpb24AGAAAAFBvd2VyUG9pbnQgUHJlc2VudGF0aW9uABgA
AABQbwAA9g8iAAAAFAAAAF/AkeO4/wAACgD0AwMAQ1RUaW0gT3Nib3JuCAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAB3ZXJQb2ludCBQcmVzZW50YXRpb24AGAAAAFBvd2VyUG9pbnQgUHJlc2VudGF0
aW9uAAwQAAAGAAAAHgAAAAsAAABGb250cyBVc2VkAAMAAAACAAAAHgAAABAAAABEZXNpZ24gVGVt
cGxhdGUAAwAAAAEAAAAeAAAADQAAAFNsaQEBAAACAQAAAwEAAAQBAAAFAQAABgEAAAcBAAAIAQAA
CQEAAAoBAAALAQAADAEAAA0BAAAOAQAADwEAABABAAARAQAAEgEAABMBAAAUAQAAFQEAABYBAAAX
AQAAGAEAABkBAAAaAQAAGwEAABwBAAAdAQAAHgEAAB8BAAAgAQAAIQEAACIBAAAjAQAAJAEAACUB
AABhAQAAJwEAACgBAAApAQAAKgEAACsBAAAsAQAALQEAAC4BAAAvAQAAMAEAADEBAAAyAQAAMwEA
ADQBAAA1AQAANgEAADcBAAA4AQAAOQEAADoBAAA7AQAAPAEAAD0BAAA+AQAAPwEAAEABAABBAQAA
QgEAAEMBAADFAQAAYAEAAEYBAABHAQAASAEAAEkBAABKAQAASwEAAEwBAABNAQAATgEAAE8BAABQ
AQAAUQEAAFIBAABTAQAAVAEAAFUBAABWAQAAVwEAAFgBAABZAQAAWgEAAFsBAABcAQAAXQEAAF4B
AAD+////HwIAAH0BAABiAQAAYwEAAGQBAABlAQAAZgEAAGcBAABoAQAAaQEAAGoBAABrAQAAbAEA
AG0BAABuAQAAbwEAAHABAABxAQAAcgEAAHMBAAB0AQAAdQEAAHYBAAB3AQAAeAEAAHkBAAB6AQAA
ewEAAHwBAAB+AQAA5AEAAH8BAACAAQAA/wIAAAAAAAIAGAABAAAAAACCAAEAGAANAAAAAAACABgA
AQAAAAAAggABABgAAQAAAAAAAgAYAAIAAAAAAAoAGADn/xIAAAAAAAIAGAABAAAAAAAKABgA5/8M
AAAAAAACABgAAgAAAAAACgAYAB4ABgAAAAAAAgAYAAEAAAAAAIIAAQAYAB4AAAAAAAIAGAACAAAA
AAAKABgAHgCgAAAAAAACABgAAgAAAAAAAgAgAAAAqg8UAAAAgQEAAAYAAAAJCAAAAQAAAAAAAAAA
APMDFAAAAAcAAAAAAAAAAgAAAAMBAAAAAAAAAACfDwQAAAAAAAAAAACoDyUAAABFZmZlY3RpdmUg
Y2xpbWF0ZSBzZW5zaXRpdml0eSBkZWZpbmVkAAChDxQAAAAmAAAAAAAAAAAAJgAAAAAAAgAkABAA
nw8EAAAAAQAAAAAAoA+KBAAATQB1AHIAcABoAHkAIAAoADEAOQA5ADUAKQAgAGQAZQBmAGkAbgBl
AGQAIAB0AGgAZQAgABggZQBmAGYAZQBjAHQAaQB2AGUAIABjAGwAaQBtAGEAdABlACAAcwBlAG4A
cwBpAHQAaQB2AGkAdAB5ABkgLAAgAGQAZQBuAG8AdABlAGQAIABE8FQAMgB4AGUAZgBmACwAIABh
AHMAIAB0AGgAZQAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHIAZQBzAHAAbwBuAHMAZQAgAHQA
bwAgAGEAIABkAG8AdQBiAGwAaQBuAGcAIABvAGYAIABDAE8AMgAgAHcAaABpAGMAaAAgAHcAbwB1
AGwAZAAgAG8AYwBjAHUAcgAgAGkAZgAgAHQAaABlACAAQQBPAEcAQwBNACAAdwBhAHMAIAByAHUA
bgAgAHQAbwAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcAaQB0AGgAIABmAGUAZQBkAGIAYQBj
AGsAIABzAHQAcgBlAG4AZwB0AGgAcwAsACAAcgBlAGEAbABpAHMAZQBkACAAYQB0ACAAYQAgAHAA
YQByAHQAaQBjAHUAbABhAHIAIAB0AGkAbQBlACwAIABoAGUAbABkACAAZgBpAHgAZQBkAC4AIABU
AGgAZQAgAGUAcQB1AGEAdABpAG8AbgAgAGYAbwByACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsA
IABwAGEAcgBhAG0AZQB0AGUAcgAgAHQAaABlAG4AIABpAG4AYwBsAHUAZABlAHMAIABhACAAaABl
AGEAdAAgAGYAbAB1AHgAIABiAGUAbABvAHcAIAB0AGgAZQAgAGEAdABtAG8AcwBwAGgAZQByAGUA
IABkAGUAbgBvAHQAZQBkACAARPBGACwADQANAGzwIAA9ACAAKABE8FEAIAAtACAARPBGACkAIAAv
ACAARPBUAA0ADQAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAYQBuAGQAIAB0AGgAZQAgAGUA
ZgBmAGUAYwB0AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAg
AGMAYQBuACAAYgBlACAAZQB4AHAAcgBlAHMAcwBlAGQAIABhAHMADQANAETwVAAyAHgAZQBmAGYA
IAA9ACAARPBRADIAeAAgAC4AIABE8FQAIAAvACAAKABE8FEAIAAtACAARPBGACkALgANAA0AVABo
AGUAIABlAGYAZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBzAGkAdABpAHYA
aQB0AHkAIABpAHMAIAB0AGgAdQBzACAAYQAgAGgAeQBwAG8AdABoAGUAdABpAGMAYQBsACAAYwBv
AG4AYwBlAHAAdAAgAGUAdgBlAG4AIAB3AGkAdABoAGkAbgAgAHQAaABlACAAcgBlAGEAbABtACAA
bwBmACAAYwBsAGkAbQBhAHQAZQAgAG0AbwBkAGUAbABsAGkAbgBnAAAAoQ/wAQAAWwEAAAAAABAA
AFoAEwAAAAAAARgAAAAAAQBaAAEAAAAAAAAYAAABAFoASAAAAAAAARAAAAAAWgABAAAAAAAAEAAA
WgAhAAAAAAABGAAAAAABAFoAAQAAAAAAABgAAAEAWgBsAAAAAAAAEAAAWgBDAAAAAAACABQAAQAA
AAAAggABABQAAQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeADEAAAAAAAIAFAABAAAA
AAAKABQA5//aAAAAAAACABQAAQAAAAAAggABABQABAAAAAAAAgAUAAEAAAAAAIIAAQAUAAQAAAAA
AAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQAAgAAAAAAAgAUAAEAAAAAAAoA
FADn/wIAAAAAAAIAFAABAAAAAACCAAEAFABMAAAAAAACABQAAQAAAAAAggABABQAAQAAAAAAAgAU
AAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeAAMAAAAAAAIAFAABAAAAAACCAAEAFAABAAAAAAACABQA
AgAAAAAACgAUAOf/AwAAAAAAAgAUAAEAAAAAAIIAAQAUAAUAAAAAAAIAFAABAAAAAACCAAEAFAAE
AAAAAAACABQAAQAAAAAAggABABQAcQAAAAAAAgAUAAAAqg8UAAAARQIAAAYAAAAJCAAAAQAAAAAA
AAAAAPMDFAAAAAgAAAAEAAAAAgAAAAQBAAAAAAAAAACfDwQAAAAAAAAAAACqDwoAAAABAAAAAQAA
AAAAEACfDwQAAAABAAAAAACqDwoAAAABAAAAAQAAAAAAAADzAxQAAAAFAAAABAAAAAAAAAABAQAA
AAAAAAAA8wMUAAAACQAAAAQAAAAAAAAABQEAAAAAAAAAAPMDFAAAAAoAAAAEAAAAAAAAAAYBAAAA
AAAAAADzAxQAAAALAAAABAAAAAAAAAAHAQAAAAAAAAAA8wMUAAAADAAAAAQAAAAAAAAACAEAAAAA
AAAAAPMDFAAAAA0AAAAEAAAAAAAAAAkBAAAAAAAAAADzAxQAAAAOAAAABAAAAAAAAAAKAQAAAAAA
AAAA8wMUAAAADwAAAAQAAAAAAAAACwEAAAAAAAAAAPMDFAAAABEAAAAEAAAAAAAAAA0BAAAAAAAA
AADzAxQAAAAQAAAABAAAAAAAAAAMAQAAAAAAAAAA6gMAAAAADwDuAxcEAAACAO8DGAAAABAAAAAA
AAAAAAAAAAAAAIAAAAAABwAAAw8ADATHAwAADwAC8L8DAACwAAjwCAAAAAUAAAAGPAAADwAD8FcD
AAAPAATwKAAAAAEACfAQAAAAAAAAAAAAAAAAAAAAAAAAAAIACvAIAAAAADwAAAUAAAAPAATwJAEA
ALIECvAIAAAAAzwAAAAKAABDAAvw/AAAAH8AgACAAARBEgAAAAXB5AAAAAYBAQAAAAwATABhAHkA
bwB1AHQAMgAuAFAASQBDAFQAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAA
IAAgACAAMAAwADAARAA3ADkANABFAAwATQBhAGMAaQBuAHQAbwBzAGgAIABIAEQAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIABCAEIAQQA3ADMAQQBFAEQAOgAAAAAAEPAIAAAA
AAAAAK0M4BAPAATwWAAAAEIBCvAIAAAABDwAAAAKAACDAAvwMAAAAIUAAgAAAIcAAQAAAEQBBAAA
AH8BAAABAL8BAAAQAMABAQAACP8BGAAYAAECAgAACAAAEPAIAAAA8AaQDJAMQAgPAATwWAAAAEIB
CvAIAAAABTwAAAAKAACDAAvwMAAAAIUAAgAAAIcAAQAAAEQBBAAAAH8BAAABAL8BAAAQAMABAQAA
CP8BGAAYAAECAgAACAAAEPAIAAAA4A1AC0ALwA8PAATwMwEAAKIMCvAIAAAABjwAAAAKAACjAAvw
PAAAAIAA4CcDBYUAAgAAAIcABgAAAL8AAgACAIEBBAAACIMBAAAACL8BAAAQAMAB/wAAAP8BCAAI
AAECAgAACAAAEPAIAAAAEAUgDeQVtAoPAA3wxwAAAAAAnw8EAAAABAAAAAAAqA9zAAAARm9yIHVz
ZSBpbiANdGhlIFBvbGljeW1ha2VycyBTdW1tYXJ5DW1heWJlIHRoZSBUQ1IgaXMgYQ1tb3JlIHRy
YW5zcGFyZW50IGFuZA1yZWxldmFudCBtZXRyaWMgZm9yIG1vZGVsIA1jb21wYXJpc29uLgAAoQ8W
AAAAdAAAAAAAAAAAAHQAAAAAAAQA/wAA/gAAqg8aAAAAZgAAAAAAAAACAAAAAQAAAAEADAAAAAAA
AAAPAATwSAAAABIACvAIAAAAATwAAAAMAACDAAvwMAAAAIEBAAAACIMBBQAACJMBjp+LAJQB3r1o
AL8BEgASAP8BAAAIAAQDCQAAAD8DAQABABAA8AcgAAAA////AAAAAACAgIAAAAAAALvg4wAzM5kA
AJmZAJnMAAAPAO4D3wcAAAIA7wMYAAAAEAAAAAAAAAAAAAAAAAAAgAAAAAAHAAADDwAMBI8HAAAP
AALwhwcAAMAACPAIAAAACwAAAA84AAAPAAPwHwcAAA8ABPAoAAAAAQAJ8BAAAAAAAAAAfAAAAAAA
AAAAAAAAAgAK8AgAAAAAOAAABQAAAA8ABPAkAQAAsgQK8AgAAAADOAAAAAoAAEMAC/D8AAAAfwCA
AIAABEEUAAAABcHkAAAABgEBAAAACgBDAE0ASQBQADIALgBQAEkAQwBUACAAIAAgACAAIAAgACAA
IAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAwADAAMABEADcAOQA0AEUADABNAGEA
YwBpAG4AdABvAHMAaAAgAEgARAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
AEIAQgBBADcAMwBBAEUARAA6AAAAAAAQ8AgAAAAQAnACABI+Cw8ABPDVAAAAogwK8AgAAAAEOAAA
AAoAAKMAC/A8AAAAgACgKwMFhQACAAAAhwAGAAAAvwACAAIAgQEEAAAIgwEAAAAIvwEAABAAwAEB
AAAI/wEAAAgAAQICAAAIAAAQ8AgAAACQAEAC/xOwAQ8ADfBpAAAAAACfDwQAAAAEAAAAAACoDzEA
AABEZWZpbml0aW9uIHVzZWQgZm9yIHRoZSBUQVIgd2l0aCB0aGUgTUFHSUNDIG1vZGVsAAChDxwA
AAAyAAAAAAAAAAAAMQAAAAEAAAABAAEAAAAAAAAADwAE8CQBAACyBArwCAAAAAg4AAAACgAAQwAL
8PwAAAB/AIAAgAAEQRUAAAAFweQAAAAGAQEAAAAPAGMAYQBwAHQAaQBvAG4AZABlAGYALgBQAEkA
QwBUACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgADAAMAAwAEQANwA5ADQA
RQAMAE0AYQBjAGkAbgB0AG8AcwBoACAASABEACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAg
ACAAIAAgACAAQgBCAEEANwAzAEEARQBEADoAAAAAABDwCAAAAKALAABAF4oPDwAE8F4AAABCAQrw
CAAAAAk4AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADL
AWpKAAD/ARgAGAABAgIAAAgAABDwCAAAACAE0BHQEQAGDwAE8F4AAABCAQrwCAAAAAo4AACACgAA
kwAL8DYAAACFAAIAAACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAAB
AgIAAAgAABDwCAAAACAEoBHQESAEDwAE8F4AAABCAQrwCAAAAAs4AAAACgAAkwAL8DYAAACFAAIA
AACHAAEAAABEAQQAAAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAA
AAAGoBHQEQAGDwAE8F4AAABCAQrwCAAAAAw4AAAACgAAkwAL8DYAAACFAAIAAACHAAEAAABEAQQA
AAB/AQAAAQC/AQAAEADAAf8AAADLAWpKAAD/ARgAGAABAgIAAAgAABDwCAAAABAF0BEAEhAFDwAE
8IoAAACiDArwCAAAAA04AAAACgAAowAL8DwAAACAAMAsAwWFAAIAAACHAAYAAAC/AAIAAgCBAQQA
AAiDAQAAAAi/AQAAEADAAQEAAAj/AQAACAABAgIAAAgAABDwCAAAAAYFBg56DiYGDwAN8B4AAAAA
AJ8PBAAAAAQAAAAAAKoPCgAAAAEAAAABAAAAAAAPAATwrgAAAKIMCvAIAAAADjgAAAAKAACTAAvw
NgAAAIAAYCwDBYUAAgAAAIcABgAAAL8AAgACAIEB/wAAAL8BAAAQAMAB/wAAAP8BCAAIAAECAgAA
CAAAEPAIAAAA8AMAEvQV/AUPAA3wSAAAAAAAnw8EAAAABAAAAAAAqA8WAAAAUmFuZ2UgdXNlZA0x
LjcgLSA0LjIgSwAAoQ8WAAAAFwAAAAAAAAAAABcAAAAAAAQA/wAA/g8ABPDSAAAAogwK8AgAAAAP
OAAAAAoAAKMAC/A8AAAAgABALgMFhQACAAAAhwAGAAAAvwACAAIAgQEEAAAIgwEAAAAIvwEAABAA
wAH/AAAA/wEIAAgAAQICAAAIAAAQ8AgAAAAAD/AD7hAmEA8ADfBmAAAAAACfDwQAAAAEAAAAAACo
DywAAABJcyB0aGlzIGFuIGFwcHJvcHJpYXRlIHByYWN0aWNhbCBkZWZpbml0aW9uPwAAoQ8eAAAA
LQAAAAAAAAAAACwAAAAAAAQA/wAA/gEAAAAAAAAADwAE8EgAAAASAArwCAAAAAE4AAAADAAAgwAL
8DAAAACBAQAAAAiDAQUAAAiTAY6fiwCUAd69aAC/ARIAEgD/AQAACAAEAwkAAAA/AwEAAQAQAPAH
IAAAAP///wAAAAAAgICAAAAAAAC74OMAMzOZAACZmQCZzAAAAAByFxQAAAABABAAasMAABAAIACF
3wAAZtsAAAAA9Q8cAAAADQEAACAFAANGwwAAbOcAAAEAAAARAAAAAQAAAA8A6AP0FwAAAQDpAygA
AACAFgAA4BAAAOAQAACAFgAABQAAAAoAAAAAAAAAAAAAAAEAAAAAAAABDwDyA2IBAAAvAMgPDAAA
ADAA0g8EAAAAAAAAAA8A1QeYAAAAAAC3D0QAAABUAGkAbQBlAHMAAAAAACBLADAP0gAEAAB/AOBp
fwCgB38AoAf/vyDW/7+Q0nQAAAAIAQCndACMiv+/kNJ0AAAAAQAEABAAtw9EAAAAUwB5AG0AYgBv
AGwAAAAgSwAwD9IABAAAfwDgaX8AoAd/AKAH/78g1v+/kNJ0AAAACAEAp3QAjIr/v5DSdAAAAAIA
BAAAAKQPCgAAAIAAYAAAAP////8AAKUPDAAAAAAAAAguAAAAAgAAAAAAqQ8KAAAABwAAAAIACQQA
AEAAow9uAAAABQD//T8AAAAiIAAAZAAAAAAAAABkAAAAAAAAAAAAQAIAAAAAAgAAAP//7wAAAAAA
////////GAAAAAABAAAABQAAIAEgAQAAAAAABQAAQAJAAgAAAAAABQAAYANgAwAAAAAABQAAgASA
BAAAAAAPAAsEkAQAAA8AAPCIBAAAAAAG8IgAAAACQAAAEAAAAEQAAAAPAAAAAQAAAAcAAAADAAAA
BAAAAAQAAAAHAAAADQAAAAQAAAAOAAAABAAAAA8AAAAIAAAABQAAAAUAAAACAAAABQAAAAYAAAAI
AAAABwAAAAQAAAAIAAAACAAAAAkAAAAGAAAACgAAAAgAAAAMAAAAEAAAAAsAAAAHAAAAXwEB8JwD
AABCAAfwJAAAAAMEOWtjRC5cr75Je4Wmj4xP6/8A3AEAAAQAAAAAAAAAAADWIEIAB/AkAAAAAwQb
HIPlwKnM6n7xBR8EU5Dj/wDyMgAAAQAAANwBAAAAANYgQgAH8CQAAAADBKACg2+kg/9D31Shu1xz
K67/AConAAABAAAAzjQAAAAA1iBCAAfwJAAAAAMEhK7VMToCFFo3lXCVmUHowf8AiCAAAAEAAAD4
WwAAAADWIEIAB/AkAAAAAwS/q0VgbnDpBjdUz3QrzdXX/wBUJwAAAQAAAIB8AAAAANYgQgAH8CQA
AAADBJKYT6NTGbAIrB7+v6WBR7//AGxbAAABAAAA1KMAAAAA1iBCAAfwJAAAAAMEE1lRGVUsdoX6
ecJzqaQNWv8AlyMAAAEAAABA/wAAAADWIEIAB/AkAAAAAwQjwG4wdYO8Rvr/CLdUJ/FK/wAofAAA
AQAAANciAQAAANYgQgAH8CQAAAADBLwDAaIe0gTlRrek/kd1wWn/APGiAAABAAAA/54BAAAA1iBC
AAfwJAAAAAMEegFUQ5Nx3HrszqJ3yPSWSv8AmwEAAAQAAADwQQIAAADWIEIAB/AkAAAAAwTx9Ss3
7TWUbVzVEGM3I7wE/wAoDwAAAQAAAItDAgAAANYgQgAH8CQAAAADBNCboZnwZLzv/Fl/fSwxSW3/
AMsVAAABAAAAs1ICAAAA1iBCAAfwJAAAAAMEDt+w04rgMDo845Zy1CC58f8AhA8AAAEAAAB+aAIA
AADWIEIAB/AkAAAAAwQ6NhRmsP+dzxyOZtdQ4j6O/wCIDQAAAQAAAAJ4AgAAANYgQgAH8CQAAAAD
BJ3jV1Akv6gSTBWpVFSOkpr/AEgdAAABAAAAioUCAAAA1iBCAAfwJAAAAAMEqx8lI7gEHa9PiPrb
a2su6f8AQw4AAAEAAADSogIAAADWIEIAB/AkAAAAAwQ+FF1OtRvClUsZ1Y2yIxVt/wCZJQAAAQAA
ABWxAgAAANYgQgAH8CQAAAADBGJDw7nNqKaaN7gJKpdFHe//AEAwAAABAAAArtYCAAAA1iACAAfw
JAAAAAAAAAAAAAAAAAAAAAAAAAAAAP8AAAAAAAAAAAAAAAAAAADWIEIAB/AkAAAAAwRSWg45Zfd1
OaR9dvJ4K10Y/wCLGwAAAQAAAO4GAwAAANYgQgAH8CQAAAADBKIoNiZN90CR7jGhoPjBJX3/AKkB
AAABAAAAeSIDAAAA1iBjAAvwJAAAAIEBBAAACIMBAAAACL8BEAAQAMABAQAACP8BCAAIAAECAgAA
CCAAGvEIAAAA/wAAAP+AAABAAB7xEAAAAP//////AAAAAgAACPcAABAfAPAPHAAAAAAA8wMUAAAA
AgAAAAAAAAAAAAAAAAAAgAAAAAAPANAH8wEAAB8AFAQcAAAAAAAVBBQAAAC6HXXsAMqaOzJOzckA
ypo7AQEBAQ8A+gNnAAAAAAD+AwMAAAAAAQAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAAAAAAAAsNL/
vwAAdACAH3oAAAAAALDS/7/A+///cP3//wAAAABwAPsDCAAAAAAAAABwCAAAcAD7AwgAAAABAAAA
QAsAAB8ABwQ8AAAAAAD9AzQAAAAhAAAAZAAAACEAAABkAAAAUJYNAQIAAAAA0/+/AAAAAGcAAAAg
1v+/AAAAAAAAAAAAAdLIHwATBDwAAAAAAP0DNAAAAGQAAABkAAAAZAAAAGQAAABQlg0BAgAAAADT
/78AAAAAZwAAACDW/78AAAAAAAAAAAAB0sgfAP8DFAAAAAIAAAQMAAAAAAAAAAAAAAACAAAAHwAI
BDwAAAAAAP0DNAAAAEIAAABkAAAAQgAAAGQAAABQlg0BAgAAAADT/78AAAAAFAAAACDW/78AAAAA
AAAAAAAA0sgPAIgTcAAAAA8AihNoAAAAAAC6DxQAAABfAF8AXwBQAFAAVAAyADAAMAAxAAAAixNE
AAAADwCIFzwAAAAAAIkXNAAAAAAAAAAAAAAAAAAAAFgCAAAAAQEAAQEAAAEBAQABAAAAAAAAAGjP
AAAAAAAAAAAAAIACAeA/ANkPDAAAAAAA2g8EAAAAAAAlAA8A8A9/DwAAAADzAxQAAAADAAAAAAAA
AAIAAAAAAQAAAAAAAAAAnw8EAAAABgAAAAAAqA9jAAAASW50ZXJwcmV0YXRpb24gb2YgbW9kZWwg
cmVzdWx0cyB0aGF0IHNob3cgY2hhbmdlcyBpbgsgdGhlIGVmZmVjdGl2ZSBjbGltYXRlIHNlbnNp
dGl2aXR5IHdpdGggdGltZS4LAAChDxQAAABkAAAAAAAAAAAAZAAAAAEAAAABAAAAqg8UAAAAYwAA
AAYAAAAJCAAAAQAAAAAAAAAQAJ8PBAAAAAUAAAAAAKgPaAAAAEFsdGVybmF0aXZlIHRpdGxlOiBJ
cyB0aGUgY2xpbWF0ZSBzZW5zaXRpdml0eSBkZWFkPw0NUy4gQy4gQi4gUmFwZXIsIEFsZnJlZCBX
ZWdlbmVyIEluc3RpdHV0ZSwgR2VybWFueQ0NAAChDyYAAABpAAAAAAAAAAAANAAAAAIAAAACAAEA
AAABAAAAAQA0AAAAAAAAAAAAqg9IAAAAPgAAAAYAAAAJCAAABQAAAAcAAAADAAkIAAAJAAAABgAA
AAkIAAAIAAAABwAAAAMACQgAABQAAAAGAAAACQgAAAEAAAAAAAAAAADzAxQAAAAEAAAAAAAAAAIA
AAACAQAAAAAAAAAAnw8EAAAAAAAAAAAAqA8fAAAARGVmaW5pdGlvbiBmb3Igc2xhYiBvY2VhbiBB
R0NNcwAAoQ8cAAAAIAAAAAAAAAAAAB8AAAAAAAIAJAABAAAAAAAAAAAAqg8SAAAAGQAAAAAAAAAH
AAAAAQAAAAMAEACfDwQAAAABAAAAAACgDwIDAABUAGgAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUA
bgBzAGkAdABpAHYAaQB0AHkAIABpAHMAIABkAGUAZgBpAG4AZQBkACAAYQBzACAAdABoAGUAIABl
AHEAdQBpAGwAaQBiAHIAaQB1AG0AIAB3AGEAcgBtAGkAbgBnACAAZgBvAHIAIABhACAAZABvAHUA
YgBsAGkAbgBnACAAbwBmACAAdABoAGUAIABjAG8AbgBjAGUAbgB0AHIAYQB0AGkAbwBuACAAbwBm
ACAAQwBPADIALAAgAGUAeABwAHIAZQBzAHMAZQBkACAAYQBzAA0ADQBE8FQAMgB4ACAAPQAgAETw
UQAyAHgAIAAvACAAbPAsAA0ADQAgACAAIAAgAHcAaABlAHIAZQAgAETwUQAyAHgAIABpAHMAIAB0
AGgAZQAgAGQAbwB1AGIAbABlAGQAIABDAE8AMgAgAGYAbwByAGMAaQBuAGcAIAAoAFcAbQAtADIA
KQAgAGEAbgBkACAAbPAgAGkAcwAgAHQAaABlACAAZgBlAGUAZABiAGEAYwBrACAAcABhAHIAYQBt
AGUAdABlAHIAIAAoAFcAbQAtADIALwBLACkALgAgAA0AQgB1AHQAIAB0AGgAZQBzAGUAIABtAGkA
eABlAGQAIABsAGEAeQBlAHIAIABvAGMAZQBhAG4AIABtAG8AZABlAGwAcwAgAGEAcgBlACAAbgBv
AHQAIAB0AGgAZQAgAG8AbgBlAHMAIAB1AHMAZQBkACAAZgBvAHIAIAB0AHIAYQBuAHMAaQBlAG4A
dAAgAHMAaQBtAHUAbABhAHQAaQBvAG4AcwAgAGEAbgBkACAAdABoAGUAIABmAGUAZQBkAGIAYQBj
AGsAcwAvAHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAgAG0AYQB5ACAAYgBlACAAZABpAGYAZgBlAHIA
ZQBuAHQAIAAoAHMAZQBlACAAQgBvAGUAcgAgAGEAbgBkACAAWQB1ACAAMgAwADAAMwBhACkALgAg
AAAAoQ9gAQAAeAAAAAAAABAAAFoAEQAAAAAAARgAAAAAAQBaAAEAAAAAAAAYAAABAFoAXAAAAAAA
ARAAAAAAWgCcAAAAAAAAEAAAWgBnAAAAAAACABgAAQAAAAAACgAYAOf/EAAAAAAAAgAYAAEAAAAA
AIIAAQAYAAEAAAAAAAIAGAACAAAAAAAKABgA5/8DAAAAAAACABgAAQAAAAAAggABABgAAQAAAAAA
AgAYAAMAAAAAAAoAGADn/wIAAAAAAAIAGAABAAAAAACCAAEAGAANAAAAAAACABgAAQAAAAAAggAB
ABgAAQAAAAAAAgAYAAIAAAAAAAoAGADn/xIAAAAAAAIAGAABAAAAAAAKABgA5/8MAAAAAAACABgA
AgAAAAAACgAYAB4ABgAAAAAAAgAYAAEAAAAAAIIAAQAYAB4AAAAAAAIAGAACAAAAAAAKABgAHgCg
AAAAAAACABgAAgAAAAAAAgAgAAAAqg8UAAAAgQEAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAAAAcA
AAAAAAAAAgAAAAMBAAAAAAAAAACfDwQAAAAAAAAAAACoDyUAAABFZmZlY3RpdmUgY2xpbWF0ZSBz
ZW5zaXRpdml0eSBkZWZpbmVkAAChDxQAAAAmAAAAAAAAAAAAJgAAAAAAAgAkABAAnw8EAAAAAQAA
AAAAoA+KBAAATQB1AHIAcABoAHkAIAAoADEAOQA5ADUAKQAgAGQAZQBmAGkAbgBlAGQAIAB0AGgA
ZQAgABggZQBmAGYAZQBjAHQAaQB2AGUAIABjAGwAaQBtAGEAdABlACAAcwBlAG4AcwBpAHQAaQB2
AGkAdAB5ABkgLAAgAGQAZQBuAG8AdABlAGQAIABE8FQAMgB4AGUAZgBmACwAIABhAHMAIAB0AGgA
ZQAgAGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHIAZQBzAHAAbwBuAHMAZQAgAHQAbwAgAGEAIABk
AG8AdQBiAGwAaQBuAGcAIABvAGYAIABDAE8AMgAgAHcAaABpAGMAaAAgAHcAbwB1AGwAZAAgAG8A
YwBjAHUAcgAgAGkAZgAgAHQAaABlACAAQQBPAEcAQwBNACAAdwBhAHMAIAByAHUAbgAgAHQAbwAg
AGUAcQB1AGkAbABpAGIAcgBpAHUAbQAgAHcAaQB0AGgAIABmAGUAZQBkAGIAYQBjAGsAIABzAHQA
cgBlAG4AZwB0AGgAcwAsACAAcgBlAGEAbABpAHMAZQBkACAAYQB0ACAAYQAgAHAAYQByAHQAaQBj
AHUAbABhAHIAIAB0AGkAbQBlACwAIABoAGUAbABkACAAZgBpAHgAZQBkAC4AIABUAGgAZQAgAGUA
cQB1AGEAdABpAG8AbgAgAGYAbwByACAAdABoAGUAIABmAGUAZQBkAGIAYQBjAGsAIABwAGEAcgBh
AG0AZQB0AGUAcgAgAHQAaABlAG4AIABpAG4AYwBsAHUAZABlAHMAIABhACAAaABlAGEAdAAgAGYA
bAB1AHgAIABiAGUAbABvAHcAIAB0AGgAZQAgAGEAdABtAG8AcwBwAGgAZQByAGUAIABkAGUAbgBv
AHQAZQBkACAARPBGACwADQANAGzwIAA9ACAAKABE8FEAIAAtACAARPBGACkAIAAvACAARPBUAA0A
DQAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAYQBuAGQAIAB0AGgAZQAgAGUAZgBmAGUAYwB0
AGkAdgBlACAAYwBsAGkAbQBhAHQAZQAgAHMAZQBuAHMAaQB0AGkAdgBpAHQAeQAgAGMAYQBuACAA
YgBlACAAZQB4AHAAcgBlAHMAcwBlAGQAIABhAHMADQANAETwVAAyAHgAZQBmAGYAIAA9ACAARPBR
ADIAeAAgAC4AIABE8FQAIAAvACAAKABE8FEAIAAtACAARPBGACkALgANAA0AVABoAGUAIABlAGYA
ZgBlAGMAdABpAHYAZQAgAGMAbABpAG0AYQB0AGUAIABzAGUAbgBzAGkAdABpAHYAaQB0AHkAIABp
AHMAIAB0AGgAdQBzACAAYQAgAGgAeQBwAG8AdABoAGUAdABpAGMAYQBsACAAYwBvAG4AYwBlAHAA
dAAgAGUAdgBlAG4AIAB3AGkAdABoAGkAbgAgAHQAaABlACAAcgBlAGEAbABtACAAbwBmACAAYwBs
AGkAbQBhAHQAZQAgAG0AbwBkAGUAbABsAGkAbgBnAAAAoQ/wAQAAWwEAAAAAABAAAFoAEwAAAAAA
ARgAAAAAAQBaAAEAAAAAAAAYAAABAFoASAAAAAAAARAAAAAAWgABAAAAAAAAEAAAWgAhAAAAAAAB
GAAAAAABAFoAAQAAAAAAABgAAAEAWgBsAAAAAAAAEAAAWgBDAAAAAAACABQAAQAAAAAAggABABQA
AQAAAAAAAgAUAAIAAAAAAAoAFADn/wMAAAAAAAoAFAAeADEAAAAAAAIAFAABAAAAAAAKABQA5//a
AAAAAAACABQAAQAAAAAAggABABQABAAAAAAAAgAUAAEAAAAAAIIAAQAUAAQAAAAAAAIAFAABAAAA
AACCAAEAFAAEAAAAAAACABQAAQAAAAAAggABABQAAgAAAAAAAgAUAAEAAAAAAAoAFADn/wIAAAAA
AAIAFAABAAAAAACCAAEAFABMAAAAAAACABQAAQAAAAAAggABABQAAQAAAAAAAgAUAAIAAAAAAAoA
FADn/wMAAAAAAAoAFAAeAAMAAAAAAAIAFAABAAAAAACCAAEAFAABAAAAAAACABQAAgAAAAAACgAU
AOf/AwAAAAAAAgAUAAEAAAAAAIIAAQAUAAUAAAAAAAIAFAABAAAAAACCAAEAFAAEAAAAAAACABQA
AQAAAAAAggABABQAcQAAAAAAAgAUAAAAqg8UAAAARQIAAAYAAAAJCAAAAQAAAAAAAAAAAPMDFAAA
AAgAAAAEAAAAAgAAAAQBAAAAAAAAAACfDwQAAAAAAAAAAACqDwoAAAABAAAAAQAAAAAAEACfDwQA
AAABAAAAAACqDwoAAAABAAAAAQAAAAAAAADzAxQAAAAFAAAABAAAAAAAAAABAQAAAAAAAAAA8wMU
AAAACQAAAAQAAAAAAAAABQEAAAAAAAAAAPMDFAAAAAoAAAAEAAAAAAAAAAYBAAAAAAAAAADzAxQA
AAALAAAABAAAAAAAAAAHAQAAAAAAAAAA8wMUAAAADAAAAAQAAAAAAAAACAEAAAAAAAAAAPMDFAAA
AA0AAAAEAAAAAAAAAAkBAAAAAAAAAADzAxQAAAAOAAAABAAAAAAAAAAKAQAAAAAAAAAA8wMUAAAA
DwAAAAQAAAAAAAAACwEAAAAAAAAAAPMDFAAAABEAAAAEAAAAAAAAAA0BAAAAAAAAAADzAxQAAAAQ
AAAABAAAAAAAAAAMAQAAAAAAAAAA6gMAAAAAAAByFwgAAAABABAArOcAAAAA9Q8cAAAADAEAACAF
AAOI5wAAqP8AAAEAAAARAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AA==

--Apple-Mail-4-259479166--

No comments:

Post a Comment